Clone Name | rbart61f09 |
---|---|
Clone Library Name | barley_pub |
>emb|AJ318884.1|TTU318884 Triticum turgidum subsp. durum xip-II gene for putative xylanase inhibitor protein Length = 2143 Score = 67.9 bits (34), Expect = 2e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 223 tcccagaccatgaccccgccatagttggccgccttctgcacc 264 ||||||||||||||||||||||||||| ||||||||||||| Sbjct: 1886 tcccagaccatgaccccgccatagttgttcgccttctgcacc 1845
>dbj|AB204556.1| Triticum aestivum Xip-III gene for xylanase inhibitor XIP-III, complete cds Length = 934 Score = 50.1 bits (25), Expect = 0.004 Identities = 40/45 (88%) Strand = Plus / Minus Query: 223 tcccagaccatgaccccgccatagttggccgccttctgcaccacc 267 ||||||| |||||||||||| |||||| || ||||||||||||| Sbjct: 877 tcccagagcatgaccccgccgtagttgtccttcttctgcaccacc 833
>emb|AL929214.6| Mouse DNA sequence from clone RP23-195I21 on chromosome 2, complete sequence Length = 43009 Score = 50.1 bits (25), Expect = 0.004 Identities = 25/25 (100%) Strand = Plus / Minus Query: 90 gcaagcacatgcacatgcacatgca 114 ||||||||||||||||||||||||| Sbjct: 8647 gcaagcacatgcacatgcacatgca 8623
>ref|NM_193094.1| Oryza sativa (japonica cultivar-group), mRNA Length = 951 Score = 48.1 bits (24), Expect = 0.015 Identities = 36/40 (90%) Strand = Plus / Minus Query: 223 tcccagaccatgaccccgccatagttggccgccttctgca 262 ||||||| ||||| ||||| ||||||||||||||||||| Sbjct: 896 tcccagatcatgaagccgccgtagttggccgccttctgca 857
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 48.1 bits (24), Expect = 0.015 Identities = 36/40 (90%) Strand = Plus / Minus Query: 223 tcccagaccatgaccccgccatagttggccgccttctgca 262 ||||||| ||||| ||||| ||||||||||||||||||| Sbjct: 26162457 tcccagatcatgaagccgccgtagttggccgccttctgca 26162418
>dbj|AK111717.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023022A01, full insert sequence Length = 1165 Score = 48.1 bits (24), Expect = 0.015 Identities = 36/40 (90%) Strand = Plus / Minus Query: 223 tcccagaccatgaccccgccatagttggccgccttctgca 262 ||||||| ||||| ||||| ||||||||||||||||||| Sbjct: 944 tcccagatcatgaagccgccgtagttggccgccttctgca 905
>dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0519E12 Length = 152448 Score = 48.1 bits (24), Expect = 0.015 Identities = 36/40 (90%) Strand = Plus / Minus Query: 223 tcccagaccatgaccccgccatagttggccgccttctgca 262 ||||||| ||||| ||||| ||||||||||||||||||| Sbjct: 54315 tcccagatcatgaagccgccgtagttggccgccttctgca 54276
>gb|U83904.1|HVU83904 Hordeum vulgare lipoxygenase isoenzyme 1 (Lox:Hv1) gene, promoter region and partial cds Length = 5236 Score = 46.1 bits (23), Expect = 0.059 Identities = 23/23 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgcagt 116 ||||||||||||||||||||||| Sbjct: 3181 gcacatgcacatgcacatgcagt 3203
>gb|AC127290.3| Mus musculus BAC clone RP23-364F13 from chromosome 5, complete sequence Length = 187121 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 caagcacatgcacatgcacatg 112 |||||||||||||||||||||| Sbjct: 101713 caagcacatgcacatgcacatg 101734
>emb|CR716376.2|CNS0GFPD Tetraodon nigroviridis full-length cDNA Length = 952 Score = 44.1 bits (22), Expect = 0.23 Identities = 22/22 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgcag 115 |||||||||||||||||||||| Sbjct: 451 gcacatgcacatgcacatgcag 472 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 446 cacatgcacatgcacatgca 465
>ref|NM_101931.2| Arabidopsis thaliana unknown protein AT1G20790 mRNA, complete cds Length = 1308 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 1101 gcacatgcacatgcacatgca 1121 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 1107 gcacatgcacatgcacatgc 1126
>gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, complete sequence Length = 186266 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 168582 gcacatgcacatgcacatgca 168602 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 168576 gcacatgcacatgcacatgca 168596
>gb|AC167164.6| Mus musculus chromosome 7, clone RP24-276M8, complete sequence Length = 171048 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 65280 gcacatgcacatgcacatgca 65300 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 65274 gcacatgcacatgcacatgca 65294 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 65268 gcacatgcacatgcacatgca 65288 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 65262 gcacatgcacatgcacatgca 65282 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 65256 gcacatgcacatgcacatgca 65276
>gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, complete sequence Length = 171409 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 118959 gcacatgcacatgcacatgca 118979
>gb|AC155300.2| Mus musculus BAC clone RP24-232D3 from chromosome 12, complete sequence Length = 176261 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 109047 gcacatgcacatgcacatgca 109027 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 109041 gcacatgcacatgcacatgca 109021 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 109035 gcacatgcacatgcacatgca 109015 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 109029 gcacatgcacatgcacatgca 109009 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 109023 gcacatgcacatgcacatgca 109003 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 109017 gcacatgcacatgcacatgca 108997 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 109052 cacatgcacatgcacatgca 109033
>gb|AC155235.2| Mus musculus BAC clone RP24-406H23 from chromosome 12, complete sequence Length = 158341 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 12885 gcacatgcacatgcacatgca 12865 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 12879 gcacatgcacatgcacatgca 12859 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 12873 gcacatgcacatgcacatgca 12853 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 12867 gcacatgcacatgcacatgca 12847 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 12861 gcacatgcacatgcacatgca 12841 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 12855 gcacatgcacatgcacatgca 12835 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 12890 cacatgcacatgcacatgca 12871
>gb|AC161580.12| Mus musculus chromosome 3, clone RP23-422D10, complete sequence Length = 224193 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 96469 gcacatgcacatgcacatgca 96449
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 3539276 gcacatgcacatgcacatgca 3539256 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 3539270 gcacatgcacatgcacatgca 3539250
>gb|AC117807.7| Mus musculus chromosome 8, clone RP24-568P2, complete sequence Length = 175586 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgcag 115 ||||||||||||||||||||| Sbjct: 54154 cacatgcacatgcacatgcag 54174
>gb|AC139025.9| Mus musculus chromosome 8, clone RP23-426K13, complete sequence Length = 203230 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgcag 115 ||||||||||||||||||||| Sbjct: 181556 cacatgcacatgcacatgcag 181536
>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence Length = 1130447 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 859544 gcacatgcacatgcacatgca 859564
>gb|AC166648.4| Mus musculus chromosome 5, clone RP23-102C14, complete sequence Length = 203566 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 158681 gcacatgcacatgcacatgca 158701 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 158687 gcacatgcacatgcacatgc 158706
>gb|AC115968.10| Mus musculus chromosome 1, clone RP24-72P6, complete sequence Length = 229959 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 29909 gcacatgcacatgcacatgca 29929
>gb|AC168275.4| Mus musculus 10 BAC RP23-350O21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 188458 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgcag 115 ||||||||||||||||||||| Sbjct: 45613 cacatgcacatgcacatgcag 45633
>gb|AC168276.3| Mus musculus BAC RP24-485I12 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 186675 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgcag 115 ||||||||||||||||||||| Sbjct: 159516 cacatgcacatgcacatgcag 159536
>gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete sequence Length = 185670 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 183297 gcacatgcacatgcacatgca 183317
>gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, complete sequence Length = 207418 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 90180 gcacatgcacatgcacatgca 90160 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 90185 cacatgcacatgcacatgca 90166
>gb|AC134795.10| Mus musculus chromosome 15, clone RP24-456M21, complete sequence Length = 166650 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 129383 gcacatgcacatgcacatgca 129363 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 129377 gcacatgcacatgcacatgca 129357
