ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart61g03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_383336.1| Gibberella zeae PH-1 chromosome 2 conserved hyp... 74 3e-10
2gb|AE017350.1| Cryptococcus neoformans var. neoformans JEC21 chr... 72 1e-09
3ref|XM_567550.1| Cryptococcus neoformans var. neoformans JEC21 d... 72 1e-09
4ref|XM_655240.1| Aspergillus nidulans FGSC A4 hypothetical prote... 54 3e-04
5emb|CT010524.6| Mouse DNA sequence from clone RP23-341L7 on chro... 40 4.7
6gb|AC109630.2| Homo sapiens chromosome 15, clone RP11-624L4, com... 40 4.7

>ref|XM_383336.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein
           (FG03160.1) partial mRNA
          Length = 927

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                       
Query: 205 aggatacctcgggcgaccaaggcgtgcttcagagcgacggtaccttccatgtgagatcct 264
           ||||| |||||||| ||||  |||||||| ||||| ||||| || ||||||||||| || 
Sbjct: 824 aggatgcctcgggcaaccagagcgtgcttgagagcaacggtgccctccatgtgagagcca 765

                                                                
Query: 265 cgatggtagaccgctttggtgaccgggagaagacggtcgtggatctcccgagc 317
           || |||||||| || || ||||| || |||||  ||||||||||||| |||||
Sbjct: 764 cggtggtagacagcctttgtgacaggcagaagctggtcgtggatctcacgagc 712



to top

>gb|AE017350.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 10, complete
              sequence
          Length = 1085720

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Minus

                                                                          
Query: 172    ggcaagagggtacctcggatctgggcgtgcttgaggatacctcgggcgaccaaggcgtgc 231
              ||||| ||||||||||||||   |||||| |||||||| || ||||| |||| ||| |||
Sbjct: 751944 ggcaaaagggtacctcggatggtggcgtgtttgaggatcccacgggcaaccagggcatgc 751885

                                                          
Query: 232    ttcagagcgacggtaccttccatgtgagatcctcgatggtagac 275
              || ||||||||||| || |||||||| || || || ||||||||
Sbjct: 751884 ttgagagcgacggtgccctccatgtgggagccacggtggtagac 751841



to top

>ref|XM_567550.1| Cryptococcus neoformans var. neoformans JEC21 dihydrodipicolinate
            synthase DapA (CNJ02600) partial mRNA
          Length = 1152

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 87/104 (83%)
 Strand = Plus / Minus

                                                                        
Query: 172  ggcaagagggtacctcggatctgggcgtgcttgaggatacctcgggcgaccaaggcgtgc 231
            ||||| ||||||||||||||   |||||| |||||||| || ||||| |||| ||| |||
Sbjct: 1082 ggcaaaagggtacctcggatggtggcgtgtttgaggatcccacgggcaaccagggcatgc 1023

                                                        
Query: 232  ttcagagcgacggtaccttccatgtgagatcctcgatggtagac 275
            || ||||||||||| || |||||||| || || || ||||||||
Sbjct: 1022 ttgagagcgacggtgccctccatgtgggagccacggtggtagac 979



to top

>ref|XM_655240.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN2728.2), mRNA
          Length = 930

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 83/99 (83%), Gaps = 2/99 (2%)
 Strand = Plus / Minus

                                                                       
Query: 211 cctcgggcgaccaaggcgtgcttcagagcgacggtaccttccatgtgagatcctcgatgg 270
           |||||||| ||||| ||||| |||| ||| || || || |||||||| ||||| || || 
Sbjct: 821 cctcgggccaccaatgcgtgtttcaaagcaacagtcccctccatgtgcgatccacggtga 762

                                                  
Query: 271 tagaccgct-ttggtgaccgggagaagacggtcgtggat 308
           ||||| ||| ||||| ||||||||||| |||||||||||
Sbjct: 761 tagac-gctcttggtcaccgggagaagccggtcgtggat 724



to top

>emb|CT010524.6| Mouse DNA sequence from clone RP23-341L7 on chromosome 16, complete
              sequence
          Length = 233599

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 68     ttcctttcatgggattatca 87
              ||||||||||||||||||||
Sbjct: 175155 ttcctttcatgggattatca 175136



to top

>gb|AC109630.2| Homo sapiens chromosome 15, clone RP11-624L4, complete sequence
          Length = 163976

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 161    cgtcctccagaggcaagagg 180
              ||||||||||||||||||||
Sbjct: 111081 cgtcctccagaggcaagagg 111062


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,657,203
Number of Sequences: 3902068
Number of extensions: 1657203
Number of successful extensions: 27398
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27385
Number of HSP's gapped (non-prelim): 13
length of query: 354
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 332
effective length of database: 17,147,199,772
effective search space: 5692870324304
effective search space used: 5692870324304
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top