Clone Name | rbart61f05 |
---|---|
Clone Library Name | barley_pub |
>gb|AC134613.5| Mus musculus BAC clone RP23-133J23 from 8, complete sequence Length = 187148 Score = 46.1 bits (23), Expect = 0.085 Identities = 23/23 (100%) Strand = Plus / Plus Query: 259 caggaagggaaggctggcagctg 281 ||||||||||||||||||||||| Sbjct: 80417 caggaagggaaggctggcagctg 80439
>gb|AY672742.1| Microcystis sp. AICB 702 phycocyanin beta subunit (cpcB) and phycocyanin alpha subunit (cpcA) genes, partial cds Length = 603 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 482 ctggcgctgctcaagctgtgtacaac 507
>gb|AY672740.1| Microcystis sp. AICB 688 phycocyanin beta subunit (cpcB) and phycocyanin alpha subunit (cpcA) genes, partial cds Length = 603 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 482 ctggcgctgctcaagctgtgtacaac 507
>gb|AY672737.1| Microcystis sp. AICB 36 phycocyanin beta subunit (cpcB) and phycocyanin alpha subunit (cpcA) genes, partial cds Length = 603 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 482 ctggcgctgctcaagctgtgtacaac 507
>gb|AY672736.1| Microcystis sp. AICB 35 phycocyanin beta subunit (cpcB) and phycocyanin alpha subunit (cpcA) genes, partial cds Length = 603 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 482 ctggcgctgctcaagctgtgtacaac 507
>gb|AY568709.1| Microcystis aeruginosa NSW-MRD- CpcB and CpcA genes, partial cds Length = 623 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568708.1| Microcystis aeruginosa NSW-MRD+ CpcB and CpcA genes, partial cds Length = 622 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 464 ctggcgctgctcaagctgtgtacaac 489
>gb|AY568704.1| Microcystis aeruginosa FACHB-908 CpcB and CpcA genes, partial cds Length = 623 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568703.1| Microcystis aeruginosa FACHB-936 CpcB gene, partial cds; and CpcA-like gene, partial sequence Length = 623 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568701.1| Microcystis viridis NIES-102 CpcB gene, partial cds; and CpcA-like gene, partial sequence Length = 618 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 459 ctggcgctgctcaagctgtgtacaac 484
>gb|AY568700.1| Microcystis aeruginosa FACHB-940 CpcB and CpcA genes, partial cds Length = 623 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568699.1| Microcystis aeruginosa FACHB-911 CpcB and CpcA genes, partial cds Length = 623 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568698.1| Microcystis aeruginosa UTEX 1939 CpcB and CpcA genes, partial cds Length = 619 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 462 ctggcgctgctcaagctgtgtacaac 487
>gb|AY568697.1| Microcystis aeruginosa FACHB-942 CpcB and CpcA genes, partial cds Length = 622 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568696.1| Microcystis aeruginosa FACHB-913 CpcB and CpcA genes, partial cds Length = 622 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568694.1| Microcystis sp. FACHB-525 CpcB and CpcA genes, partial cds Length = 622 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568692.1| Microcystis sp. FACHB-574 CpcB and CpcA genes, partial cds Length = 610 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 453 ctggcgctgctcaagctgtgtacaac 478
>gb|AY568691.1| Microcystis aeruginosa PCC 7820 CpcB and CpcA genes, partial cds Length = 621 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 464 ctggcgctgctcaagctgtgtacaac 489
>gb|AY568690.1| Microcystis aeruginosa PCC 7806 CpcB and CpcA genes, partial cds Length = 623 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568689.1| Microcystis aeruginosa FACHB-912 CpcB and CpcA genes, partial cds Length = 622 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 464 ctggcgctgctcaagctgtgtacaac 489
>gb|AY568688.1| Microcystis sp. FACHB-563 CpcB and CpcA genes, partial cds Length = 623 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 466 ctggcgctgctcaagctgtgtacaac 491