>gb|AY687385.1| Pelodiscus sinensis mitochondrion, complete genome Length = 17364 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16787 gcacatgcacatgcacatgca 16807 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16781 gcacatgcacatgcacatgca 16801 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16775 gcacatgcacatgcacatgca 16795 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16769 gcacatgcacatgcacatgca 16789 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16763 gcacatgcacatgcacatgca 16783 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16757 gcacatgcacatgcacatgca 16777 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16649 gcacatgcacatgcacatgca 16669 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16643 gcacatgcacatgcacatgca 16663 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16637 gcacatgcacatgcacatgca 16657 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16631 gcacatgcacatgcacatgca 16651 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16625 gcacatgcacatgcacatgca 16645 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16619 gcacatgcacatgcacatgca 16639 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16613 gcacatgcacatgcacatgca 16633 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16607 gcacatgcacatgcacatgca 16627 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16601 gcacatgcacatgcacatgca 16621 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16595 gcacatgcacatgcacatgca 16615 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16589 gcacatgcacatgcacatgca 16609 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16583 gcacatgcacatgcacatgca 16603 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16577 gcacatgcacatgcacatgca 16597 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16571 gcacatgcacatgcacatgca 16591 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16565 gcacatgcacatgcacatgca 16585 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16559 gcacatgcacatgcacatgca 16579 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16553 gcacatgcacatgcacatgca 16573 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 16752 cacatgcacatgcacatgca 16771
>gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosome 8, complete sequence Length = 183218 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 68833 gcacatgcacatgcacatgca 68853
>gb|AC147263.3| Mus musculus BAC clone RP24-213I13 from chromosome 13, complete sequence Length = 182371 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 11344 gcacatgcacatgcacatgca 11324
>gb|AC142270.4| Mus musculus BAC clone RP24-115G23 from chromosome 3, complete sequence Length = 170870 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 42080 gcacatgcacatgcacatgca 42060
>gb|AC102369.21| Mus musculus chromosome 12, clone RP23-246F14, complete sequence Length = 214580 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59875 gcacatgcacatgcacatgca 59855 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59869 gcacatgcacatgcacatgca 59849 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59863 gcacatgcacatgcacatgca 59843 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59857 gcacatgcacatgcacatgca 59837 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59851 gcacatgcacatgcacatgca 59831 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59845 gcacatgcacatgcacatgca 59825 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 59880 cacatgcacatgcacatgca 59861
>gb|AC150413.2| Branchiostoma floridae clone CH302-61A17, complete sequence Length = 240260 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 226264 gcacatgcacatgcacatgca 226244 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 226269 cacatgcacatgcacatgca 226250
>gb|AC158951.5| Mus musculus chromosome 8, clone RP23-265B11, complete sequence Length = 191700 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 155892 gcacatgcacatgcacatgca 155912 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 155887 cacatgcacatgcacatgca 155906
>gb|AC129567.8| Mus musculus chromosome 8, clone RP23-50L10, complete sequence Length = 228046 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 88701 gcacatgcacatgcacatgca 88721
>gb|AC164300.3| Mus musculus BAC clone RP23-310J6 from chromosome 8, complete sequence Length = 200605 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 179708 gcacatgcacatgcacatgca 179728
>gb|AC101787.11| Mus musculus chromosome 1, clone RP24-147F6, complete sequence Length = 172617 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59989 gcacatgcacatgcacatgca 59969 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59983 gcacatgcacatgcacatgca 59963 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59977 gcacatgcacatgcacatgca 59957 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59971 gcacatgcacatgcacatgca 59951 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59965 gcacatgcacatgcacatgca 59945 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59959 gcacatgcacatgcacatgca 59939 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 59953 gcacatgcacatgcacatgca 59933 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 59994 cacatgcacatgcacatgca 59975
>gb|AC118702.8| Mus musculus chromosome 5, clone RP24-166J1, complete sequence Length = 171263 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 4155 gcacatgcacatgcacatgca 4135 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 4149 gcacatgcacatgcacatgca 4129
>gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, complete sequence Length = 190888 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 149713 gcacatgcacatgcacatgca 149733 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 149707 gcacatgcacatgcacatgca 149727 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 149702 cacatgcacatgcacatgca 149721
>gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome 7, complete sequence Length = 207234 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 137950 gcacatgcacatgcacatgca 137930 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 137944 gcacatgcacatgcacatgca 137924 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 137938 gcacatgcacatgcacatgca 137918 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 137932 gcacatgcacatgcacatgca 137912 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 137926 gcacatgcacatgcacatgca 137906 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 137920 gcacatgcacatgcacatgca 137900 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 137914 gcacatgcacatgcacatgca 137894 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 137908 gcacatgcacatgcacatgca 137888 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 137902 gcacatgcacatgcacatgca 137882 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 137896 gcacatgcacatgcacatgca 137876 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 137890 gcacatgcacatgcacatgca 137870 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 137884 gcacatgcacatgcacatgca 137864
>emb|CR936412.13| Zebrafish DNA sequence from clone DKEY-181M21 in linkage group 18, complete sequence Length = 151872 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 140340 gcacatgcacatgcacatgca 140320 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 140334 gcacatgcacatgcacatgca 140314
>gb|AC147546.1| Rattus norvegicus chromosome 1 clone RP32-323A19 map q33, complete sequence Length = 118946 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 91027 gcacatgcacatgcacatgca 91007
>gb|AC132430.3| Mus musculus BAC clone RP23-208D22 from chromosome 9, complete sequence Length = 192991 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 96817 gcacatgcacatgcacatgca 96837
>gb|AC123843.4| Mus musculus BAC clone RP23-407D18 from chromosome 8, complete sequence Length = 205875 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 113309 gcacatgcacatgcacatgca 113329 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 113303 gcacatgcacatgcacatgca 113323 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 113297 gcacatgcacatgcacatgca 113317 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 113291 gcacatgcacatgcacatgca 113311 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 113285 gcacatgcacatgcacatgca 113305 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 113279 gcacatgcacatgcacatgca 113299 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 113273 gcacatgcacatgcacatgca 113293 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 113268 cacatgcacatgcacatgca 113287
>gb|AC121946.3| Mus musculus BAC clone RP24-212F15 from chromosome 10, complete sequence Length = 181828 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16975 gcacatgcacatgcacatgca 16955 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 16980 cacatgcacatgcacatgca 16961
>gb|AC122008.4| Mus musculus BAC clone RP24-344F8 from chromosome 3, complete sequence Length = 209378 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 164877 gcacatgcacatgcacatgca 164897
>gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, complete sequence Length = 203855 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 107689 gcacatgcacatgcacatgca 107669 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 107683 gcacatgcacatgcacatgca 107663
>gb|AC121857.2| Mus musculus BAC clone RP24-98A9 from 1, complete sequence Length = 171124 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 157732 gcacatgcacatgcacatgca 157752
>gb|AC125277.1| Mus musculus BAC clone RP24-554P24 from 13, complete sequence Length = 141866 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 116030 gcacatgcacatgcacatgca 116010
>gb|AC109805.8| Mus musculus chromosome 3, clone RP23-91D14, complete sequence Length = 171006 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 40198 gcacatgcacatgcacatgca 40178
>gb|AC135605.25| Medicago truncatula clone mth2-7m1, complete sequence Length = 121648 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 68485 gcacatgcacatgcacatgca 68465
>gb|AC124964.17| Medicago truncatula clone mth2-27c4, complete sequence Length = 114519 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 51403 gcacatgcacatgcacatgca 51423
>gb|AC165165.3| Mus musculus BAC clone RP23-121B15 from chromosome 3, complete sequence Length = 228648 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 23710 gcacatgcacatgcacatgca 23730
>emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on chromosome 9 Contains a novel pseudogene, the MRPL50 gene for mitochondrial ribosomal protein L50, the ZNF189 gene for zinc finger protein 189, the ALDOB gene for aldolase B, fructose-bisphosphate, a NADH dehydrogenase (ubiquinone) 1 alpha subcomplex (NDUFA4) pseudogene, three novel genes, the 5' end of the RNF20 gene for ring finger protein 20 and three CpG islands, complete sequence Length = 164115 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 138236 gcacatgcacatgcacatgca 138216 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 138241 cacatgcacatgcacatgca 138222
>gb|AC162899.5| Mus musculus chromosome 1, clone RP24-222G3, complete sequence Length = 176916 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 145466 gcacatgcacatgcacatgca 145486 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 145460 gcacatgcacatgcacatgca 145480 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 145454 gcacatgcacatgcacatgca 145474 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 145448 gcacatgcacatgcacatgca 145468 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 145442 gcacatgcacatgcacatgca 145462 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 145436 gcacatgcacatgcacatgca 145456 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 145430 gcacatgcacatgcacatgca 145450 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 145425 cacatgcacatgcacatgca 145444
>gb|AC162946.4| Mus musculus BAC clone RP23-38M11 from chromosome 9, complete sequence Length = 183012 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 19626 gcacatgcacatgcacatgca 19606
>emb|AJ627388.1| Yersinia pseudotuberculosis adhesion pathogenicity island (YAPI), complete sequence, strain 32777 Length = 102752 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 64731 gcacatgcacatgcacatgca 64751
>emb|AJ421451.1|LCA421451 Lemur catta mitochondrion complete mitochondrial genome Length = 17036 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16410 gcacatgcacatgcacatgca 16430 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16404 gcacatgcacatgcacatgca 16424 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16398 gcacatgcacatgcacatgca 16418 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16392 gcacatgcacatgcacatgca 16412 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16386 gcacatgcacatgcacatgca 16406 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16380 gcacatgcacatgcacatgca 16400 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16374 gcacatgcacatgcacatgca 16394 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16368 gcacatgcacatgcacatgca 16388 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16362 gcacatgcacatgcacatgca 16382 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16356 gcacatgcacatgcacatgca 16376 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16350 gcacatgcacatgcacatgca 16370 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16344 gcacatgcacatgcacatgca 16364 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16338 gcacatgcacatgcacatgca 16358 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16332 gcacatgcacatgcacatgca 16352 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16326 gcacatgcacatgcacatgca 16346 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16320 gcacatgcacatgcacatgca 16340 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16314 gcacatgcacatgcacatgca 16334 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16308 gcacatgcacatgcacatgca 16328 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16302 gcacatgcacatgcacatgca 16322 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16296 gcacatgcacatgcacatgca 16316 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16290 gcacatgcacatgcacatgca 16310 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16284 gcacatgcacatgcacatgca 16304 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16278 gcacatgcacatgcacatgca 16298 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16272 gcacatgcacatgcacatgca 16292 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16266 gcacatgcacatgcacatgca 16286 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16260 gcacatgcacatgcacatgca 16280 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16254 gcacatgcacatgcacatgca 16274 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16248 gcacatgcacatgcacatgca 16268 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 16242 gcacatgcacatgcacatgca 16262
>gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, complete sequence Length = 202719 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 94992 gcacatgcacatgcacatgca 95012 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 94986 gcacatgcacatgcacatgca 95006 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 94981 cacatgcacatgcacatgca 95000
>gb|AC022018.10| Homo sapiens chromosome 10 clone RP11-214N15, complete sequence Length = 159617 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 69413 gcacatgcacatgcacatgca 69393
>gb|AC013549.9| Homo sapiens chromosome 11, clone RP11-47J17, complete sequence Length = 163180 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 99803 gcacatgcacatgcacatgca 99783
>gb|AC151617.2| Emiliania huxleyi clone JGIACCU-13M3, complete sequence Length = 33456 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13356 gcacatgcacatgcacatgca 13336 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13350 gcacatgcacatgcacatgca 13330 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13344 gcacatgcacatgcacatgca 13324 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13338 gcacatgcacatgcacatgca 13318 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13332 gcacatgcacatgcacatgca 13312 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13326 gcacatgcacatgcacatgca 13306 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13320 gcacatgcacatgcacatgca 13300 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13314 gcacatgcacatgcacatgca 13294 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13308 gcacatgcacatgcacatgca 13288 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13302 gcacatgcacatgcacatgca 13282 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13296 gcacatgcacatgcacatgca 13276 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13290 gcacatgcacatgcacatgca 13270 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13284 gcacatgcacatgcacatgca 13264 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13278 gcacatgcacatgcacatgca 13258 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13272 gcacatgcacatgcacatgca 13252 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13266 gcacatgcacatgcacatgca 13246 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13260 gcacatgcacatgcacatgca 13240 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13254 gcacatgcacatgcacatgca 13234 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13248 gcacatgcacatgcacatgca 13228 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13242 gcacatgcacatgcacatgca 13222 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13236 gcacatgcacatgcacatgca 13216 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13230 gcacatgcacatgcacatgca 13210 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13224 gcacatgcacatgcacatgca 13204 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 13218 gcacatgcacatgcacatgca 13198
>emb|BX649331.16| Zebrafish DNA sequence from clone DKEY-12N3 in linkage group 11, complete sequence Length = 252675 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 10592 gcacatgcacatgcacatgca 10612 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 10587 cacatgcacatgcacatgca 10606
