ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart60f02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|X75777.1|ASTCPP1 A.sativa (Pewi) ASTCP-K19 mRNA for t comple... 182 6e-43
2emb|X75778.1|ASTCPP1A A.sativa (Pewi) ASTCP-K36 mRNA for t compl... 178 9e-42
3dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 115 1e-22
4dbj|AP003714.2| Oryza sativa (japonica cultivar-group) genomic D... 115 1e-22
5dbj|AK105701.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
6dbj|AK067114.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
7gb|BT017463.1| Zea mays clone EL01N0407F08.c mRNA sequence 96 1e-16
8gb|AY103729.1| Zea mays PCO099347 mRNA sequence 92 2e-15
9gb|AF097668.1|AF097668 Mesembryanthemum crystallinum T-complex p... 78 2e-11
10emb|CR734406.2|CNS0GTG5 Tetraodon nigroviridis full-length cDNA 58 2e-05
11emb|CR734368.2|CNS0GTF3 Tetraodon nigroviridis full-length cDNA 58 2e-05
12emb|CR704636.2|CNS0G6NC Tetraodon nigroviridis full-length cDNA 58 2e-05
13emb|CR702647.2|CNS0G543 Tetraodon nigroviridis full-length cDNA 58 2e-05
14emb|CR693702.2|CNS0FY7M Tetraodon nigroviridis full-length cDNA 58 2e-05
15emb|CR693121.2|CNS0FXRH Tetraodon nigroviridis full-length cDNA 58 2e-05
16emb|CR692993.2|CNS0FXNX Tetraodon nigroviridis full-length cDNA 58 2e-05
17emb|CR682065.2|CNS0FP8D Tetraodon nigroviridis full-length cDNA 58 2e-05
18emb|CR664385.2|CNS0FBLZ Tetraodon nigroviridis full-length cDNA 58 2e-05
19emb|CR659491.2|CNS0F7U1 Tetraodon nigroviridis full-length cDNA 58 2e-05
20gb|AC141435.28| Medicago truncatula clone mth2-21i11, complete s... 58 2e-05
21emb|CT030174.3| M.truncatula DNA sequence from clone MTH2-71J12 ... 58 2e-05
22gb|AC077693.19| Oryza sativa chromosome 10 BAC OSJNBa0095C07 gen... 56 9e-05
23dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
24dbj|AK106739.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
25dbj|AK070073.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
26gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 56 9e-05
27emb|BX064596.1|CNS09M08 Single read from an extremity of a full-... 54 4e-04
28emb|BX059609.1|CNS09I5P Single read from an extremity of a full-... 54 4e-04
29emb|BX058534.1|CNS09HBU Single read from an extremity of a full-... 54 4e-04
30emb|BX058090.1|CNS09GZI Single read from an extremity of a full-... 54 4e-04
31emb|BX047036.1|CNS098GG Single read from an extremity of a full-... 54 4e-04
32emb|BX042897.1|CNS0959H Single read from an extremity of a full-... 54 4e-04
33emb|BX037203.1|CNS090VB Single read from an extremity of a full-... 54 4e-04
34emb|BX032800.1|CNS08XH0 Single read from an extremity of a full-... 54 4e-04
35emb|BX022454.1|CNS08PHM Single read from an extremity of a full-... 54 4e-04
36emb|BX025429.1|CNS08RS9 Single read from an extremity of a full-... 54 4e-04
37emb|BX025374.1|CNS08RQQ Single read from an extremity of a full-... 54 4e-04
38emb|BX025373.1|CNS08RQP Single read from an extremity of a full-... 54 4e-04
39emb|BX015203.1|CNS08JW7 Single read from an extremity of a full-... 54 4e-04
40emb|BX013195.1|CNS08ICF Single read from an extremity of a full-... 54 4e-04
41emb|BX010233.1|CNS08G25 Single read from an extremity of a full-... 54 4e-04
42emb|BX009560.1|CNS08FJG Single read from an extremity of a full-... 54 4e-04
43ref|XM_317219.2| Anopheles gambiae str. PEST ENSANGP00000012024 ... 54 4e-04
44ref|XM_307323.1| Anopheles gambiae str. PEST ENSANGP00000001996 ... 54 4e-04
45emb|BX010234.1|CNS08G26 Single read from an extremity of a full-... 50 0.006
46gb|AY398321.1| Danio rerio clone RK074A2D01 chaperonin containin... 48 0.022
47gb|AY648807.1| Danio rerio TCP-1 epsilon mRNA, complete cds 48 0.022
48gb|BC068037.1| Danio rerio chaperonin containing TCP1, subunit 5... 48 0.022
49emb|BX469922.12| Zebrafish DNA sequence from clone DKEY-30N5 in ... 48 0.022
50ref|NM_212613.1| Danio rerio chaperonin containing TCP1, subunit... 48 0.022
51ref|XM_762836.1| Giardia lamblia ATCC 50803 hypothetical protein... 46 0.088
52ref|XM_762838.1| Giardia lamblia ATCC 50803 chaperonin subunit e... 46 0.088
53emb|BX024353.1|CNS08QYD Single read from an extremity of a full-... 46 0.088
54ref|XM_774923.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.088
55ref|XM_796613.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.088
56gb|AF226724.1|AF226724 Giardia intestinalis chaperonin subunit e... 46 0.088
57emb|CR699738.2|CNS0G2VA Tetraodon nigroviridis full-length cDNA 44 0.35
58emb|BX033735.1|CNS08Y6Z Single read from an extremity of a full-... 44 0.35
59emb|BX025983.1|CNS08S7N Single read from an extremity of a full-... 44 0.35
60dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
61gb|AC092660.2| Homo sapiens BAC clone RP11-502A5 from 2, complet... 42 1.4
62dbj|AP005848.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
63gb|AC141436.17| Medicago truncatula clone mth2-31k19, complete s... 40 5.4
64gb|AC139706.8| Medicago truncatula clone mth2-28n21, complete se... 40 5.4
65emb|AL590138.7| Human DNA sequence from clone RP11-243A2 on chro... 40 5.4
66gb|AC007155.16| Arabidopsis thaliana chromosome 2 clone T18E17 m... 40 5.4
67gb|AC006437.5| Arabidopsis thaliana chromosome 2 clone T19K21 ma... 40 5.4
68dbj|AP000999.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 5.4
69dbj|AP002853.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 5.4
70gb|AC138027.3| Mus musculus BAC clone RP24-100L8 from 12, comple... 40 5.4 
>emb|X75777.1|ASTCPP1 A.sativa (Pewi) ASTCP-K19 mRNA for t complex polypeptide 1
          Length = 2039

