>gb|AC007170.6| Arabidopsis thaliana chromosome 2 clone T3P4 map mi310, complete
             sequence
          Length = 78568

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 67    ctgctagaaagtagaaacccta 88
             ||||||||||||||||||||||
Sbjct: 17718 ctgctagaaagtagaaacccta 17697

>gb|AC025296.10| Oryza sativa chromosome 10 BAC OSJNBa0076F20 genomic sequence, complete
              sequence
          Length = 165394

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 179    gcgcgcggtgatcgatcgatcgatgg 204
              |||||||| |||||||||||||||||
Sbjct: 132036 gcgcgcggcgatcgatcgatcgatgg 132011

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 179      gcgcgcggtgatcgatcgatcgatgg 204
                |||||||| |||||||||||||||||
Sbjct: 19504170 gcgcgcggcgatcgatcgatcgatgg 19504145

>gb|AC019013.2|AC019013 Genomic Sequence For Arabidopsis thaliana, Clone T5E15, Chromosome V,
            complete sequence
          Length = 114056

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 67   ctgctagaaagtagaaacccta 88
            ||||||||||||||||||||||
Sbjct: 7802 ctgctagaaagtagaaacccta 7781

>gb|AC018660.1|AC018660 Genomic Sequence For Arabidopsis thaliana Clone F11P10, Chromosome V,
             complete sequence
          Length = 105589

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 67    ctgctagaaagtagaaacccta 88
             ||||||||||||||||||||||
Sbjct: 98477 ctgctagaaagtagaaacccta 98456

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 179      gcgcgcggtgatcgatcgatcgatgg 204
                |||||||| |||||||||||||||||
Sbjct: 19515446 gcgcgcggcgatcgatcgatcgatgg 19515421

>ref|XM_789429.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC589795 (LOC589795), partial mRNA
          Length = 414

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 289 ttgctaggatcgcaaccatgg 309
           |||||||||||||||||||||
Sbjct: 104 ttgctaggatcgcaaccatgg 84

>ref|XM_790776.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC591199 (LOC591199), mRNA
          Length = 880

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 289 ttgctaggatcgcaaccatgg 309
           |||||||||||||||||||||
Sbjct: 468 ttgctaggatcgcaaccatgg 448

>gb|AC168274.5| Mus musculus  BAC RP23-229B1 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 177020

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 125    aagaaatgtagccaaaagggtgaa 148
              |||||||||||||||| |||||||
Sbjct: 159696 aagaaatgtagccaaatgggtgaa 159673

>gb|AC156952.22| Mus musculus 10 BAC RP24-385D2 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 179140

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 125   aagaaatgtagccaaaagggtgaa 148
             |||||||||||||||| |||||||
Sbjct: 74318 aagaaatgtagccaaatgggtgaa 74295

>gb|AC148970.3| Medicago truncatula chromosome 2 BAC clone mth2-74j13, complete
             sequence
          Length = 83100

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    acagtagcaaggaggaggag 107
             ||||||||||||||||||||
Sbjct: 11235 acagtagcaaggaggaggag 11216

>gb|AC135228.5| Oryza sativa chromosome 3 BAC OSJNBb0122C16 genomic sequence, complete
              sequence
          Length = 129440

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 185    ggtgatcgatcgatcgatgg 204
              ||||||||||||||||||||
Sbjct: 110926 ggtgatcgatcgatcgatgg 110945

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 185      ggtgatcgatcgatcgatgg 204
                ||||||||||||||||||||
Sbjct: 29279065 ggtgatcgatcgatcgatgg 29279084



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 188     gatcgatcgatcgatggggt 207
               ||||||||||||||||||||
Sbjct: 6764180 gatcgatcgatcgatggggt 6764199

>gb|AC145380.3| Oryza sativa chromosome 3 BAC OSJNBa0013A09 genomic sequence, complete
             sequence
          Length = 139788