>gb|AC010711.5| Drosophila melanogaster 3L BAC RP98-22D12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 187438 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 70416 gcacatgcacatgcacatgca 70436 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 70410 gcacatgcacatgcacatgca 70430
>gb|AC107326.4| Drosophila melanogaster X BAC RP98-33A8 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 177096 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 48160 gcacatgcacatgcacatgca 48140
>gb|AC100795.2| Homo sapiens chromosome 18, clone RP11-956K8, complete sequence Length = 193569 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgcag 115 ||||||||||||||||||||| Sbjct: 96146 cacatgcacatgcacatgcag 96126
>gb|AC079617.5| Homo sapiens BAC clone RP11-623K14 from 4, complete sequence Length = 112615 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 28613 gcacatgcacatgcacatgca 28593 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 28607 gcacatgcacatgcacatgca 28587 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 28618 cacatgcacatgcacatgca 28599
>gb|AC112031.4| Rattus norvegicus BAC CH230-99K18 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 242158 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgcag 115 ||||||||||||||||||||| Sbjct: 121225 cacatgcacatgcacatgcag 121245
>gb|AC099012.1| Drosophila melanogaster, chromosome 2R, region 56F-57X, BAC clone BACR23F24, complete sequence Length = 183592 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 31529 gcacatgcacatgcacatgca 31549
>gb|AC110911.18| Mus musculus chromosome 7, clone RP24-357A15, complete sequence Length = 146978 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 51702 gcacatgcacatgcacatgca 51722 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 51696 gcacatgcacatgcacatgca 51716 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 51690 gcacatgcacatgcacatgca 51710 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 51684 gcacatgcacatgcacatgca 51704 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 51678 gcacatgcacatgcacatgca 51698
>gb|AC157567.6| Mus musculus chromosome 5, clone RP23-246I12, complete sequence Length = 157519 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 89387 gcacatgcacatgcacatgca 89367 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 89381 gcacatgcacatgcacatgca 89361
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 2058901 gcacatgcacatgcacatgca 2058881 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 2058895 gcacatgcacatgcacatgca 2058875 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 2058889 gcacatgcacatgcacatgc 2058870
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 1349847 gcacatgcacatgcacatgca 1349867 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 acatgcacatgcacatgcag 115 |||||||||||||||||||| Sbjct: 13094744 acatgcacatgcacatgcag 13094763 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 1349842 cacatgcacatgcacatgca 1349861
>gb|AY843546.1| Acacia brevispica microsatellite Ab15 sequence Length = 224 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 194 gcacatgcacatgcacatgca 214
>gb|AC091657.3| Rattus norvegicus strain Brown Norway clone RP31-29N16, complete sequence Length = 141898 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 2916 gcacatgcacatgcacatgca 2896 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 2910 gcacatgcacatgcacatgca 2890 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 2904 gcacatgcacatgcacatgc 2885
>gb|AC104417.14| Homo sapiens chromosome 8, clone RP11-953B20, complete sequence Length = 186063 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgcag 115 ||||||||||||||||||||| Sbjct: 43146 cacatgcacatgcacatgcag 43166
>gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana BAC F2D10 from chromosome I, complete sequence Length = 143879 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 111625 gcacatgcacatgcacatgca 111605 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 111619 gcacatgcacatgcacatgc 111600
>gb|AC091710.3| Rattus norvegicus strain Brown Norway clone RP31-580N24, complete sequence Length = 87280 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 77034 gcacatgcacatgcacatgca 77014 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 77028 gcacatgcacatgcacatgca 77008 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 77022 gcacatgcacatgcacatgc 77003
>gb|AC117729.9| Mus musculus chromosome 8, clone RP24-126M11, complete sequence Length = 193119 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 119858 gcacatgcacatgcacatgca 119838 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 119863 cacatgcacatgcacatgca 119844
>gb|AC154311.2| Mus musculus BAC clone RP23-359C9 from 16, complete sequence Length = 194103 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 58117 gcacatgcacatgcacatgca 58097
>emb|CT571248.10| Mouse DNA sequence from clone RP24-355C16 on chromosome 16, complete sequence Length = 136128 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 60753 gcacatgcacatgcacatgca 60773 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 60747 gcacatgcacatgcacatgca 60767 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 60741 gcacatgcacatgcacatgca 60761 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 60735 gcacatgcacatgcacatgca 60755 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 60729 gcacatgcacatgcacatgca 60749 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 60724 cacatgcacatgcacatgca 60743
>gb|AC156387.5| Mus musculus 10 BAC RP24-396H15 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 230270 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgcag 115 ||||||||||||||||||||| Sbjct: 7462 cacatgcacatgcacatgcag 7482
>gb|AE003793.3| Drosophila melanogaster chromosome 2R, section 57 of 73 of the complete sequence Length = 271902 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 125790 gcacatgcacatgcacatgca 125810
>emb|AL359220.4|CNS05TEI Human chromosome 14 DNA sequence BAC R-855C23 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 196698 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 135322 gcacatgcacatgcacatgca 135342
>gb|AE003470.4| Drosophila melanogaster chromosome 3L, section 4 of 83 of the complete sequence Length = 318699 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 194964 gcacatgcacatgcacatgca 194984 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 194958 gcacatgcacatgcacatgca 194978
>emb|AL049775.2|CNS00006 Human chromosome 14 DNA sequence BAC R-497E19 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 181433 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 91 caagcacatgcacatgcacat 111 ||||||||||||||||||||| Sbjct: 123883 caagcacatgcacatgcacat 123863
>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete sequence Length = 304204 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 110470 gcacatgcacatgcacatgca 110450
>dbj|AP001980.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-264L21, complete sequence Length = 151939 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 105911 gcacatgcacatgcacatgca 105891
>dbj|AP003460.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-285P16, complete sequence Length = 171738 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 28586 gcacatgcacatgcacatgca 28566
>gb|AC115809.8| Mus musculus chromosome 8, clone RP23-416L3, complete sequence Length = 193884 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgcag 115 ||||||||||||||||||||| Sbjct: 19626 cacatgcacatgcacatgcag 19606
>gb|AC171680.5| Mus musculus chromosome 7, clone RP23-146B24, complete sequence Length = 200031 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 139469 gcacatgcacatgcacatgca 139489
>gb|AC110192.14| Mus musculus chromosome 7, clone RP23-227K15, complete sequence Length = 181287 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 158851 gcacatgcacatgcacatgca 158871
>gb|AC151998.6| Mus musculus BAC clone RP23-98L16 from chromosome 8, complete sequence Length = 219376 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 155969 gcacatgcacatgcacatgca 155949
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 1349847 gcacatgcacatgcacatgca 1349867 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 acatgcacatgcacatgcag 115 |||||||||||||||||||| Sbjct: 13049018 acatgcacatgcacatgcag 13049037 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 1349842 cacatgcacatgcacatgca 1349861
>emb|AL591417.9| Mouse DNA sequence from clone RP23-272C1 on chromosome 11, complete sequence Length = 131385 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 8084 gcacatgcacatgcacatgca 8104
>gb|AC005286.1|AC005286 Drosophila melanogaster DNA sequence (P1s DS01995 (D179), DS03499 (D217), and DS08132 (D174)), complete sequence Length = 173970 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 37904 gcacatgcacatgcacatgca 37924