>gb|AY568687.1| Microcystis sp. FACHB-524 CpcB and CpcA genes, partial cds Length = 621 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568686.1| Microcystis aeruginosa UTEX 'LB 2061' CpcB and CpcA genes, partial cds Length = 620 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 463 ctggcgctgctcaagctgtgtacaac 488
>gb|AY568685.1| Microcystis aeruginosa NIES-98 CpcB and CpcA genes, partial cds Length = 622 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568683.1| Microcystis aeruginosa PCC 7820 CpcB and CpcA genes, partial cds Length = 617 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568682.1| Microcystis aeruginosa FACHB-978 CpcB and CpcA genes, partial cds Length = 622 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY568681.1| Microcystis aeruginosa FACHB-905 CpcB gene, partial cds; and CpcA-like gene, partial sequence Length = 618 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 465 ctggcgctgctcaagctgtgtacaac 490
>gb|AY524851.1| Microcystis sp. KLL MG-J CpcB (cpcB) and CpcA (cpcA) genes, partial cds Length = 663 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 507 ctggcgctgctcaagctgtgtacaac 532
>gb|AY524849.1| Microcystis sp. KLL MB-J CpcB (cpcB) and CpcA (cpcA) genes, partial cds Length = 663 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 507 ctggcgctgctcaagctgtgtacaac 532
>gb|AY271737.1| Microcystis flos-aquae UAM256 phycocyanin B (cpcB) and phycocyanin A (cpcA) genes, partial cds Length = 643 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 497 ctggcgctgctcaagctgtgtacaac 522
>gb|AY271729.1| Microcystis flos-aquae UAM246 phycocyanin B (cpcB) and phycocyanin A (cpcA) genes, partial cds Length = 643 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 497 ctggcgctgctcaagctgtgtacaac 522
>emb|AJ003179.1|MAAJ3179 Microcystis aeruginosa partial pcB and pcA genes, strain EAWAG171 Length = 663 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 507 ctggcgctgctcaagctgtgtacaac 532
>emb|AJ003171.1|MAAJ3171 Microcystis aeruginosa partial pcB and pcA genes, strain EAWAG94a Length = 663 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 507 ctggcgctgctcaagctgtgtacaac 532
>emb|AJ003169.1|MAAJ3169 Microcystis aeruginosa partial pcB and pcA genes, strain PCC7820 Length = 661 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 505 ctggcgctgctcaagctgtgtacaac 530
>emb|AJ003168.1|MAAJ3168 Microcystis aeruginosa partial pcB and pcA genes, strain PCC7806Fr Length = 662 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 506 ctggcgctgctcaagctgtgtacaac 531
>emb|AJ003167.1|MAAJ3167 Microcystis aeruginosa partial pcB and pcA genes, strain PCC7806Pi Length = 662 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 506 ctggcgctgctcaagctgtgtacaac 531
>emb|CR385081.7| Zebrafish DNA sequence from clone CH211-59O9 in linkage group 25, complete sequence Length = 182806 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 41 tgacagctgaaactattagcacaaca 66 |||| ||||||||||||||||||||| Sbjct: 98251 tgactgctgaaactattagcacaaca 98276
>gb|AF385388.1|AF385388 Microcystis aeruginosa strain PCC 7941 c-phycocyanin beta subunit (cpcB) and c-phycocyanin alpha subunit (cpcA) genes, partial cds Length = 575 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 455 ctggcgctgctcaagctgtgtacaac 480
>gb|AF385387.1|AF385387 Microcystis aeruginosa strain PCC 7820 c-phycocyanin beta subunit (cpcB) and c-phycocyanin alpha subunit (cpcA) genes, partial cds Length = 575 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 455 ctggcgctgctcaagctgtgtacaac 480
>gb|AF385386.1|AF385386 Microcystis aeruginosa strain PCC 7806 c-phycocyanin beta subunit (cpcB) and c-phycocyanin alpha subunit (cpcA) genes, partial cds Length = 575 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 455 ctggcgctgctcaagctgtgtacaac 480
>gb|AF385385.1|AF385385 Microcystis aeruginosa strain NIES 99 c-phycocyanin beta subunit (cpcB) and c-phycocyanin alpha subunit (cpcA) genes, partial cds Length = 575 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 455 ctggcgctgctcaagctgtgtacaac 480
