ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart60e07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC159228.2| Mus musculus BAC clone RP24-338I14 from chromosom... 42 1.2
2emb|AL133412.7| Human DNA sequence from clone RP11-78H18 on chro... 42 1.2
3gb|AC173481.1| Mus musculus BAC clone RP23-411A24 from chromosom... 42 1.2
4gb|AC121514.14| Mus musculus chromosome 8, clone RP24-394H9, com... 40 4.9
5gb|AC102775.6| Mus musculus chromosome 8, clone RP23-115C10, com... 40 4.9
6gb|AC161571.11| Mus musculus chromosome 7, clone RP23-403M22, co... 40 4.9
7gb|AC147925.2| Oryza sativa (japonica cultivar-group) chromosome... 40 4.9
8gb|AC159614.7| Mus musculus chromosome 1, clone RP24-305O23, com... 40 4.9
9gb|AC165253.2| Mus musculus BAC clone RP23-413P10 from chromosom... 40 4.9
10gb|AC113123.8| Mus musculus chromosome 8, clone RP23-349O15, com... 40 4.9
11emb|CR640683.2|CNS0ETBL Tetraodon nigroviridis full-length cDNA 40 4.9
12gb|AY343333.1| Enterobacteria phage RB49, complete genome 40 4.9
13gb|AF491780.1| Homo sapiens neuregulin 1 (NRG1) gene, partial cd... 40 4.9
14emb|AL160287.18| Human DNA sequence from clone RP11-128B16 on ch... 40 4.9
15emb|AL158819.14| Human DNA sequence from clone RP11-382F24 on ch... 40 4.9
16gb|AC158295.5| Mus musculus chromosome 8, clone RP24-208G23, com... 40 4.9
17dbj|AB081624.1| Misgurnus anguillicaudatus DNA, microsatellite M... 40 4.9
18gb|AC083977.5| Homo sapiens chromosome 8, clone RP11-317J8, comp... 40 4.9
19gb|AC013561.9| Homo sapiens chromosome 8, clone RP11-301H15, com... 40 4.9
20gb|AC093494.1| Homo sapiens chromosome 3 clone RP11-1004I19 map ... 40 4.9
21gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 4.9
22tpg|BK000383.1| TPA: TPA_exp: Homo sapiens neuregulin 1 isoform ... 40 4.9
23dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.9
24dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.9
25dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.9
26gb|AC008197.3|AC008197 Drosophila melanogaster, chromosome 3R, r... 40 4.9
27gb|AC009846.9|AC009846 Drosophila melanogaster, chromosome 3R, r... 40 4.9
28gb|AC093822.2| Homo sapiens BAC clone RP11-382L24 from 2, comple... 40 4.9
29gb|AC091492.2| Homo sapiens chromosome 3 clone RP11-335I9 map 3p... 40 4.9
30dbj|AP005864.2| Oryza sativa (japonica cultivar-group) genomic D... 40 4.9
31ref|NM_212328.2| Eremothecium gossypii AFR644Cp (AFR644C), mRNA 40 4.9
32gb|AC118007.11| Mus musculus chromosome 9, clone RP23-377N5, com... 40 4.9
33gb|AE003740.3| Drosophila melanogaster chromosome 3R, section 78... 40 4.9
34gb|AC147744.17| Mus musculus chromosome 18, clone RP23-398N23, c... 40 4.9
35gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 4.9
36gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 4.9
37emb|AL732647.4|CNS08C9M Oryza sativa chromosome 12, . BAC OSJNBb... 40 4.9
38emb|AL731670.13| Mouse DNA sequence from clone RP23-463E7 on chr... 40 4.9
39emb|AL805952.11| Mouse DNA sequence from clone RP23-125H10 on ch... 40 4.9 
>gb|AC159228.2| Mus musculus BAC clone RP24-338I14 from chromosome 13, complete
             sequence
          Length = 158726