>emb|BX000507.2|CNS08CDX Oryza sativa chromosome 12, . BAC OJ1003_C01 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 157453 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 79322 gcacatgcacatgcacatgca 79302 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 79327 cacatgcacatgcacatgca 79308
>emb|CT009765.9| Mouse DNA sequence from clone RP23-235B7 on chromosome 12, complete sequence Length = 197822 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 3935 gcacatgcacatgcacatgca 3955 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 3929 gcacatgcacatgcacatgca 3949 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 3923 gcacatgcacatgcacatgca 3943 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 3917 gcacatgcacatgcacatgca 3937 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 3911 gcacatgcacatgcacatgca 3931 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 3905 gcacatgcacatgcacatgca 3925 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 3900 cacatgcacatgcacatgca 3919
>gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complete sequence Length = 201762 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 161188 gcacatgcacatgcacatgca 161168
>gb|AC154344.1| Mus musculus BAC clone RP23-226G16 from 16, complete sequence Length = 171340 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 116938 gcacatgcacatgcacatgca 116958
>gb|AC134457.4| Mus musculus BAC clone RP23-340O18 from 10, complete sequence Length = 186273 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 98905 gcacatgcacatgcacatgca 98885 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 98910 cacatgcacatgcacatgca 98891
>emb|AL713990.16| Mouse DNA sequence from clone RP23-224N1 on chromosome X, complete sequence Length = 163330 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 11303 gcacatgcacatgcacatgca 11323
>emb|CT030152.4| Mouse DNA sequence from clone RP24-323G18 on chromosome 13, complete sequence Length = 129293 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 120165 gcacatgcacatgcacatgca 120185
>gb|AC163446.2| Mus musculus chromosome 5, clone RP23-151G22, complete sequence Length = 190466 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 155791 gcacatgcacatgcacatgca 155771 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 155785 gcacatgcacatgcacatgca 155765
>emb|AL671269.11| Mouse DNA sequence from clone RP23-143P22 on chromosome 4, complete sequence Length = 183416 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 70527 gcacatgcacatgcacatgca 70507
>emb|AL772402.5| Mouse DNA sequence from clone RP23-65J9 on chromosome 11, complete sequence Length = 242502 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 81189 gcacatgcacatgcacatgca 81169 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 81183 gcacatgcacatgcacatgca 81163 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 81177 gcacatgcacatgcacatgca 81157 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 81171 gcacatgcacatgcacatgca 81151
>gb|AC140979.17| Mus musculus chromosome 1, clone RP23-307M11, complete sequence Length = 209748 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 18836 gcacatgcacatgcacatgca 18816
>gb|AC163685.4| Mus musculus BAC clone RP23-4M16 from chromosome 13, complete sequence Length = 242910 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 169818 gcacatgcacatgcacatgca 169798
>emb|AL021067.1|DMC123F11 Drosophila melanogaster cosmid clone 123F11 Length = 23109 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgca 114 ||||||||||||||||||||| Sbjct: 488 gcacatgcacatgcacatgca 468
>gb|AC154262.1| Mus musculus chromosome 14 clone RP24-304G19, complete sequence Length = 162962 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 91 caagcacatgcacatgcaca 110 |||||||||||||||||||| Sbjct: 154838 caagcacatgcacatgcaca 154857
>gb|AC110560.11| Mus musculus chromosome 3, clone RP23-254K1, complete sequence Length = 156067 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 2462 cacatgcacatgcacatgca 2481
>gb|AC166650.7| Mus musculus chromosome 5, clone RP23-434O9, complete sequence Length = 207176 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 128882 gcacatgcacatgcacatgc 128901
>gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, complete sequence Length = 184600 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 53534 cacatgcacatgcacatgca 53553
>gb|AC102735.9| Mus musculus chromosome 5, clone RP24-237I4, complete sequence Length = 167871 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 107712 cacatgcacatgcacatgca 107731
>gb|AC166649.5| Mus musculus chromosome 5, clone RP23-379D24, complete sequence Length = 176315 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 96798 gcacatgcacatgcacatgc 96779
>gb|AC101716.6| Mus musculus chromosome 7, clone RP23-287I20, complete sequence Length = 182151 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 151531 cacatgcacatgcacatgca 151512
>gb|AY486602.1| Hevea brasiliensis clone mHbCIRa380 microsatellite sequences Length = 687 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 99 cacatgcacatgcacatgca 80
>gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome Length = 1838554 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tggcgtagctgctgtaattt 201 |||||||||||||||||||| Sbjct: 442767 tggcgtagctgctgtaattt 442748
>gb|AC161480.9| Mus musculus chromosome 15, clone RP23-404I10, complete sequence Length = 187202 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 157568 cacatgcacatgcacatgca 157587
>gb|AC111620.5| Rattus norvegicus 2 BAC CH230-123K4 (Children's Hospital Oakland Research Institute) complete sequence Length = 59971 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 41983 cacatgcacatgcacatgca 42002
>gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome Length = 1899877 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tggcgtagctgctgtaattt 201 |||||||||||||||||||| Sbjct: 475367 tggcgtagctgctgtaattt 475348
>gb|AC148336.4| Mus musculus BAC clone RP23-21J15 from chromosome 18, complete sequence Length = 238060 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 234459 cacatgcacatgcacatgca 234478
>gb|AE006511.1| Streptococcus pyogenes M1 GAS, section 40 of 167 of the complete genome Length = 11131 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tggcgtagctgctgtaattt 201 |||||||||||||||||||| Sbjct: 6815 tggcgtagctgctgtaattt 6796
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 2104564 gcacatgcacatgcacatgc 2104583
>gb|AC091268.2| Rattus norvegicus strain Brown Norway clone RP31-536L14, complete sequence Length = 148631 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 39531 gcacatgcacatgcacatgc 39550
>gb|AC147502.2| Mus musculus BAC clone RP23-111N9 from chromosome 7, complete sequence Length = 202934 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 5745 cacatgcacatgcacatgca 5726
>gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome Length = 1937111 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tggcgtagctgctgtaattt 201 |||||||||||||||||||| Sbjct: 457540 tggcgtagctgctgtaattt 457521
>gb|CP000261.1| Streptococcus pyogenes MGAS2096, complete genome Length = 1860355 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tggcgtagctgctgtaattt 201 |||||||||||||||||||| Sbjct: 447756 tggcgtagctgctgtaattt 447737
>gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome Length = 1928252 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tggcgtagctgctgtaattt 201 |||||||||||||||||||| Sbjct: 444861 tggcgtagctgctgtaattt 444842
>gb|CP000259.1| Streptococcus pyogenes MGAS9429, complete genome Length = 1836467 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tggcgtagctgctgtaattt 201 |||||||||||||||||||| Sbjct: 445846 tggcgtagctgctgtaattt 445827
>gb|AC156620.10| Mus musculus chromosome 5, clone RP23-80G18, complete sequence Length = 248320 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 91 caagcacatgcacatgcacatgca 114 |||||||||||||| ||||||||| Sbjct: 218760 caagcacatgcacaggcacatgca 218737
>gb|AC163328.6| Mus musculus chromosome 5, clone RP24-405J8, complete sequence Length = 141045 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 84001 gcacatgcacatgcacatgc 84020
>gb|AC109204.21| Mus musculus chromosome 17, clone RP23-55J9, complete sequence Length = 245496 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 5695 cacatgcacatgcacatgca 5676
>gb|AC165344.3| Mus musculus BAC clone RP23-390P7 from chromosome 16, complete sequence Length = 193532 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 119761 cacatgcacatgcacatgca 119742
>gb|AC166370.3| Mus musculus BAC clone RP23-20I24 from chromosome 9, complete sequence Length = 242229 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 69671 gcacatgcacatgcacatgc 69690