>gb|AF385384.1|AF385384 Microcystis aeruginosa strain NIES 98 c-phycocyanin beta subunit (cpcB) and c-phycocyanin alpha subunit (cpcA) genes, partial cds Length = 575 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 455 ctggcgctgctcaagctgtgtacaac 480
>gb|AF385383.1|AF385383 Microcystis viridis strain NIES 102 c-phycocyanin beta subunit (cpcB) and c-phycocyanin alpha subunit (cpcA) genes, partial cds Length = 575 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 455 ctggcgctgctcaagctgtgtacaac 480
>gb|AF385374.1|AF385374 Microcystis sp. FCLA-200 c-phycocyanin beta subunit (cpcB) and c-phycocyanin alpha subunit (cpcA) genes, partial cds Length = 575 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 455 ctggcgctgctcaagctgtgtacaac 480
>gb|AF385368.1|AF385368 Microcystis sp. NPLS-1 c-phycocyanin beta subunit (cpcB) and c-phycocyanin alpha subunit (cpcA) genes, partial cds Length = 575 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 455 ctggcgctgctcaagctgtgtacaac 480
>gb|AF195178.1|AF195178 Microcystis sp. UWOCC F phycocyanin beta subunit (pcB) and phycocyanin alpha subunit (pcA) genes, partial cds Length = 626 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 487 ctggcgctgctcaagctgtgtacaac 512
>gb|AF195177.1|AF195177 Microcystis aeruginosa strain PCC7806 phycocyanin beta subunit (pcB) and phycocyanin alpha subunit (pcA) genes, partial cds Length = 641 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 489 ctggcgctgctcaagctgtgtacaac 514
>gb|AF195176.1|AF195176 Microcystis aeruginosa strain PCC7820 phycocyanin beta subunit (pcB) and phycocyanin alpha subunit (pcA) genes, partial cds Length = 625 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 487 ctggcgctgctcaagctgtgtacaac 512
>gb|AF195174.1|AF195174 Microcystis aeruginosa strain UWOCC CBS phycocyanin beta subunit (pcB) gene, partial cds; and phycocyanin alpha subunit (pcA) gene, complete cds Length = 629 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 488 ctggcgctgctcaagctgtgtacaac 513
>gb|AF195173.1|AF195173 Microcystis aeruginosa strain UWOCC MR-C phycocyanin beta subunit (pcB) and phycocyanin alpha subunit (pcA) genes, partial cds Length = 635 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 490 ctggcgctgctcaagctgtgtacaac 515
>gb|AF195172.1|AF195172 Microcystis aeruginosa strain UWOCC MR-D phycocyanin beta subunit (pcB) and phycocyanin alpha subunit (pcA) genes, partial cds Length = 625 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 488 ctggcgctgctcaagctgtgtacaac 513
>gb|AF195170.1|AF195170 Microcystis aeruginosa strain UWOCC 017 phycocyanin beta subunit (pcB) and phycocyanin alpha subunit (pcA) genes, partial cds Length = 624 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 487 ctggcgctgctcaagctgtgtacaac 512
>gb|AF195169.1|AF195169 Microcystis aeruginosa strain UWOCC 023 phycocyanin beta subunit (pcB) and phycocyanin alpha subunit (pcA) genes, partial cds Length = 629 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 487 ctggcgctgctcaagctgtgtacaac 512
>gb|AF195158.1|AF195158 Microcystis aeruginosa strain UWOCC 001 phycocyanin beta subunit (pcB) and phycocyanin alpha subunit (pcA) genes, partial cds Length = 635 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 488 ctggcgctgctcaagctgtgtacaac 513
>gb|AY999930.1| Microcystis sp. 003 phycocyanin beta subunit (pcB) and phycocyanin alpha subunit (pcA) genes, partial cds Length = 608 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 487 ctggcgctgctcaagctgtgtacaac 512
>gb|AY117047.1| Microcystis sp. WW1 phycocyanin beta subunit (pcB) and phycocyanin alpha subunit (pcA) genes, partial cds Length = 585 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 448 ctggcgctgctcaagctgtgtacaac 473
