ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart61g05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CT009526.6| Pig DNA sequence from clone CH242-219E11 on chro... 42 0.65
2emb|AL591804.5| Human DNA sequence from clone RP11-457O1 on chro... 40 2.6
3gb|AC011291.8| Homo sapiens BAC clone RP11-67G7 from 2, complete... 40 2.6
4dbj|AP006201.1| Homo sapiens genomic DNA, chromosome 6, clone:RP... 40 2.6
5dbj|AP006200.1| Homo sapiens genomic DNA, chromosome 6, clone:RP... 40 2.6
6dbj|AP002528.1| Homo sapiens genomic DNA, chromosome 6q21, anti-... 40 2.6
7dbj|AB042234.1| Homo sapiens genomic DNA, chromosome 6q21, clone... 40 2.6

>emb|CT009526.6| Pig DNA sequence from clone CH242-219E11 on chromosome 17, complete
             sequence
          Length = 100904

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 167   ctctggaaaatgcaagggact 187
             |||||||||||||||||||||
Sbjct: 78910 ctctggaaaatgcaagggact 78890



to top

>emb|AL591804.5| Human DNA sequence from clone RP11-457O1 on chromosome X, complete
             sequence
          Length = 112366

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    ctgcatactatctttttcca 92
             ||||||||||||||||||||
Sbjct: 90051 ctgcatactatctttttcca 90032



to top

>gb|AC011291.8| Homo sapiens BAC clone RP11-67G7 from 2, complete sequence
          Length = 150214

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 51    tagaatatgaaaagcagtctaact 74
             |||||||||| |||||||||||||
Sbjct: 57275 tagaatatgataagcagtctaact 57298



to top

>dbj|AP006201.1| Homo sapiens genomic DNA, chromosome 6, clone:RP11-79K22, complete
              sequence
          Length = 172172

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     atactggacatagtacatag 53
              ||||||||||||||||||||
Sbjct: 137962 atactggacatagtacatag 137943



to top

>dbj|AP006200.1| Homo sapiens genomic DNA, chromosome 6, clone:RP11-688E1, complete
             sequence
          Length = 159019

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    atactggacatagtacatag 53
             ||||||||||||||||||||
Sbjct: 34378 atactggacatagtacatag 34359



to top

>dbj|AP002528.1| Homo sapiens genomic DNA, chromosome 6q21, anti-oncogene region,
             section 1/4
          Length = 300000

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    atactggacatagtacatag 53
             ||||||||||||||||||||
Sbjct: 90852 atactggacatagtacatag 90833



to top

>dbj|AB042234.1| Homo sapiens genomic DNA, chromosome 6q21, clone:353I20, complete
             sequence
          Length = 143320

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    atactggacatagtacatag 53
             ||||||||||||||||||||
Sbjct: 90852 atactggacatagtacatag 90833


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,085,113
Number of Sequences: 3902068
Number of extensions: 2085113
Number of successful extensions: 143966
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 143943
Number of HSP's gapped (non-prelim): 23
length of query: 204
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 182
effective length of database: 17,147,199,772
effective search space: 3120790358504
effective search space used: 3120790358504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top