>gb|AC101796.8| Mus musculus chromosome 1, clone RP24-206P18, complete sequence Length = 171181 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 43169 cacatgcacatgcacatgca 43188
>gb|AC139940.5| Mus musculus chromosome 15, clone RP23-468K16, complete sequence Length = 212183 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 33272 cacatgcacatgcacatgca 33291
>gb|AC138093.7| Mus musculus chromosome 16, clone RP24-559J21, complete sequence Length = 123569 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 74233 cacatgcacatgcacatgca 74252
>gb|AC107667.12| Mus musculus chromosome 3, clone RP23-187C2, complete sequence Length = 229632 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 106204 cacatgcacatgcacatgca 106185
>emb|CT009736.8| Mouse DNA sequence from clone RP23-99F22 on chromosome 17, complete sequence Length = 210326 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 26450 cacatgcacatgcacatgca 26431
>emb|CR352310.15| Zebrafish DNA sequence from clone CH211-254E10 in linkage group 24, complete sequence Length = 181023 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 91 caagcacatgcacatgcaca 110 |||||||||||||||||||| Sbjct: 53191 caagcacatgcacatgcaca 53210
>emb|AJ418636.1|SAU418636 Sparus aurata satellite DNA, clone SAdi-IMBB05 Length = 374 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 39 cacatgcacatgcacatgca 58
>gb|AC124728.5| Mus musculus BAC clone RP23-470C22 from chromosome 6, complete sequence Length = 183845 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 141307 cacatgcacatgcacatgca 141326
>gb|AC138768.3| Mus musculus BAC clone RP24-465E14 from chromosome 18, complete sequence Length = 158065 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 51571 cacatgcacatgcacatgca 51552
>emb|CR388124.15| Zebrafish DNA sequence from clone CH211-72C8 in linkage group 15, complete sequence Length = 173535 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 tcgttttattattgtatata 44 |||||||||||||||||||| Sbjct: 146686 tcgttttattattgtatata 146667
>gb|AC124429.4| Mus musculus BAC clone RP24-239N4 from chromosome 13, complete sequence Length = 168858 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 153982 cacatgcacatgcacatgca 154001
>gb|AC124483.4| Mus musculus BAC clone RP24-127J3 from chromosome 5, complete sequence Length = 134272 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 15578 gcacatgcacatgcacatgc 15597
>gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, complete sequence Length = 189936 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 15523 cacatgcacatgcacatgca 15504
>gb|AC124184.3| Mus musculus BAC clone RP23-227N23 from 10, complete sequence Length = 182135 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 147254 cacatgcacatgcacatgca 147273
>emb|CR925759.7| Wallaby DNA sequence from clone MEKBa-346C2, complete sequence Length = 146757 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 86 gtaagcaagcacatgcacatgcacatgc 113 ||||||| ||||||||||| |||||||| Sbjct: 84905 gtaagcatgcacatgcacacgcacatgc 84932
>emb|CR936483.10| Human DNA sequence from clone DAAP-35D11 on chromosome 6, complete sequence Length = 67632 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 catgcacatgcacatgcagt 116 |||||||||||||||||||| Sbjct: 2471 catgcacatgcacatgcagt 2452
>gb|AC113316.14| Mus musculus chromosome 5, clone RP23-441I24, complete sequence Length = 247892 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 165924 cacatgcacatgcacatgca 165943
>gb|AC021218.9| Homo sapiens BAC clone RP11-525O1 from 7, complete sequence Length = 159482 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 27288 cacatgcacatgcacatgca 27269
>gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, complete sequence Length = 137137 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 76350 cacatgcacatgcacatgca 76331
>gb|AC164001.4| Mus musculus chromosome 7, clone RP23-332G12, complete sequence Length = 190345 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 57942 cacatgcacatgcacatgca 57961
>gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome Length = 1897573 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tggcgtagctgctgtaattt 201 |||||||||||||||||||| Sbjct: 445356 tggcgtagctgctgtaattt 445337
>gb|AC163994.4| Mus musculus chromosome 1, clone RP24-132H2, complete sequence Length = 160383 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 64270 cacatgcacatgcacatgca 64289
>emb|BX927314.11| Zebrafish DNA sequence from clone DKEYP-88H4 in linkage group 14, complete sequence Length = 79737 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 91 caagcacatgcacatgcaca 110 |||||||||||||||||||| Sbjct: 32759 caagcacatgcacatgcaca 32740
>emb|Z81008.1|HS369O24 Human DNA sequence from clone RP3-369O24 on chromosome X Contains part of the ODZ1 gene for odz, odd Oz/ten-m homolog 1(Drosophila), complete sequence Length = 110180 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 107146 cacatgcacatgcacatgca 107165
>emb|BX000688.11| Human DNA sequence from clone DAQB-36F16 on chromosome 6 Contains the GPR53P pseudogene for G protein-coupled receptor 53, the OR2I1P pseudogene for olfactory receptor, family 2, subfamily I, member 1, the UBD gene for ubiquitin D, the OR2H5P pseudogene for olfactory receptor, family 2, subfamily H, member 5, the RPL13AP pseudogene for ribosomal protein L13a, the OR2H2 gene for olfactory receptor, family 2, subfamily H, member 2, the GABBR1 gene for gamma-aminobutyric acid (GABA) B receptor, 1, and 3 CpG islands, complete sequence Length = 102684 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 catgcacatgcacatgcagt 116 |||||||||||||||||||| Sbjct: 75647 catgcacatgcacatgcagt 75628
>emb|AL662826.11| Human DNA sequence from clone XXbac-101I20 on chromosome 6 contains a MAS1 oncogene pseudogene, a olfactory receptor, family 2, subfamily I, member 1 pseudogene (OR2I1P, HS6M1-14P), the UBD gene for ubiquitin D (FAT10), a olfactory receptor, family 2, subfamily H, member 5 pseudogene (OR2H5P, HS6M1-13P), a 60S ribosomal protein L13A (RPL13A) pseudogene, the OR2H2 gene for olfactory receptor, family 2, subfamily H, member 2 (HS6M1-12), the GABBR1 gene for gamma-aminobutryic acid (GABA) B receptor, 1 (GPRC3A, GABABR1), the 5' end of the MOG gene for myelin oligodendrocyte protein and three CpG islands, complete sequence Length = 145431 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 catgcacatgcacatgcagt 116 |||||||||||||||||||| Sbjct: 82068 catgcacatgcacatgcagt 82049
>emb|AL645936.5| Human DNA sequence from clone XXbac-126D10 on chromosome 6 contains the OR2H2 gene for olfactory receptor, family 2, subfamily H, member 2, the OR2I1P and OR2H5P pseudogenes for olfactory receptor, family 2, subfamily I, member 1 and subfamily H, member 5, the UBD gene for ubiquitin D, a 60S ribosomal protein L13A (RPL13A) pseudogene, the GABBR1 gene for gamma-aminobutyric acid (GABA) B receptor, 1, a SMT3 suppressor of mif two 3 homolog 1 (SMT3H1) pseudogene, the MOG gene for myelin oligodendrocyte glycoprotein, the gene for a novel KRAB box-containing C2H2 type zinc finger protein and four CpG islands, complete sequence Length = 155874 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 catgcacatgcacatgcagt 116 |||||||||||||||||||| Sbjct: 58940 catgcacatgcacatgcagt 58921
>emb|AL353896.12| Human DNA sequence from clone RP11-390J12 on chromosome 13, complete sequence Length = 89264 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 29 tttattattgtatataaagcacac 52 ||||||||| |||||||||||||| Sbjct: 37818 tttattattatatataaagcacac 37795
>gb|AC158571.3| Mus musculus chromosome 3, clone RP23-117E23, complete sequence Length = 197545 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 156696 cacatgcacatgcacatgca 156715
>gb|AC158575.3| Mus musculus chromosome 7, clone RP23-275H16, complete sequence Length = 221489 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 37710 cacatgcacatgcacatgca 37691
>gb|AC113633.5| Rattus norvegicus 4 BAC CH230-350N19 (Children's Hospital Oakland Research Institute) complete sequence Length = 133392 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 65791 gcacatgcacatgcacatgc 65772
>gb|AC010053.7| Drosophila melanogaster 3L BAC RP98-6H19 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 128765 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 4839 gcacatgcacatgcacatgc 4820
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 266151 gcacatgcacatgcacatgc 266170
>gb|BC094506.1| Mus musculus mucin 15, mRNA (cDNA clone MGC:106271 IMAGE:5341608), complete cds Length = 3092 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 2251 cacatgcacatgcacatgca 2232
>gb|BC038066.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:3489729) Length = 2096 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 1254 cacatgcacatgcacatgca 1235