 Score =  182 bits (92), Expect = 6e-43
 Identities = 113/120 (94%)
 Strand = Plus / Minus

                                                                        
Query: 286  tcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgtgt 345
            |||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||| ||
Sbjct: 1715 tcaatattcggaaggcgtgataacatcatcgatcttgaggatcatcttgacgacctgggt 1656

                                                                        
Query: 346  tgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttcat 405
            ||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||
Sbjct: 1655 tgccagcaagatctgctgctgcttgccaatcagagtttcaaaaacattctgctctttcat 1596



 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 84   aaactggtatcgacaggatttgt 106
            |||||||||||||||||||||||
Sbjct: 1927 aaactggtatcgacaggatttgt 1905
to top
>emb|X75778.1|ASTCPP1A A.sativa (Pewi) ASTCP-K36 mRNA for t complex polypeptide 1
          Length = 2022

 Score =  178 bits (90), Expect = 9e-42
 Identities = 105/110 (95%)
 Strand = Plus / Minus

                                                                        
Query: 296  gaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaag 355
            |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 1730 gaaggcgtgataacatcatcgatcttgaggatcatcttgacgacctgggttgccagcaag 1671

                                                              
Query: 356  atctgctgctgcttgccgatcagagtctcgaaaacattctgctctttcat 405
            ||||||||||||||||| |||||||| |||||||||||||||||||||||
Sbjct: 1670 atctgctgctgcttgccaatcagagtttcgaaaacattctgctctttcat 1621



 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 84   aaactggtatcgacaggatttgt 106
            |||||||||||||||||||||||
Sbjct: 1956 aaactggtatcgacaggatttgt 1934
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  115 bits (58), Expect = 1e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                            
Query: 284      catcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgt 343
                |||||||| || |||||||  |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 21250809 catcaatagtcagaaggcgagataacatcatcgatcttgagaatcatcttcaccacctgg 21250868