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 259   aacatacatgcatggacgcatgcac 283
             |||||| ||||||||||||||||||
Sbjct: 51828 aacatagatgcatggacgcatgcac 51804
to top
>emb|AL133412.7| Human DNA sequence from clone RP11-78H18 on chromosome 9q22.1-22.33
             Contains the 5' end of the TNFSF15 gene for tumor necrosis
             factor (ligand) superfamily, member 15 (TL1, VEG1), a PRP4
             pre-mRNA processing factor 4 homolog B (PR4H, Prp4, PRP4H,
             PRP4K, KIAA0536) (PRPF4B) pseudogene and the TNFSF8 gene
             for tumor necrosis factor (ligand) superfamily, member 8
             (CD153, CD30L, CD30LG), complete sequence
          Length = 158717

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 15    ttacatttcatcaaacaaata 35
             |||||||||||||||||||||
Sbjct: 48478 ttacatttcatcaaacaaata 48498
to top
>gb|AC173481.1| Mus musculus BAC clone RP23-411A24 from chromosome 13, complete
             sequence
          Length = 203948

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 259   aacatacatgcatggacgcatgcac 283
             |||||| ||||||||||||||||||
Sbjct: 64136 aacatagatgcatggacgcatgcac 64160
to top
>gb|AC121514.14| Mus musculus chromosome 8, clone RP24-394H9, complete sequence
          Length = 168316

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 66    gttgaagcacacacacgcac 85
             ||||||||||||||||||||
Sbjct: 59025 gttgaagcacacacacgcac 59006
to top
>gb|AC102775.6| Mus musculus chromosome 8, clone RP23-115C10, complete sequence
          Length = 185846

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 17     acatttcatcaaacaaatacaagt 40
              |||||||||||||||||| |||||
Sbjct: 139551 acatttcatcaaacaaatgcaagt 139574
to top
>gb|AC161571.11| Mus musculus chromosome 7, clone RP23-403M22, complete sequence
          Length = 211052

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   agccaaactaagacaaatta 137
             ||||||||||||||||||||
Sbjct: 58117 agccaaactaagacaaatta 58098
to top
>gb|AC147925.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0032N11
              map near 50283S, complete sequence
          Length = 139217

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 285    ggcgatgcatgcatgcatgc 304
              ||||||||||||||||||||
Sbjct: 111650 ggcgatgcatgcatgcatgc 111631
to top
>gb|AC159614.7| Mus musculus chromosome 1, clone RP24-305O23, complete sequence
          Length = 156924

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 260   acatacatgcatggacgcatgcac 283
             ||||||||||||| ||||||||||
Sbjct: 39454 acatacatgcatgcacgcatgcac 39477
to top
>gb|AC165253.2| Mus musculus BAC clone RP23-413P10 from chromosome 9, complete sequence
          Length = 200549

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 264   acatgcatggacgcatgcac 283
             ||||||||||||||||||||
Sbjct: 35417 acatgcatggacgcatgcac 35436
to top
>gb|AC113123.8| Mus musculus chromosome 8, clone RP23-349O15, complete sequence
          Length = 213829

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 17     acatttcatcaaacaaatacaagt 40
              |||||||||||||||||| |||||
Sbjct: 145553 acatttcatcaaacaaatgcaagt 145530
to top
>emb|CR640683.2|CNS0ETBL Tetraodon nigroviridis full-length cDNA
          Length = 1140

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 170 acacacgcacgcacgaacga 189
           ||||||||||||||||||||
Sbjct: 34  acacacgcacgcacgaacga 15
to top
>gb|AY343333.1| Enterobacteria phage RB49, complete genome
          Length = 164018

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 178    acgcacgaacgaaaaactac 197
              ||||||||||||||||||||
Sbjct: 109550 acgcacgaacgaaaaactac 109569
to top
>gb|AF491780.1| Homo sapiens neuregulin 1 (NRG1) gene, partial cds, alternatively spliced
          Length = 1285452