>gb|BC020027.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:3666894) Length = 2070 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 1230 cacatgcacatgcacatgca 1211
>gb|BC048853.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:5150458), with apparent retained intron Length = 2194 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 1354 cacatgcacatgcacatgca 1335
>gb|BC055469.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:4024476), partial cds Length = 2433 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 1593 cacatgcacatgcacatgca 1574
>gb|AC117661.20| Mus musculus chromosome 6, clone RP23-343P1, complete sequence Length = 180209 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 30422 cacatgcacatgcacatgca 30403
>emb|CR407571.9| Zebrafish DNA sequence from clone CH211-140C16 in linkage group 1, complete sequence Length = 161017 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 110167 cacatgcacatgcacatgca 110186
>emb|AL646096.8| Mouse DNA sequence from clone RP23-176J13 on chromosome 11 Contains the 5' end of the Scpep1 gene for serine carboxypeptidase 1, two transcription elongation factor B (SIII) polypeptide 2 (Tceb2) pseudogenes, four novel genes (incl. A930013B10Rik), the Coil gene for coilin, the Trim25 gene for tripartite motif protein 25 and the Dgke gene for diacylglycerol kinase epsilon, complete sequence Length = 171512 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 96100 cacatgcacatgcacatgca 96081
>gb|AC078925.18| Homo sapiens 12q BAC RP11-76C10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 153284 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 115612 cacatgcacatgcacatgca 115593
>emb|BX647858.1|HSM808004 Homo sapiens genomic DNA; cDNA DKFZp313K1416 (from clone DKFZp313K1416) Length = 2410 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 430 cacatgcacatgcacatgca 411
>emb|CR759766.5| Human DNA sequence from clone DAMA-BMC177C8 on chromosome 6, complete sequence Length = 127280 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 catgcacatgcacatgcagt 116 |||||||||||||||||||| Sbjct: 53966 catgcacatgcacatgcagt 53947
>emb|CR450726.6| Zebrafish DNA sequence from clone CH211-149F21 in linkage group 5, complete sequence Length = 93211 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 tcgttttattattgtatata 44 |||||||||||||||||||| Sbjct: 19088 tcgttttattattgtatata 19069
>emb|AL714006.13| Mouse DNA sequence from clone RP23-173E15 on chromosome 4 Contains a novel gene and the 3' end of a novel gene, complete sequence Length = 196097 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 14871 cacatgcacatgcacatgca 14852
>emb|CR457461.7| Zebrafish DNA sequence from clone DKEY-23O10 in linkage group 14, complete sequence Length = 213600 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 91 caagcacatgcacatgcaca 110 |||||||||||||||||||| Sbjct: 41131 caagcacatgcacatgcaca 41112
>gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, complete sequence Length = 223809 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 91 caagcacatgcacatgcacatgca 114 |||||||||||||| ||||||||| Sbjct: 182132 caagcacatgcacaggcacatgca 182155
>emb|CR759870.6| Human DNA sequence from clone DADB-225M10 on chromosome 6, complete sequence Length = 57743 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 catgcacatgcacatgcagt 116 |||||||||||||||||||| Sbjct: 30792 catgcacatgcacatgcagt 30773
>emb|CR388210.7| Human DNA sequence from clone DAMA-186H17 on chromosome 6, complete sequence Length = 64196 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 catgcacatgcacatgcagt 116 |||||||||||||||||||| Sbjct: 20317 catgcacatgcacatgcagt 20298
>gb|AC009779.18| Homo sapiens 12 BAC RP11-644F5 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 192550 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 35938 cacatgcacatgcacatgca 35919
>emb|AL928605.22| Mouse DNA sequence from clone RP23-139P14 on chromosome 4, complete sequence Length = 209024 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 186478 cacatgcacatgcacatgca 186497
>emb|BX537453.3|RN86L3 Rattus norvegicus chromosome 1 BAC RP32-86L3, complete sequence Length = 154099 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 85284 cacatgcacatgcacatgca 85265
>gb|AC010033.8| Drosophila melanogaster 3L BAC RP98-3I5 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 188653 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 131326 gcacatgcacatgcacatgc 131307
>gb|AC170742.3| Sorex araneus clone SA_Ba-580J7, complete sequence Length = 156998 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 35047 cacatgcacatgcacatgca 35066
>gb|AE009996.1| Streptococcus pyogenes strain MGAS8232, section 44 of 173 of the complete genome Length = 11130 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tggcgtagctgctgtaattt 201 |||||||||||||||||||| Sbjct: 6816 tggcgtagctgctgtaattt 6797
>gb|AC021979.6| Homo sapiens chromosome 15, clone RP11-30G8, complete sequence Length = 190692 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 27347 cacatgcacatgcacatgca 27328
>gb|AC104340.10| Mus musculus chromosome 7, clone RP24-495M13, complete sequence Length = 170605 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 15011 cacatgcacatgcacatgca 15030
>gb|AC009126.2| Homo sapiens chromosome 5 clone RP11-496M2, complete sequence Length = 177978 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 15885 cacatgcacatgcacatgca 15866
>gb|AC010837.2| Homo sapiens chromosome 18, clone RP11-307E5, complete sequence Length = 210074 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 58663 cacatgcacatgcacatgca 58644
>gb|DP000052.1| Sus scrofa target 126 genomic scaffold Length = 432382 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 93 agcacatgcacatgcacatg 112 |||||||||||||||||||| Sbjct: 71903 agcacatgcacatgcacatg 71922
>gb|AC092752.2| Genomic sequence for Mus musculus, clone RP23-51O3, complete sequence Length = 226416 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 15947 cacatgcacatgcacatgca 15928
>gb|AC006137.3|AC006137 Homo sapiens clone SCb-254N2 (UWGC:rg254N02) from 6p21, complete sequence Length = 129806 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 97 catgcacatgcacatgcagt 116 |||||||||||||||||||| Sbjct: 49256 catgcacatgcacatgcagt 49275
>gb|AC157594.4| Mus musculus BAC clone RP23-279A2 from chromosome 17, complete sequence Length = 220526 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 52103 cacatgcacatgcacatgca 52122
>gb|AC154572.2| Mus musculus BAC clone RP23-392G15 from chromosome 13, complete sequence Length = 185090 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 49079 cacatgcacatgcacatgca 49060
>gb|AC154505.3| Mus musculus BAC clone RP24-92J14 from chromosome 13, complete sequence Length = 199707 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 105689 cacatgcacatgcacatgca 105708
>gb|AC159741.2| Mus musculus BAC clone RP23-178B21 from chromosome 9, complete sequence Length = 185878 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 158441 gcacatgcacatgcacatgc 158460
>gb|AC148698.1| Macaca mulatta Major Histocompatibility Complex BAC MMU268P23, complete sequence Length = 185838 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 catgcacatgcacatgcagt 116 |||||||||||||||||||| Sbjct: 34025 catgcacatgcacatgcagt 34006
>gb|AC148689.1| Macaca mulatta Major Histocompatibility Complex BAC MMU222I18, complete sequence Length = 174202 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 catgcacatgcacatgcagt 116 |||||||||||||||||||| Sbjct: 131087 catgcacatgcacatgcagt 131068
>dbj|AK043643.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830014N07 product:unclassifiable, full insert sequence Length = 2863 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 1025 cacatgcacatgcacatgca 1006
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 3.7 Identities = 47/56 (83%) Strand = Plus / Plus Query: 206 gcttgtcctcgtaacgttcccagaccatgaccccgccatagttggccgccttctgc 261 ||||||| | ||| || ||||||| ||||| ||||| |||||| ||||||||||| Sbjct: 14484682 gcttgtcgtagtatcggtcccagatcatgaagccgccgtagttgtccgccttctgc 14484737
>gb|AC100738.8| Mus musculus chromosome 15, clone RP24-362K21, complete sequence Length = 128950 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 58627 cacatgcacatgcacatgca 58646
>gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold Length = 1888123 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 1244995 gcacatgcacatgcacatgc 1245014
>gb|AC008906.5|AC008906 Homo sapiens chromosome 5 clone CTD-2260A17, complete sequence Length = 151801 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 88742 cacatgcacatgcacatgca 88723
>gb|AC155817.2| Mus musculus BAC clone RP23-473M8 from chromosome 12, complete sequence Length = 159497 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 29950 cacatgcacatgcacatgca 29931
>gb|AC156015.2| Mus musculus BAC clone RP24-345H1 from chromosome 16, complete sequence Length = 154624 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 50006 cacatgcacatgcacatgca 49987