                                                                  
Query: 344      gttgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacatt 393
                |||||||| |||||||||||||||||||| ||||| || || ||||||||
Sbjct: 21250869 gttgccagtaagatctgctgctgcttgcctatcagtgtttcaaaaacatt 21250918
to top
>dbj|AP003714.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0656E03
          Length = 181786

 Score =  115 bits (58), Expect = 1e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                         
Query: 284   catcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgt 343
             |||||||| || |||||||  |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 46185 catcaatagtcagaaggcgagataacatcatcgatcttgagaatcatcttcaccacctgg 46244

                                                               
Query: 344   gttgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacatt 393
             |||||||| |||||||||||||||||||| ||||| || || ||||||||
Sbjct: 46245 gttgccagtaagatctgctgctgcttgcctatcagtgtttcaaaaacatt 46294
to top
>dbj|AK105701.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-201-D07, full
            insert sequence
          Length = 2088

 Score =  115 bits (58), Expect = 1e-22
 Identities = 97/110 (88%)
 Strand = Plus / Minus

                                                                        
Query: 284  catcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgt 343
            |||||||| || |||||||  |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 1703 catcaatagtcagaaggcgagataacatcatcgatcttgagaatcatcttcaccacctgg 1644

                                                              
Query: 344  gttgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacatt 393
            |||||||| |||||||||||||||||||| ||||| || || ||||||||
Sbjct: 1643 gttgccagtaagatctgctgctgcttgcctatcagtgtttcaaaaacatt 1594
to top
>dbj|AK067114.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013095K16, full
            insert sequence
          Length = 2100

 Score =  115 bits (58), Expect = 1e-22
 Identities = 97/110 (88%)
 Strand = Plus / Minus

                                                                        
Query: 284  catcaatactcggaaggcgttataacatcatcgatcttgaggatcatcttgacaacctgt 343
            |||||||| || |||||||  |||||||||||||||||||| |||||||| || ||||| 
Sbjct: 1717 catcaatagtcagaaggcgagataacatcatcgatcttgagaatcatcttcaccacctgg 1658

                                                              
Query: 344  gttgccagcaagatctgctgctgcttgccgatcagagtctcgaaaacatt 393
            |||||||| |||||||||||||||||||| ||||| || || ||||||||
Sbjct: 1657 gttgccagtaagatctgctgctgcttgcctatcagtgtttcaaaaacatt 1608
to top
>gb|BT017463.1| Zea mays clone EL01N0407F08.c mRNA sequence
          Length = 710

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 81/92 (88%)
 Strand = Plus / Minus

                                                                       
Query: 314 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 373
           |||||||| ||||||||||| || ||||| ||||| |||| |||||||||||||||||| 
Sbjct: 379 tcgatcttcaggatcatcttcaccacctgagttgctagcaggatctgctgctgcttgcca 320

                                           
Query: 374 atcagagtctcgaaaacattctgctctttcat 405
           ||||| ||||| || || ||||||||||||||
Sbjct: 319 atcagggtctcaaagacgttctgctctttcat 288
to top
>gb|AY103729.1| Zea mays PCO099347 mRNA sequence
          Length = 2083

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 85/98 (86%)
 Strand = Plus / Minus

                                                                        
Query: 308  acatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgc 367
            ||||| |||||||| ||||||||||| || ||||| || || ||||||||||| ||||||
Sbjct: 1706 acatcgtcgatcttcaggatcatcttcaccacctgggtggcaagcaagatctgttgctgc 1647

                                                  
Query: 368  ttgccgatcagagtctcgaaaacattctgctctttcat 405
            ||||| ||||| |||||||| || ||||| ||||||||
Sbjct: 1646 ttgccaatcagggtctcgaagacgttctgttctttcat 1609
to top
>gb|AF097668.1|AF097668 Mesembryanthemum crystallinum T-complex protein 1 epsilon subunit
            (TCP-1-EPSILON) mRNA, partial cds
          Length = 1458

