>gb|AF510424.1|AF510423S2 Homo sapiens chromosome 5 BAC clone TAR28, 3' sequence
          Length = 470

 Score = 46.1 bits (23), Expect = 0.076
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 162 gggtgaacactggaaaaatttga 184
           |||||||||||||||||||||||
Sbjct: 202 gggtgaacactggaaaaatttga 224

>gb|AC148477.3| Homo sapiens 12 BAC RP13-895J2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 160802

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                         
Query: 140   caccagggga-tgcactcccactgggtg 166
             |||||||||| |||||||||||||||||
Sbjct: 45781 caccaggggaatgcactcccactgggtg 45754

>gb|AC123044.4| Mus musculus BAC clone RP24-548B7 from chromosome 5, complete sequence
          Length = 184772

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 153   actcccactgggtgaacact 172
             ||||||||||||||||||||
Sbjct: 99002 actcccactgggtgaacact 99021

>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome
          Length = 2971517

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 209     gcacttccactgggtgcaca 228
               ||||||||||||||||||||
Sbjct: 2256462 gcacttccactgggtgcaca 2256481


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,009,094
Number of Sequences: 3902068
Number of extensions: 3009094
Number of successful extensions: 48677
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 3
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 48670
Number of HSP's gapped (non-prelim): 8
length of query: 354
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 332
effective length of database: 17,147,199,772
effective search space: 5692870324304
effective search space used: 5692870324304
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)