>gb|AY117043.1| Microcystis sp. CaD-1 phycocyanin beta subunit (pcB) and phycocyanin alpha subunit (pcA) genes, partial cds Length = 585 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 448 ctggcgctgctcaagctgtgtacaac 473
>emb|AJ965489.1| Microcystis aeruginosa HUB53 partial pcB gene for phycocyanin beta subunit and partial pcA gene for phycocyanin alpha subunit Length = 544 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 187 ctggcgctgctcaagctgtgcacaac 212 |||||||||||||||||||| ||||| Sbjct: 445 ctggcgctgctcaagctgtgtacaac 470
>gb|AC135956.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0005H20, complete sequence Length = 135560 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 352 tatttaagctgctcctttgca 372 ||||||||||||||||||||| Sbjct: 18071 tatttaagctgctcctttgca 18091
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 352 tatttaagctgctcctttgca 372 ||||||||||||||||||||| Sbjct: 29469230 tatttaagctgctcctttgca 29469210 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 ctagaactcgttgacacttgacag 257 |||||||| ||||||||||||||| Sbjct: 33604751 ctagaactggttgacacttgacag 33604774
>emb|CR376751.15| Zebrafish DNA sequence from clone CH211-220M6 in linkage group 8, complete sequence Length = 229078 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 18 tatgaaattattaattgttacattg 42 ||||||||||||||||| ||||||| Sbjct: 65232 tatgaaattattaattgatacattg 65208
>emb|CR847797.8| Zebrafish DNA sequence from clone DKEY-281F2 in linkage group 8, complete sequence Length = 219913 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 18 tatgaaattattaattgttacattg 42 ||||||||||||||||| ||||||| Sbjct: 83173 tatgaaattattaattgatacattg 83149
>gb|AC025566.22| Homo sapiens 3 BAC RP11-501O2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 200398 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 30 aattgttacattgacagctga 50 ||||||||||||||||||||| Sbjct: 196642 aattgttacattgacagctga 196622
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 352 tatttaagctgctcctttgca 372 ||||||||||||||||||||| Sbjct: 29560652 tatttaagctgctcctttgca 29560632 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 ctagaactcgttgacacttgacag 257 |||||||| ||||||||||||||| Sbjct: 33695223 ctagaactggttgacacttgacag 33695246
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 352 tatttaagctgctcctttgca 372 ||||||||||||||||||||| Sbjct: 9050626 tatttaagctgctcctttgca 9050606
>dbj|AP001080.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0499C11 Length = 151369 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 352 tatttaagctgctcctttgca 372 ||||||||||||||||||||| Sbjct: 79633 tatttaagctgctcctttgca 79613
>dbj|AK120531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013127H23, full insert sequence Length = 6225 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 352 tatttaagctgctcctttgca 372 ||||||||||||||||||||| Sbjct: 757 tatttaagctgctcctttgca 777
>gb|CP000025.1| Campylobacter jejuni RM1221, complete genome Length = 1777831 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 25 ttattaattgttacattgacagct 48 |||||||||||| ||||||||||| Sbjct: 1247890 ttattaattgttgcattgacagct 1247913
>gb|AY739093.1| Takifugu rubripes frMUT, frGPR136L1, and frGPR136L2 genes, complete sequence; frRUNX2 (frRUNX2) gene, complete cds; and frCLIC5, frENPP5, frPHIP, frIRAK1BP1, and frTBX18 genes, complete sequence Length = 235024 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 133 cccagtgtcggggtctaggaaagc 156 ||||||||||||||| |||||||| Sbjct: 169402 cccagtgtcggggtcaaggaaagc 169379
>gb|AC135595.5| Oryza sativa chromosome 3 BAC OSJNBa0028F23 genomic sequence, complete sequence Length = 166888 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 234 ctagaactcgttgacacttgacag 257 |||||||| ||||||||||||||| Sbjct: 60329 ctagaactggttgacacttgacag 60306
>gb|AC152499.17| Medicago truncatula clone mth2-56f20, complete sequence Length = 125561 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 10 aatactagtatgaaattattaatt 33 ||||||||||| |||||||||||| Sbjct: 59298 aatactagtatcaaattattaatt 59275