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                        
Query: 305  ataacatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgc 364
            ||||||||||||||||| |  |||||||| |||||||| || |||||||| | ||| |||
Sbjct: 1238 ataacatcatcgatcttcaaaatcatcttcacaacctgagtagccagcaaaagctgttgc 1179

                                               
Query: 365  tgcttgccgatcagagtctcgaaaacattctgctc 399
            | ||| || ||||  ||||||||||||||||||||
Sbjct: 1178 ttctttccaatcaatgtctcgaaaacattctgctc 1144
to top
>emb|CR734406.2|CNS0GTG5 Tetraodon nigroviridis full-length cDNA
          Length = 275

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 314 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 373
           |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 95  tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 36

                        
Query: 374 atcagagtctcga 386
           ||||| |||||||
Sbjct: 35  atcagggtctcga 23
to top
>emb|CR734368.2|CNS0GTF3 Tetraodon nigroviridis full-length cDNA
          Length = 1888

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 314  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 373
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1708 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1649

                         
Query: 374  atcagagtctcga 386
            ||||| |||||||
Sbjct: 1648 atcagggtctcga 1636
to top
>emb|CR704636.2|CNS0G6NC Tetraodon nigroviridis full-length cDNA
          Length = 1816

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 314  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 373
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1697 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1638

                         
Query: 374  atcagagtctcga 386
            ||||| |||||||
Sbjct: 1637 atcagggtctcga 1625
to top
>emb|CR702647.2|CNS0G543 Tetraodon nigroviridis full-length cDNA
          Length = 1848

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 314  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 373
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1676 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1617

                         
Query: 374  atcagagtctcga 386
            ||||| |||||||
Sbjct: 1616 atcagggtctcga 1604
to top
>emb|CR693702.2|CNS0FY7M Tetraodon nigroviridis full-length cDNA
          Length = 1102

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 314 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 373
           |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 918 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 859

                        
Query: 374 atcagagtctcga 386
           ||||| |||||||
Sbjct: 858 atcagggtctcga 846
to top
>emb|CR693121.2|CNS0FXRH Tetraodon nigroviridis full-length cDNA
          Length = 1851

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 314  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 373
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1691 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1632

                         
Query: 374  atcagagtctcga 386
            ||||| |||||||
Sbjct: 1631 atcagggtctcga 1619
to top
>emb|CR692993.2|CNS0FXNX Tetraodon nigroviridis full-length cDNA
          Length = 1013

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 314 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 373
           |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 830 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 771

                        
Query: 374 atcagagtctcga 386
           ||||| |||||||
Sbjct: 770 atcagggtctcga 758
to top
>emb|CR682065.2|CNS0FP8D Tetraodon nigroviridis full-length cDNA
          Length = 1001

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                       
Query: 314 tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 373
           |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 824 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 765

                        
Query: 374 atcagagtctcga 386
           ||||| |||||||
Sbjct: 764 atcagggtctcga 752
to top
>emb|CR664385.2|CNS0FBLZ Tetraodon nigroviridis full-length cDNA
          Length = 1196

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 314  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 373
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1013 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 954

                         
Query: 374  atcagagtctcga 386
            ||||| |||||||
Sbjct: 953  atcagggtctcga 941
to top
>emb|CR659491.2|CNS0F7U1 Tetraodon nigroviridis full-length cDNA
          Length = 1879

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                        
Query: 314  tcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttgccg 373
            |||||||| |||||||||||||| || || || || |||| ||| |||||||  ||||||
Sbjct: 1703 tcgatctttaggatcatcttgacgacttgggtggcgagcaggatttgctgctttttgccg 1644

                         
Query: 374  atcagagtctcga 386
            ||||| |||||||
Sbjct: 1643 atcagggtctcga 1631
to top
>gb|AC141435.28| Medicago truncatula clone mth2-21i11, complete sequence
          Length = 132497

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Minus

                                                                          
Query: 305    ataacatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgc 364
              ||||||||||| || || |  |||||||||||||| || || || ||||||||||| |||
Sbjct: 107610 ataacatcatcaatttttaatatcatcttgacaacttgagtagcaagcaagatctgttgc 107551

