>gb|AC096785.29| Mus musculus strain C57BL/6J clone rp23-382i2 map 18, complete sequence
          Length = 201304

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 145    acatatgtaaagttatgtata 165
              |||||||||||||||||||||
Sbjct: 116410 acatatgtaaagttatgtata 116390

>emb|CT030124.12| Mouse DNA sequence from clone RP23-100B15 on chromosome 9, complete
             sequence
          Length = 203615

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 145   acatatgtaaagttatgtata 165
             |||||||||||||||||||||
Sbjct: 90293 acatatgtaaagttatgtata 90273

>gb|AC074314.29| 433m13, complete sequence
          Length = 209644

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 145    acatatgtaaagttatgtata 165
              |||||||||||||||||||||
Sbjct: 207126 acatatgtaaagttatgtata 207106

>dbj|D45066.1| Cucurbita maxima mRNA for AOBP (ascorbate oxidase promoter-binding
            protein), complete cds
          Length = 1485

 Score = 42.1 bits (21), Expect = 0.89
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 143  tcacatatgtaaagttatgta 163
            |||||||||||||||||||||
Sbjct: 1419 tcacatatgtaaagttatgta 1399

>gb|AC007770.5|AC007770 Drosophila melanogaster, chromosome 3R, region 86C-86C, BAC clone
             BACR03J13, complete sequence
          Length = 179260

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 145   acatatgtaaagttatgtat 164
             ||||||||||||||||||||
Sbjct: 65449 acatatgtaaagttatgtat 65468

>gb|AC084491.1|CBRG06P23 Caenorhabditis briggsae cosmid G06P23, complete sequence
          Length = 42762

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 65   ccgcttctctgttttttact 84
            ||||||||||||||||||||
Sbjct: 2297 ccgcttctctgttttttact 2278

>gb|AE003687.3| Drosophila melanogaster chromosome 3R, section 25 of 118 of the complete
              sequence
          Length = 260168

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 145    acatatgtaaagttatgtat 164
              ||||||||||||||||||||
Sbjct: 118625 acatatgtaaagttatgtat 118644


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,124,196
Number of Sequences: 3902068
Number of extensions: 2124196
Number of successful extensions: 38279
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38271
Number of HSP's gapped (non-prelim): 8
length of query: 271
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 249
effective length of database: 17,147,199,772
effective search space: 4269652743228
effective search space used: 4269652743228
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)