>emb|AL139077.2|CJ11168X4 Campylobacter jejuni subsp. jejuni NCTC 11168 complete genome; segment 4/6 Length = 282183 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 25 ttattaattgttacattgacagct 48 |||||||||||| ||||||||||| Sbjct: 186992 ttattaattgttgcattgacagct 187015
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 actggcgctgctcaagctgt 205 |||||||||||||||||||| Sbjct: 3387604 actggcgctgctcaagctgt 3387623
>gb|AC108725.5| Homo sapiens 3 BAC RP11-451J24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 84562 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 107 aaacatcagcagcacatgac 126 |||||||||||||||||||| Sbjct: 84542 aaacatcagcagcacatgac 84561
>gb|AC037441.12| Homo sapiens chromosome , clone RP11-87E22, complete sequence Length = 163147 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 252 tgacaggcaggaagggaaggctgg 275 |||||||||||||||| ||||||| Sbjct: 107680 tgacaggcaggaagggtaggctgg 107657
>ref|NM_079884.3| Drosophila melanogaster Zn finger homeodomain 2 CG1449-RA (zfh2), mRNA Length = 10571 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 22 aaattattaattgttacattgaca 45 ||||||||||| |||||||||||| Sbjct: 10428 aaattattaatagttacattgaca 10405
>gb|AC093503.2| Homo sapiens chromosome 19 clone CTB-12A17, complete sequence Length = 147598 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 253 gacaggcaggaagggaaggc 272 |||||||||||||||||||| Sbjct: 101042 gacaggcaggaagggaaggc 101061
>gb|AC018478.4| Drosophila melanogaster, chromosome 4, region 101F-102F, BAC clone BACH57F14, complete sequence Length = 103809 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 22 aaattattaattgttacattgaca 45 ||||||||||| |||||||||||| Sbjct: 84181 aaattattaatagttacattgaca 84158
>gb|AC010668.7| Drosophila melanogaster, chromosome 4, region 101F-102F, BAC clone BACR44L03, complete sequence Length = 172190 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 22 aaattattaattgttacattgaca 45 ||||||||||| |||||||||||| Sbjct: 23971 aaattattaatagttacattgaca 23948
>gb|M63450.1|DROZFH2 Drosophila melanogaster zinc-finger homeodomain protein 2 (zfh-2) mRNA, complete cds Length = 10571 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 22 aaattattaattgttacattgaca 45 ||||||||||| |||||||||||| Sbjct: 10428 aaattattaatagttacattgaca 10405
>gb|AC108702.3| Homo sapiens 3 BAC RP11-20B7 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 171106 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 107 aaacatcagcagcacatgac 126 |||||||||||||||||||| Sbjct: 1984 aaacatcagcagcacatgac 2003
>gb|AC067959.5| Homo sapiens BAC clone RP11-79J24 from 2, complete sequence Length = 59030 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 269 aggctggcagctgcaagctc 288 |||||||||||||||||||| Sbjct: 40917 aggctggcagctgcaagctc 40898
>gb|AE003843.5| Drosophila melanogaster chromosome 4, section 3 of 5 of the complete sequence Length = 328561 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 22 aaattattaattgttacattgaca 45 ||||||||||| |||||||||||| Sbjct: 70300 aaattattaatagttacattgaca 70277
>emb|BX323833.4| Pig DNA sequence from clone XX-554F3, complete sequence Length = 121483 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 269 aggctggcagctgcaagctc 288 |||||||||||||||||||| Sbjct: 74244 aggctggcagctgcaagctc 74263 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,777,909 Number of Sequences: 3902068 Number of extensions: 3777909 Number of successful extensions: 95954 Number of sequences better than 10.0: 84 Number of HSP's better than 10.0 without gapping: 86 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 95744 Number of HSP's gapped (non-prelim): 210 length of query: 392 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 370 effective length of database: 17,147,199,772 effective search space: 6344463915640 effective search space used: 6344463915640 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)