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 149     ttaaccagtgcatataaatgaaca 172
               |||| |||||||||||||||||||
Sbjct: 1189842 ttaagcagtgcatataaatgaaca 1189819
to top
>emb|AL160287.18| Human DNA sequence from clone RP11-128B16 on chromosome 10p11.1-11.23
              Contains the 3' end of the APBB1IP gene for amyloid beta
              (A4) precursor protein-binding family B member 1
              interacting protein and two novel genes, complete sequence
          Length = 144666

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 44     acacatgctcaatcaaatta 63
              ||||||||||||||||||||
Sbjct: 113246 acacatgctcaatcaaatta 113227
to top
>emb|AL158819.14| Human DNA sequence from clone RP11-382F24 on chromosome X Contains a
             NADH dehydrogenase 2 (MTND2) pseudogene, a NADH
             dehydrogenase 1 (MTND1) pseudogene, the gene for PAGE-5
             protein (PAGE-5) and two novel genes, complete sequence
          Length = 174913

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     tgcaaattacatttcatcaa 28
             ||||||||||||||||||||
Sbjct: 86485 tgcaaattacatttcatcaa 86466
to top
>gb|AC158295.5| Mus musculus chromosome 8, clone RP24-208G23, complete sequence
          Length = 167209

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    gttgaagcacacacacgcac 85
             ||||||||||||||||||||
Sbjct: 82309 gttgaagcacacacacgcac 82328
to top
>dbj|AB081624.1| Misgurnus anguillicaudatus DNA, microsatellite Mac43
          Length = 390

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 293 atgcatgcatgccttgctttggtt 316
           |||||||||||| |||||||||||
Sbjct: 249 atgcatgcatgcattgctttggtt 226
to top
>gb|AC083977.5| Homo sapiens chromosome 8, clone RP11-317J8, complete sequence
          Length = 212555

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 149    ttaaccagtgcatataaatgaaca 172
              |||| |||||||||||||||||||
Sbjct: 118123 ttaagcagtgcatataaatgaaca 118100
to top
>gb|AC013561.9| Homo sapiens chromosome 8, clone RP11-301H15, complete sequence
          Length = 185249

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 149    ttaaccagtgcatataaatgaaca 172
              |||| |||||||||||||||||||
Sbjct: 153349 ttaagcagtgcatataaatgaaca 153372
to top
>gb|AC093494.1| Homo sapiens chromosome 3 clone RP11-1004I19 map 3p, complete sequence
          Length = 159189

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 247    aaagaagataacaacataca 266
              ||||||||||||||||||||
Sbjct: 151769 aaagaagataacaacataca 151750
to top
>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
               complete sequence
          Length = 1813164

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 19      atttcatcaaacaaatacaa 38
               ||||||||||||||||||||
Sbjct: 1611537 atttcatcaaacaaatacaa 1611556
to top
>tpg|BK000383.1| TPA: TPA_exp: Homo sapiens neuregulin 1 isoform (NRG1) gene, alternatively
               spliced, complete cds
          Length = 1421559

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 149     ttaaccagtgcatataaatgaaca 172
               |||| |||||||||||||||||||
Sbjct: 1189842 ttaagcagtgcatataaatgaaca 1189819
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 289      atgcatgcatgcatgccttg 308
                ||||||||||||||||||||
Sbjct: 21858116 atgcatgcatgcatgccttg 21858135
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 285      ggcgatgcatgcatgcatgc 304
                ||||||||||||||||||||
Sbjct: 14496816 ggcgatgcatgcatgcatgc 14496797
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 105      gtacgtagtacacagccaaa 124
                ||||||||||||||||||||
Sbjct: 20178807 gtacgtagtacacagccaaa 20178826
to top
>gb|AC008197.3|AC008197 Drosophila melanogaster, chromosome 3R, region 94B-94C, BAC clone
              BACR02L12, complete sequence
          Length = 178931