                           
Query: 365    tgcttgccgatca 377
              ||||| |||||||
Sbjct: 107550 tgctttccgatca 107538
to top
>emb|CT030174.3| M.truncatula DNA sequence from clone MTH2-71J12 on chromosome 3,
             complete sequence
          Length = 133240

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                         
Query: 305   ataacatcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgc 364
             ||||||||||| || || |  |||||||||||||| || || || ||||||||||| |||
Sbjct: 96253 ataacatcatcaatttttaatatcatcttgacaacttgagtagcaagcaagatctgttgc 96312

                          
Query: 365   tgcttgccgatca 377
             ||||| |||||||
Sbjct: 96313 tgctttccgatca 96325
to top
>gb|AC077693.19| Oryza sativa chromosome 10 BAC OSJNBa0095C07 genomic sequence, complete
             sequence
          Length = 187707

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 311   tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 370
             ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 15677 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 15618
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 311      tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 370
                ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 22011133 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 22011074
to top
>dbj|AK106739.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-B02, full
           insert sequence
          Length = 1961

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 370
           ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 388 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 329
to top
>dbj|AK070073.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023043F15, full
            insert sequence
          Length = 3156

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                        
Query: 311  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 370
            ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 2027 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 1968
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 311      tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 370
                ||||| |||||||| ||||| || || ||||| |||| ||||| ||||||||||||||||
Sbjct: 22022796 tcatcaatcttgagaatcattttcaccacctgagttgtcagcacgatctgctgctgcttg 22022737
to top
>emb|BX064596.1|CNS09M08 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 345 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 399
to top
>emb|BX059609.1|CNS09I5P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 544 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 490
to top
>emb|BX058534.1|CNS09HBU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 384 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 438
to top
>emb|BX058090.1|CNS09GZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 416 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 470
to top
>emb|BX047036.1|CNS098GG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 592

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 351 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 405
to top
>emb|BX042897.1|CNS0959H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 686

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 358 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 412
to top
>emb|BX037203.1|CNS090VB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 404 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 458
to top
>emb|BX032800.1|CNS08XH0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 470

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 341 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 395
to top
>emb|BX022454.1|CNS08PHM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 360 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 414
to top
>emb|BX025429.1|CNS08RS9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 161 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 215
to top
>emb|BX025374.1|CNS08RQQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 402 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 456
to top
>emb|BX025373.1|CNS08RQP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 671 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 617
to top
>emb|BX015203.1|CNS08JW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 329 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 383
to top
>emb|BX013195.1|CNS08ICF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 347 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 401
to top
>emb|BX010233.1|CNS08G25 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 670 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 616
to top
>emb|BX009560.1|CNS08FJG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 325 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 379
to top
>ref|XM_317219.2| Anopheles gambiae str. PEST ENSANGP00000012024 (ENSANGG00000009535),
            partial mRNA
          Length = 1779

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 311  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
            |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 1769 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 1715
to top
>ref|XM_307323.1| Anopheles gambiae str. PEST ENSANGP00000001996 (ENSANGG00000001693),
            partial mRNA
          Length = 1515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 311  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
            |||||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 1505 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 1451
to top
>emb|BX010234.1|CNS08G26 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 313 atcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||| ||||||||||| | ||| || || |||| |||||||||||
Sbjct: 407 atcgatcttgagaatcatcttgacgagctgggtggcgagcacgatctgctgct 459
to top
>gb|AY398321.1| Danio rerio clone RK074A2D01 chaperonin containing TCP1, subunit 5
            (epsilon) (CCT5) mRNA, complete cds
          Length = 1896

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                        
Query: 311  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 370
            ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 1709 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 1650

                            
Query: 371  ccgatcagagtctcga 386
            ||||| || |||||||
Sbjct: 1649 ccgataagggtctcga 1634
to top
>gb|AY648807.1| Danio rerio TCP-1 epsilon mRNA, complete cds
          Length = 1853

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                        
Query: 311  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 370
            ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 1684 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 1625

                            
Query: 371  ccgatcagagtctcga 386
            ||||| || |||||||
Sbjct: 1624 ccgataagggtctcga 1609
to top
>gb|BC068037.1| Danio rerio chaperonin containing TCP1, subunit 5 (epsilon), mRNA
            (cDNA clone MGC:77639 IMAGE:6996933), complete cds
          Length = 1879