>gb|AC012074.9| Homo sapiens BAC clone RP11-458N5 from 2, complete sequence Length = 197652 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 168710 gcacatgcacatgcacatgc 168691
>gb|AC013719.8| Homo sapiens BAC clone RP11-270E5 from 2, complete sequence Length = 152996 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 79453 cacatgcacatgcacatgca 79434
>gb|AE014074.1| Streptococcus pyogenes MGAS315, complete genome Length = 1900521 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tggcgtagctgctgtaattt 201 |||||||||||||||||||| Sbjct: 427887 tggcgtagctgctgtaattt 427868
>gb|AC009073.8|AC009073 Homo sapiens chromosome 16 clone RP11-31O11, complete sequence Length = 177978 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 15885 cacatgcacatgcacatgca 15866
>gb|AC139849.5| Mus musculus BAC clone RP23-84M17 from chromosome 7, complete sequence Length = 189942 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 30858 cacatgcacatgcacatgca 30839
>dbj|BA000034.2| Streptococcus pyogenes SSI-1 DNA, complete genome Length = 1894275 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 182 tggcgtagctgctgtaattt 201 |||||||||||||||||||| Sbjct: 1468855 tggcgtagctgctgtaattt 1468874
>gb|AC103635.8| Mus musculus chromosome 1, clone RP24-397O8, complete sequence Length = 188226 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 37172 gcacatgcacatgcacatgc 37153
>dbj|AP004732.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0021M10 Length = 163416 Score = 40.1 bits (20), Expect = 3.7 Identities = 47/56 (83%) Strand = Plus / Plus Query: 206 gcttgtcctcgtaacgttcccagaccatgaccccgccatagttggccgccttctgc 261 ||||||| | ||| || ||||||| ||||| ||||| |||||| ||||||||||| Sbjct: 77856 gcttgtcgtagtatcggtcccagatcatgaagccgccgtagttgtccgccttctgc 77911
>emb|BX548065.6| Mouse DNA sequence from clone RP23-163B21 on chromosome X, complete sequence Length = 225082 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 82307 cacatgcacatgcacatgca 82326
>emb|AL844579.10| Mouse DNA sequence from clone RP23-219M22 on chromosome 2, complete sequence Length = 103290 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 42287 cacatgcacatgcacatgca 42268
>emb|BX294656.8| Zebrafish DNA sequence from clone CH211-238M13, complete sequence Length = 162077 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 59327 cacatgcacatgcacatgca 59308
>gb|AC154342.2| Mus musculus BAC clone RP23-227D10 from 17, complete sequence Length = 199709 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 62321 cacatgcacatgcacatgca 62302
>gb|AC154244.2| Mus musculus BAC clone RP24-321P20 from 17, complete sequence Length = 172093 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 50462 cacatgcacatgcacatgca 50443
>gb|AC122362.5| Mus musculus BAC clone RP23-430N1 from chromosome 6, complete sequence Length = 212275 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 191335 cacatgcacatgcacatgca 191316
>gb|AC140488.4| Mus musculus BAC clone RP24-142A8 from 9, complete sequence Length = 185649 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 124609 cacatgcacatgcacatgca 124628
>gb|AC122495.4| Mus musculus BAC clone RP24-397P10 from 9, complete sequence Length = 175838 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 129905 cacatgcacatgcacatgca 129886
>gb|AC155233.2| Mus musculus BAC clone RP24-381F23 from 12, complete sequence Length = 149905 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 2869 cacatgcacatgcacatgca 2888
>emb|CT954231.1| Medicago truncatula chromosome 5 clone mth2-166e2, COMPLETE SEQUENCE Length = 122895 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 91 caagcacatgcacatgcacatgca 114 |||||||| ||||||||||||||| Sbjct: 9247 caagcacaagcacatgcacatgca 9224
>gb|AC105335.27| Mus musculus chromosome 5, clone RP23-377H14, complete sequence Length = 171789 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 63343 cacatgcacatgcacatgca 63362
>gb|AC174449.2| Mus musculus BAC clone RP23-338O19 from chromosome 6, complete sequence Length = 217169 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 814 cacatgcacatgcacatgca 795
>emb|X95927.1|RNCFTR7 R.norvegicus CFTR gene Length = 4787 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 4003 gcacatgcacatgcacatgc 4022
>gb|AE003544.4| Drosophila melanogaster chromosome 3L, section 41 of 83 of the complete sequence Length = 280378 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 149774 gcacatgcacatgcacatgc 149755
>emb|BX629359.1|CNS09SBT Tetraodon nigroviridis BAC sequence Length = 139693 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 109011 cacatgcacatgcacatgca 109030
>gb|AC115725.9| Mus musculus chromosome 5, clone RP23-21A18, complete sequence Length = 278172 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 254552 cacatgcacatgcacatgca 254571
>emb|CT571274.6| Mouse DNA sequence from clone RP24-142M17 on chromosome 14, complete sequence Length = 178159 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 91 caagcacatgcacatgcaca 110 |||||||||||||||||||| Sbjct: 150708 caagcacatgcacatgcaca 150727
>gb|AC154614.3| Mus musculus BAC clone RP23-255I2 from chromosome 14, complete sequence Length = 186187 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 65805 cacatgcacatgcacatgca 65824
>emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chromosome 2, complete sequence Length = 181372 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 37404 cacatgcacatgcacatgca 37385
>gb|AC119921.12| Mus musculus chromosome 12, clone RP24-252B23, complete sequence Length = 162290 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 22263 cacatgcacatgcacatgca 22282
>emb|AL031983.2|HS271M21 Human DNA sequence from clone RP1-271M21 on chromosome 6p21.31-22.2 Contains a MAS1 oncogene pseudogene, the OR2H2 gene for olfactory receptor 2H2, olfactory receptor 2I1 and 2H5 pseudogenes OR2I1P and OR2H5P, the gene for diubiquitin, an RPL13A (60S Ribosomal Protein L13A) pseudogene, the GABBR1 gene for gamma-aminobutyric acid (GABA) B receptor 1 and an SMT3H1 or SMT3H2 (SMT3 (suppressor of mif two 3, yeast) homolog) pseudogene and three CpG islands, complete sequence Length = 134292 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 catgcacatgcacatgcagt 116 |||||||||||||||||||| Sbjct: 104348 catgcacatgcacatgcagt 104329
>emb|AL731785.2|CNS08C89 Oryza sativa chromosome 12, . BAC OSJNBa0037L20 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 178827 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 acatgcacatgcacatgcag 115 |||||||||||||||||||| Sbjct: 83947 acatgcacatgcacatgcag 83966
>gb|AC171912.2| Capitella capitata clone JGIBGZA-9O3, complete sequence Length = 40293 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 22052 cacatgcacatgcacatgca 22071
>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome Length = 2519802 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 1995856 cacatgcacatgcacatgca 1995875
>gb|AC149060.4| Mus musculus BAC clone RP23-242D8 from 7, complete sequence Length = 205543 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 66199 cacatgcacatgcacatgca 66180
>gb|AC121770.3| Mus musculus BAC clone RP23-341M16 from 17, complete sequence Length = 186190 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 178171 cacatgcacatgcacatgca 178152
>gb|AC123868.4| Mus musculus BAC clone RP23-129K6 from 8, complete sequence Length = 174224 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 158756 cacatgcacatgcacatgca 158737
>emb|CR387992.11| Zebrafish DNA sequence from clone DKEY-234K24 in linkage group 1, complete sequence Length = 76732 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 95 cacatgcacatgcacatgca 114 |||||||||||||||||||| Sbjct: 65303 cacatgcacatgcacatgca 65284
>emb|CT025838.2| Medicago truncatula chromosome 5 clone mth2-124f10, COMPLETE SEQUENCE Length = 113309 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 91 caagcacatgcacatgcacatgca 114 |||||||| ||||||||||||||| Sbjct: 112245 caagcacaagcacatgcacatgca 112222
>gb|AC168210.13| Mus musculus chromosome 5, clone RP24-72J20, complete sequence Length = 193750 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 94 gcacatgcacatgcacatgc 113 |||||||||||||||||||| Sbjct: 116174 gcacatgcacatgcacatgc 116155 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,129,118 Number of Sequences: 3902068 Number of extensions: 2129118 Number of successful extensions: 61514 Number of sequences better than 10.0: 261 Number of HSP's better than 10.0 without gapping: 263 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 60204 Number of HSP's gapped (non-prelim): 1144 length of query: 281 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 259 effective length of database: 17,147,199,772 effective search space: 4441124740948 effective search space used: 4441124740948 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)