ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart61c12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 38 1.4
2gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 38 1.4
3gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 38 1.4
4gb|CP000001.1| Bacillus cereus E33L, complete genome 38 1.4
5emb|AJ249463.1|BAN249463 Bacillus anthracis csaAB operon 38 1.4
6gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 38 1.4
7gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 38 1.4
8ref|XM_469994.1| Oryza sativa (japonica cultivar-group), mRNA 36 5.5
9gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 36 5.5
10emb|AL357032.13| Human DNA sequence from clone RP11-432M2 on chr... 36 5.5
11emb|AL136234.12| Human DNA sequence from clone RP5-933B4 on chro... 36 5.5
12gb|AC091020.10| Homo sapiens chromosome 18, clone RP11-701C7, co... 36 5.5
13gb|AC011804.6| Homo sapiens chromosome 18, clone RP11-71F23, com... 36 5.5
14dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 36 5.5
15gb|AC108906.9| Oryza sativa chromosome 3 BAC OSJNBa0087C10 genom... 36 5.5
16dbj|AK064481.1| Oryza sativa (japonica cultivar-group) cDNA clon... 36 5.5
17gb|AC106824.2| Homo sapiens chromosome 5 clone RP11-81H9, comple... 36 5.5
18dbj|AP001964.2| Homo sapiens genomic DNA, chromosome 4q22-q24, c... 36 5.5
19dbj|AP003498.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 36 5.5

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 14     tgcatgaatccactgcaacgatt 36
              |||||||||||||| ||||||||
Sbjct: 894083 tgcatgaatccactacaacgatt 894105



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 14     tgcatgaatccactgcaacgatt 36
              |||||||||||||| ||||||||
Sbjct: 893977 tgcatgaatccactacaacgatt 893999



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 6      aggagcactgcatgaatcc 24
              |||||||||||||||||||
Sbjct: 712884 aggagcactgcatgaatcc 712902



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 14     tgcatgaatccactgcaacgatt 36
              |||||||||||||| ||||||||
Sbjct: 898698 tgcatgaatccactacaacgatt 898720



to top

>emb|AJ249463.1|BAN249463 Bacillus anthracis csaAB operon
          Length = 3444

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 14   tgcatgaatccactgcaacgatt 36
            |||||||||||||| ||||||||
Sbjct: 1069 tgcatgaatccactacaacgatt 1091



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 14     tgcatgaatccactgcaacgatt 36
              |||||||||||||| ||||||||
Sbjct: 894082 tgcatgaatccactacaacgatt 894104



to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 38.2 bits (19), Expect = 1.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 14     tgcatgaatccactgcaacgatt 36
              |||||||||||||| ||||||||
Sbjct: 996906 tgcatgaatccactacaacgatt 996928



to top

>ref|XM_469994.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 8122

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 23   ccactgcaacgattgaca 40
            ||||||||||||||||||
Sbjct: 5636 ccactgcaacgattgaca 5653



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                  
Query: 23       ccactgcaacgattgaca 40
                ||||||||||||||||||
Sbjct: 33229939 ccactgcaacgattgaca 33229922



to top

>emb|AL357032.13| Human DNA sequence from clone RP11-432M2 on chromosome 9 Contains a novel
              gene, complete sequence
          Length = 115438

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 17     atgaatccactgcaacga 34
              ||||||||||||||||||
Sbjct: 107326 atgaatccactgcaacga 107309



to top

>emb|AL136234.12| Human DNA sequence from clone RP5-933B4 on chromosome 1p22.3-31.1
             Contains a novel gene and the 5' end of a novel gene,
             complete sequence
          Length = 119481

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 13    ctgcatgaatccactgca 30
             ||||||||||||||||||
Sbjct: 69144 ctgcatgaatccactgca 69127



to top

>gb|AC091020.10| Homo sapiens chromosome 18, clone RP11-701C7, complete sequence
          Length = 184164

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 2      aaaaaggagcactgcatg 19
              ||||||||||||||||||
Sbjct: 156460 aaaaaggagcactgcatg 156477



to top

>gb|AC011804.6| Homo sapiens chromosome 18, clone RP11-71F23, complete sequence
          Length = 205174

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 2      aaaaaggagcactgcatg 19
              ||||||||||||||||||
Sbjct: 190441 aaaaaggagcactgcatg 190458



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                  
Query: 23       ccactgcaacgattgaca 40
                ||||||||||||||||||
Sbjct: 33320449 ccactgcaacgattgaca 33320432



to top

>gb|AC108906.9| Oryza sativa chromosome 3 BAC OSJNBa0087C10 genomic sequence, complete
             sequence
          Length = 144487

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 23    ccactgcaacgattgaca 40
             ||||||||||||||||||
Sbjct: 14616 ccactgcaacgattgaca 14633



to top

>dbj|AK064481.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-111-A10, full
           insert sequence
          Length = 3054

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 23  ccactgcaacgattgaca 40
           ||||||||||||||||||
Sbjct: 239 ccactgcaacgattgaca 256



to top

>gb|AC106824.2| Homo sapiens chromosome 5 clone RP11-81H9, complete sequence
          Length = 127326

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    actgcatgaatccactgc 29
             ||||||||||||||||||
Sbjct: 59278 actgcatgaatccactgc 59261



to top

>dbj|AP001964.2| Homo sapiens genomic DNA, chromosome 4q22-q24, clone:2133K21, complete
             sequence
          Length = 94739

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     gaaaaaggagcactgcat 18
             ||||||||||||||||||
Sbjct: 45340 gaaaaaggagcactgcat 45323



to top

>dbj|AP003498.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-167J8, complete
             sequence
          Length = 120199

 Score = 36.2 bits (18), Expect = 5.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    cactgcatgaatccactg 28
             ||||||||||||||||||
Sbjct: 48376 cactgcatgaatccactg 48393


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 259,079
Number of Sequences: 3902068
Number of extensions: 259079
Number of successful extensions: 58584
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58322
Number of HSP's gapped (non-prelim): 262
length of query: 45
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 25
effective length of database: 17,155,003,908
effective search space: 428875097700
effective search space used: 428875097700
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top