ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart60h07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|BX005161.6| Zebrafish DNA sequence from clone CH211-168N16 i... 44 0.091
2gb|AC163742.4| Mus musculus BAC clone RP23-383K19 from chromosom... 42 0.36
3ref|XM_717457.1| Candida albicans SC5314 putative patatin-like p... 40 1.4
4ref|XM_717319.1| Candida albicans SC5314 putative patatin-like p... 40 1.4
5emb|AL670941.11| Mouse DNA sequence from clone RP23-291M22 on ch... 40 1.4
6gb|AC145877.3| Pan troglodytes BAC clone RP43-20I7 from 7, compl... 38 5.6
7gb|AC102792.7| Mus musculus chromosome 7, clone RP23-370I17, com... 38 5.6
8gb|AC140030.6| Medicago truncatula clone mth2-7g24, complete seq... 38 5.6
9gb|AC009196.14| Homo sapiens chromosome 7 clone RP11-49B7, compl... 38 5.6
10gb|AC007444.1|AC007444 Homo sapiens clone RP11-340F1 from 7p14-1... 38 5.6
11emb|AL929277.9| Mouse DNA sequence from clone RP23-153J22 on chr... 38 5.6
12emb|AL133494.1|HSE72 Homo sapiens chromosome X sequence from cos... 38 5.6

>emb|BX005161.6| Zebrafish DNA sequence from clone CH211-168N16 in linkage group 20,
             complete sequence
          Length = 150884

 Score = 44.1 bits (22), Expect = 0.091
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 13    tgtgatgggaagcacaagtatc 34
             ||||||||||||||||||||||
Sbjct: 52803 tgtgatgggaagcacaagtatc 52824



to top

>gb|AC163742.4| Mus musculus BAC clone RP23-383K19 from chromosome 14, complete sequence
          Length = 199109

 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 20     ggaagcacaagtatccatatg 40
              |||||||||||||||||||||
Sbjct: 136128 ggaagcacaagtatccatatg 136108



to top

>ref|XM_717457.1| Candida albicans SC5314 putative patatin-like phospholipase
           (CaO19_1504), mRNA
          Length = 2562

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 49  tcgtttcctttcacctctcc 68
           ||||||||||||||||||||
Sbjct: 741 tcgtttcctttcacctctcc 722



to top

>ref|XM_717319.1| Candida albicans SC5314 putative patatin-like phospholipase
           (CaO19_9080), mRNA
          Length = 2565

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 49  tcgtttcctttcacctctcc 68
           ||||||||||||||||||||
Sbjct: 741 tcgtttcctttcacctctcc 722



to top

>emb|AL670941.11| Mouse DNA sequence from clone RP23-291M22 on chromosome 4, complete
             sequence
          Length = 193162

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     caagtatgtgatgggaagca 26
             ||||||||||||||||||||
Sbjct: 89313 caagtatgtgatgggaagca 89332



to top

>gb|AC145877.3| Pan troglodytes BAC clone RP43-20I7 from 7, complete sequence
          Length = 192794

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 86    tactaactggatctaagat 104
             |||||||||||||||||||
Sbjct: 20603 tactaactggatctaagat 20585



to top

>gb|AC102792.7| Mus musculus chromosome 7, clone RP23-370I17, complete sequence
          Length = 215999

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 31     tatccatatgggatgggtt 49
              |||||||||||||||||||
Sbjct: 165529 tatccatatgggatgggtt 165511



to top

>gb|AC140030.6| Medicago truncatula clone mth2-7g24, complete sequence
          Length = 122057

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     aagacaagtatgtgatggg 21
             |||||||||||||||||||
Sbjct: 27562 aagacaagtatgtgatggg 27580



to top

>gb|AC009196.14| Homo sapiens chromosome 7 clone RP11-49B7, complete sequence
          Length = 170763

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 86     tactaactggatctaagat 104
              |||||||||||||||||||
Sbjct: 150215 tactaactggatctaagat 150233



to top

>gb|AC007444.1|AC007444 Homo sapiens clone RP11-340F1 from 7p14-15, complete sequence
          Length = 156940

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 86   tactaactggatctaagat 104
            |||||||||||||||||||
Sbjct: 1797 tactaactggatctaagat 1815



to top

>emb|AL929277.9| Mouse DNA sequence from clone RP23-153J22 on chromosome 4, complete
             sequence
          Length = 144310

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 52    tttcctttcacctctccta 70
             |||||||||||||||||||
Sbjct: 66494 tttcctttcacctctccta 66512



to top

>emb|AL133494.1|HSE72 Homo sapiens chromosome X sequence from cosmid ICRFc104D0920 map
           Xp21.1 region DXS709-SRPX, complete sequence
          Length = 37913

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 10  gtatgtgatgggaagcaca 28
           |||||||||||||||||||
Sbjct: 569 gtatgtgatgggaagcaca 587


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 716,336
Number of Sequences: 3902068
Number of extensions: 716336
Number of successful extensions: 45718
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45705
Number of HSP's gapped (non-prelim): 13
length of query: 121
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 100
effective length of database: 17,151,101,840
effective search space: 1715110184000
effective search space used: 1715110184000
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top