ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart61d01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr... 92 6e-16
2gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complet... 40 1.9
3gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone ... 40 1.9
4tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy ... 40 1.9
5emb|AL355137.23| Human DNA sequence from clone RP11-511D14 on ch... 38 7.4
6gb|AC023716.4| Drosophila melanogaster X BAC RP98-45E21 (Roswell... 38 7.4
7gb|AC023694.4| Drosophila melanogaster X BAC RP98-18B11 (Roswell... 38 7.4
8gb|AC154609.2| Mus musculus BAC clone RP23-334N13 from 16, compl... 38 7.4
9gb|AE003449.2| Drosophila melanogaster chromosome X, section 33 ... 38 7.4

>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1067

 Score = 91.7 bits (46), Expect = 6e-16
 Identities = 90/104 (86%), Gaps = 8/104 (7%)
 Strand = Plus / Minus

                                                                       
Query: 26  gcttcaatctgaaccaaacaacatgacgttcttcacatcatcgaaacatt-------ctg 78
           ||||| ||||||||||||||||| || |||||||||||||||||||||||       |||
Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaaacattcgtgagactg 873

                                                       
Query: 79  accaccacgcacgcacttttttatgttgccgaaggcatcatgga 122
            |||||||| |||||| ||||||||||||||||||||| |||||
Sbjct: 872 cccaccacgtacgcac-tttttatgttgccgaaggcattatgga 830



to top

>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence
          Length = 121598

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 112    ggcatcatggaaaccaaaca 131
              ||||||||||||||||||||
Sbjct: 113843 ggcatcatggaaaccaaaca 113824



to top

>gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-147E23, complete
              sequence
          Length = 222430

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     tctgaaccaaacaacatgac 52
              ||||||||||||||||||||
Sbjct: 111593 tctgaaccaaacaacatgac 111574



to top

>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region
               locus, strain C57BL/6
          Length = 2500000

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 33      tctgaaccaaacaacatgac 52
               ||||||||||||||||||||
Sbjct: 1893522 tctgaaccaaacaacatgac 1893503



to top

>emb|AL355137.23| Human DNA sequence from clone RP11-511D14 on chromosome 6p23-24.3
             Contains the gene for a novel protein isentical to
             ribosomal protein L15 (RPL15), complete sequence
          Length = 190223

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 109   gaaggcatcatggaaacca 127
             |||||||||||||||||||
Sbjct: 98391 gaaggcatcatggaaacca 98373



to top

>gb|AC023716.4| Drosophila melanogaster X BAC RP98-45E21 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 169124

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 85    acgcacgcacttttttatg 103
             |||||||||||||||||||
Sbjct: 63139 acgcacgcacttttttatg 63121



to top

>gb|AC023694.4| Drosophila melanogaster X BAC RP98-18B11 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 170301

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 85     acgcacgcacttttttatg 103
              |||||||||||||||||||
Sbjct: 105314 acgcacgcacttttttatg 105296



to top

>gb|AC154609.2| Mus musculus BAC clone RP23-334N13 from 16, complete sequence
          Length = 202556

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 114    catcatggaaaccaaacaccgaa 136
              |||| ||||||||||||||||||
Sbjct: 183434 catcttggaaaccaaacaccgaa 183456



to top

>gb|AE003449.2| Drosophila melanogaster chromosome X, section 33 of 74 of the complete
              sequence
          Length = 307201

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 85     acgcacgcacttttttatg 103
              |||||||||||||||||||
Sbjct: 295141 acgcacgcacttttttatg 295123


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,382,023
Number of Sequences: 3902068
Number of extensions: 1382023
Number of successful extensions: 101697
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 101668
Number of HSP's gapped (non-prelim): 28
length of query: 155
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 133
effective length of database: 17,147,199,772
effective search space: 2280577569676
effective search space used: 2280577569676
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top