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                        
Query: 311  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 370
            ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 1694 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 1635

                            
Query: 371  ccgatcagagtctcga 386
            ||||| || |||||||
Sbjct: 1634 ccgataagggtctcga 1619
to top
>emb|BX469922.12| Zebrafish DNA sequence from clone DKEY-30N5 in linkage group 24, complete
              sequence
          Length = 200409

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                          
Query: 311    tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 370
              ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 165976 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 166035

                              
Query: 371    ccgatcagagtctcga 386
              ||||| || |||||||
Sbjct: 166036 ccgataagggtctcga 166051
to top
>ref|NM_212613.1| Danio rerio chaperonin containing TCP1, subunit 5 (epsilon) (cct5),
            mRNA
          Length = 1896

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                        
Query: 311  tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgctgcttg 370
            ||||| ||||| || |||||||| ||||| || || |||||  |||||||||||| ||| 
Sbjct: 1709 tcatcaatcttcagaatcatctttacaacttgagtggccagagagatctgctgcttcttc 1650

                            
Query: 371  ccgatcagagtctcga 386
            ||||| || |||||||
Sbjct: 1649 ccgataagggtctcga 1634
to top
>ref|XM_762836.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_549_7513_8304)
           partial mRNA
          Length = 792

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagca 353
           ||||||||||||||||||||   ||| |||||||| |||||||
Sbjct: 593 tcatcgatcttgaggatcatgcggacgacctgtgtggccagca 635
to top
>ref|XM_762838.1| Giardia lamblia ATCC 50803 chaperonin subunit epsilon
            (GLP_549_9744_8083) partial mRNA
          Length = 1662

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 311  tcatcgatcttgaggatcatcttgacaacctgtgttgccagca 353
            ||||||||||||||||||||   ||| |||||||| |||||||
Sbjct: 1640 tcatcgatcttgaggatcatgcggacgacctgtgtggccagca 1598
to top
>emb|BX024353.1|CNS08QYD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 311 tcatcgatcttgaggatcatcttgacaacctgtgttgccagcaagatctgctgct 365
           |||||||||||||| ||||||||||| | ||| || || |||| | |||||||||
Sbjct: 339 tcatcgatcttgagaatcatcttgacgagctgggtggcgagcacgttctgctgct 393
to top
>ref|XM_774923.1| PREDICTED: Strongylocentrotus purpuratus similar to chaperonin
            containing TCP1, subunit 5 (epsilon), transcript variant
            1 (LOC575808), mRNA
          Length = 2235

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 355  gatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttcat 405
            |||||| |||| |||||| ||||||||||| || |||| |||||| |||||
Sbjct: 1650 gatctgttgcttcttgccaatcagagtctcaaacacatgctgctccttcat 1600
to top
>ref|XM_796613.1| PREDICTED: Strongylocentrotus purpuratus similar to chaperonin
            containing TCP1, subunit 5 (epsilon), transcript variant
            2 (LOC575808), mRNA
          Length = 2250

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 355  gatctgctgctgcttgccgatcagagtctcgaaaacattctgctctttcat 405
            |||||| |||| |||||| ||||||||||| || |||| |||||| |||||
Sbjct: 1665 gatctgttgcttcttgccaatcagagtctcaaacacatgctgctccttcat 1615
to top
>gb|AF226724.1|AF226724 Giardia intestinalis chaperonin subunit epsilon CCTepsilon (Ccte)
            gene, complete cds
          Length = 1829

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 311  tcatcgatcttgaggatcatcttgacaacctgtgttgccagca 353
            ||||||||||||||||||||   ||| |||||||| |||||||
Sbjct: 1730 tcatcgatcttgaggatcatgcggacgacctgtgtggccagca 1688
to top
>emb|CR699738.2|CNS0G2VA Tetraodon nigroviridis full-length cDNA
          Length = 1834

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 62/74 (83%), Gaps = 1/74 (1%)
 Strand = Plus / Minus

                                                                        
Query: 314  tcgatcttgaggatcatct-tgacaacctgtgttgccagcaagatctgctgctgcttgcc 372
            |||||||| |||||||||| |||| || || || || |||| ||| |||||||  |||||
Sbjct: 1669 tcgatcttaaggatcatctatgacgacttgggtggcgagcaggatttgctgctttttgcc 1610