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    aaatgaacacacgcacgcac 183
              ||||||||||||||||||||
Sbjct: 107238 aaatgaacacacgcacgcac 107219
to top
>gb|AC009846.9|AC009846 Drosophila melanogaster, chromosome 3R, region 94C-94D, BAC clone
             BACR23F10, complete sequence
          Length = 164038

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   aaatgaacacacgcacgcac 183
             ||||||||||||||||||||
Sbjct: 29301 aaatgaacacacgcacgcac 29282
to top
>gb|AC093822.2| Homo sapiens BAC clone RP11-382L24 from 2, complete sequence
          Length = 32289

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     tgcaaattacatttcatcaa 28
             ||||||||||||||||||||
Sbjct: 12396 tgcaaattacatttcatcaa 12415
to top
>gb|AC091492.2| Homo sapiens chromosome 3 clone RP11-335I9 map 3p, complete sequence
          Length = 180963

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 247   aaagaagataacaacataca 266
             ||||||||||||||||||||
Sbjct: 70981 aaagaagataacaacataca 70962
to top
>dbj|AP005864.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBa0047P18
          Length = 169128

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 105   gtacgtagtacacagccaaa 124
             ||||||||||||||||||||
Sbjct: 72307 gtacgtagtacacagccaaa 72326
to top
>ref|NM_212328.2| Eremothecium gossypii AFR644Cp (AFR644C), mRNA
          Length = 2349

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 19  atttcatcaaacaaatacaa 38
           ||||||||||||||||||||
Sbjct: 245 atttcatcaaacaaatacaa 226
to top
>gb|AC118007.11| Mus musculus chromosome 9, clone RP23-377N5, complete sequence
          Length = 203921

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 264   acatgcatggacgcatgcac 283
             ||||||||||||||||||||
Sbjct: 91933 acatgcatggacgcatgcac 91952
to top
>gb|AE003740.3| Drosophila melanogaster chromosome 3R, section 78 of 118 of the
             complete sequence
          Length = 234378

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   aaatgaacacacgcacgcac 183
             ||||||||||||||||||||
Sbjct: 15952 aaatgaacacacgcacgcac 15933
to top
>gb|AC147744.17| Mus musculus chromosome 18, clone RP23-398N23, complete sequence
          Length = 201455

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 159    catataaatgaacacacgca 178
              ||||||||||||||||||||
Sbjct: 150841 catataaatgaacacacgca 150860
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 285      ggcgatgcatgcatgcatgc 304
                ||||||||||||||||||||
Sbjct: 14578817 ggcgatgcatgcatgcatgc 14578798
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 289      atgcatgcatgcatgccttg 308
                ||||||||||||||||||||
Sbjct: 21786461 atgcatgcatgcatgccttg 21786480
to top
>emb|AL732647.4|CNS08C9M Oryza sativa chromosome 12, . BAC OSJNBb0087J18 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 121592

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 289   atgcatgcatgcatgccttg 308
             ||||||||||||||||||||
Sbjct: 65216 atgcatgcatgcatgccttg 65197
to top
>emb|AL731670.13| Mouse DNA sequence from clone RP23-463E7 on chromosome 11, complete
              sequence
          Length = 198411

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                          
Query: 55     atcaaattactgtt-gaagcacacacac 81
              |||||||||||||| |||||||||||||
Sbjct: 107962 atcaaattactgtttgaagcacacacac 107989
to top
>emb|AL805952.11| Mouse DNA sequence from clone RP23-125H10 on chromosome 4, complete
              sequence
          Length = 199540

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 168    gaacacacgcacgcacgaacgaaa 191
              ||||||||||||||||| ||||||
Sbjct: 192370 gaacacacgcacgcacgcacgaaa 192393


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,190,457
Number of Sequences: 3902068
Number of extensions: 4190457
Number of successful extensions: 122263
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 121834
Number of HSP's gapped (non-prelim): 428
length of query: 368
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 346
effective length of database: 17,147,199,772
effective search space: 5932931121112
effective search space used: 5932931121112
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top