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 185   ggtgatcgatcgatcgatgg 204
             ||||||||||||||||||||
Sbjct: 76935 ggtgatcgatcgatcgatgg 76916

>ref|XM_388832.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08656.1)
            partial mRNA
          Length = 1836

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 97   aggaggaggagcaccactag 116
            ||||||||||||||||||||
Sbjct: 1476 aggaggaggagcaccactag 1457

>gb|AC158235.3| Mus musculus BAC clone RP23-185P17 from chromosome 16, complete
             sequence
          Length = 198822

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 26    attatttctgcatacacaaa 45
             ||||||||||||||||||||
Sbjct: 72705 attatttctgcatacacaaa 72724

>gb|AC130275.16| Medicago truncatula clone mth1-63a17, complete sequence
          Length = 90599

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 88   acagtagcaaggaggaggag 107
            ||||||||||||||||||||
Sbjct: 4015 acagtagcaaggaggaggag 4034

>emb|AL355310.20| Human DNA sequence from clone RP5-1160K1 on chromosome 1 Contains the
              GPR61 gene for G protein-coupled receptor 61, the GNAI3
              gene for guanine nucleotide binding protein (G protein)
              alpha inhibiting activity polypeptide 3, two novel genes,
              the GNAT2 gene for guanine nucleotide binding protein (G
              protein) alpha transducing activity polypeptide 2, the
              AMPD2 gene for adenosine monophosphate deaminase 2 (isoform
              L) and the 5' end of a ribosomal protein L7 (RPL7)
              pseudogene, complete sequence
          Length = 112911

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 283    ttgcatttgctaggatcgca 302
              ||||||||||||||||||||
Sbjct: 111991 ttgcatttgctaggatcgca 111972

>gb|AC089982.15| Homo sapiens 12 BAC RP11-25I15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 173877

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 17     cttggattaattatttctgc 36
              ||||||||||||||||||||
Sbjct: 145425 cttggattaattatttctgc 145406

>gb|AC092859.26| Pan troglodytes clone rp43-111m15, complete sequence
          Length = 175281

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 283   ttgcatttgctaggatcgca 302
             ||||||||||||||||||||
Sbjct: 34605 ttgcatttgctaggatcgca 34624

>gb|AC099732.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1203D03,
             complete sequence
          Length = 82352

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 188   gatcgatcgatcgatggggt 207
             ||||||||||||||||||||
Sbjct: 60565 gatcgatcgatcgatggggt 60546

>gb|AC000031.6| Homo sapiens Chromosome 1p13.3 Cosmid Clone ctgm1, complete sequence
          Length = 38703

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 283   ttgcatttgctaggatcgca 302
             ||||||||||||||||||||
Sbjct: 37629 ttgcatttgctaggatcgca 37648

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 185      ggtgatcgatcgatcgatgg 204
                ||||||||||||||||||||
Sbjct: 29370487 ggtgatcgatcgatcgatgg 29370506



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 188     gatcgatcgatcgatggggt 207
               ||||||||||||||||||||
Sbjct: 6763393 gatcgatcgatcgatggggt 6763412

>gb|AC067719.12| Homo sapiens 3 BAC RP11-183L23 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 172945

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 30     tttctgcatacacaaatcaa 49
              ||||||||||||||||||||
Sbjct: 111039 tttctgcatacacaaatcaa 111020

>emb|BX649319.8| Zebrafish DNA sequence from clone DKEYP-88E3 in linkage group 20,
             complete sequence
          Length = 108164

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 20    ggattaattatttctgcata 39
             ||||||||||||||||||||
Sbjct: 30459 ggattaattatttctgcata 30440


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,011,142
Number of Sequences: 3902068
Number of extensions: 3011142
Number of successful extensions: 59753
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59128
Number of HSP's gapped (non-prelim): 625
length of query: 333
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 311
effective length of database: 17,147,199,772
effective search space: 5332779129092
effective search space used: 5332779129092
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)