                          
Query: 373  gatcagagtctcga 386
            |||||| |||||||
Sbjct: 1609 gatcagggtctcga 1596
to top
>emb|BX033735.1|CNS08Y6Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 707

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 311 tcatcgatcttgaggatcatcttgac 336
           |||||||||||||| |||||||||||
Sbjct: 330 tcatcgatcttgagaatcatcttgac 355
to top
>emb|BX025983.1|CNS08S7N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 148

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 311 tcatcgatcttgaggatcatcttgac 336
           |||||||||||||| |||||||||||
Sbjct: 79  tcatcgatcttgagaatcatcttgac 104
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 358      ctgctgctgcttgccgatcag 378
                |||||||||||||||||||||
Sbjct: 31442963 ctgctgctgcttgccgatcag 31442983
to top
>gb|AC092660.2| Homo sapiens BAC clone RP11-502A5 from 2, complete sequence
          Length = 154704

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 343    tgttgccagcaagatctgctg 363
              |||||||||||||||||||||
Sbjct: 104641 tgttgccagcaagatctgctg 104621
to top
>dbj|AP005848.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0078N11
          Length = 155168

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 358   ctgctgctgcttgccgatcag 378
             |||||||||||||||||||||
Sbjct: 78360 ctgctgctgcttgccgatcag 78380
to top
>gb|AC141436.17| Medicago truncatula clone mth2-31k19, complete sequence
          Length = 112268

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    tttgtggtccaaaaccatag 53
             ||||||||||||||||||||
Sbjct: 46607 tttgtggtccaaaaccatag 46626
to top
>gb|AC139706.8| Medicago truncatula clone mth2-28n21, complete sequence
          Length = 106244

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 34    tttgtggtccaaaaccatag 53
             ||||||||||||||||||||
Sbjct: 59645 tttgtggtccaaaaccatag 59626
to top
>emb|AL590138.7| Human DNA sequence from clone RP11-243A2 on chromosome 1 Contains part of
              the PLXNA2 gene for plexin A2, complete sequence
          Length = 164057

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 348    ccagcaagatctgctgctgcttgc 371
              ||||||| ||||||||||||||||
Sbjct: 116407 ccagcaacatctgctgctgcttgc 116430
to top
>gb|AC007155.16| Arabidopsis thaliana chromosome 2 clone T18E17 map PR1, complete
             sequence
          Length = 96095

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 354   agatctgctgctgcttgccgatca 377
             ||||||||||||||| ||||||||
Sbjct: 27576 agatctgctgctgctcgccgatca 27553
to top
>gb|AC006437.5| Arabidopsis thaliana chromosome 2 clone T19K21 map mi421, complete
             sequence
          Length = 76713

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 354   agatctgctgctgcttgccgatca 377
             ||||||||||||||| ||||||||
Sbjct: 71220 agatctgctgctgctcgccgatca 71197
to top
>dbj|AP000999.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-667I23, complete
              sequence
          Length = 189892

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 213    taacacaataaatgtgcacc 232
              ||||||||||||||||||||
Sbjct: 100507 taacacaataaatgtgcacc 100488
to top
>dbj|AP002853.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-46K15, complete
             sequence
          Length = 177463

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 213   taacacaataaatgtgcacc 232
             ||||||||||||||||||||
Sbjct: 18067 taacacaataaatgtgcacc 18048
to top
>gb|AC138027.3| Mus musculus BAC clone RP24-100L8 from 12, complete sequence
          Length = 201839

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 213    taacacaataaatgtgcacc 232
              ||||||||||||||||||||
Sbjct: 111526 taacacaataaatgtgcacc 111545


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,048,179
Number of Sequences: 3902068
Number of extensions: 5048179
Number of successful extensions: 61872
Number of sequences better than 10.0: 70
Number of HSP's better than 10.0 without gapping: 69
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 61731
Number of HSP's gapped (non-prelim): 142
length of query: 405
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 383
effective length of database: 17,147,199,772
effective search space: 6567377512676
effective search space used: 6567377512676
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top