Clone Name | rbart60d11 |
---|---|
Clone Library Name | barley_pub |
>emb|AL117340.3|HSBA192P3 Human DNA sequence from clone RP11-192P3 on chromosome 10 Contains a novel gene, the 5' end of the TCF8 gene for transcription factor 8 (represses interleukin 2 expression) (BZP,ZEB,ZEB1,AREB6,ZFHEP,NIL-2A,ZFHX1A,NIL-2-A), a pseudogene similar to part of serine palmitoyltransferase, long chain base subunit 1 (SPTLC1) (HSAN, HSN1, LBC1, LCB1, SPT1, SPTI) and two CpG islands, complete sequence Length = 187517 Score = 44.1 bits (22), Expect = 0.29 Identities = 22/22 (100%) Strand = Plus / Minus Query: 186 cacacacagtttaccctgaatt 207 |||||||||||||||||||||| Sbjct: 184855 cacacacagtttaccctgaatt 184834
>gb|AF225898.1|AF225898 Homo sapiens BAC clone 13d21, complete sequence Length = 198084 Score = 44.1 bits (22), Expect = 0.29 Identities = 22/22 (100%) Strand = Plus / Minus Query: 186 cacacacagtttaccctgaatt 207 |||||||||||||||||||||| Sbjct: 67269 cacacacagtttaccctgaatt 67248
>gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome Length = 3544738 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 300 gcatggatgatcagaagagat 320 ||||||||||||||||||||| Sbjct: 1664674 gcatggatgatcagaagagat 1664654
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 ttctcaatctctcatggcgat 296 ||||||||||||||||||||| Sbjct: 3810439 ttctcaatctctcatggcgat 3810419
>dbj|AP003215.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0089K24 Length = 154137 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 ttctcaatctctcatggcgat 296 ||||||||||||||||||||| Sbjct: 83981 ttctcaatctctcatggcgat 83961
>gb|AC168309.2| Mus musculus chromosome 1, clone wi1-2866I16, complete sequence Length = 40737 Score = 40.1 bits (20), Expect = 4.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 251 gatgacacgatgacacttgcttgatttc 278 ||||||| ||||||| |||||||||||| Sbjct: 2691 gatgacatgatgacaattgcttgatttc 2664
>gb|AC145376.3| Pan troglodytes BAC clone RP43-59A12 from 7, complete sequence Length = 221727 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 251 gatgacacgatgacacttgc 270 |||||||||||||||||||| Sbjct: 108005 gatgacacgatgacacttgc 107986
>gb|AC102374.7| Mus musculus chromosome 1, clone RP23-278G2, complete sequence Length = 170448 Score = 40.1 bits (20), Expect = 4.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 251 gatgacacgatgacacttgcttgatttc 278 ||||||| ||||||| |||||||||||| Sbjct: 25899 gatgacatgatgacaattgcttgatttc 25926
>ref|XM_386515.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG06339.1) partial mRNA Length = 1497 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 gcatggatgatcagaagaga 319 |||||||||||||||||||| Sbjct: 773 gcatggatgatcagaagaga 792
>emb|AL355472.19| Human DNA sequence from clone RP5-827C21 on chromosome 1 Contains a ribosomal protein S15 (RPS15) pseudogene, three novel genes (LOC388753), the 3' end of the TARBP1 gene for TAR (HIV) RNA binding protein 1 and a CpG island, complete sequence Length = 92628 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 162 acaagagattattcctgactgact 185 ||||||| |||||||||||||||| Sbjct: 68131 acaagagcttattcctgactgact 68108
>gb|AC090498.4| Homo sapiens chromosome 7 clone RP11-84E17, complete sequence Length = 188036 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 251 gatgacacgatgacacttgc 270 |||||||||||||||||||| Sbjct: 67930 gatgacacgatgacacttgc 67911
>gb|AC083905.20| Homo sapiens 3 BAC RP11-124N24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 109471 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 248 actgatgacacgatgacact 267 |||||||||||||||||||| Sbjct: 67496 actgatgacacgatgacact 67515
>emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii Length = 2037969 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 302 atggatgatcagaagagatt 321 |||||||||||||||||||| Sbjct: 1044394 atggatgatcagaagagatt 1044413
>emb|AL954726.31| Zebrafish DNA sequence from clone CH211-274A9 in linkage group 23, complete sequence Length = 164507 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 99 tttgtacaaacattaatctt 118 |||||||||||||||||||| Sbjct: 115044 tttgtacaaacattaatctt 115063
>gb|AC160030.4| Mus musculus 10 BAC RP24-311K18 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 162351 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 attgctaggacagacagcag 97 |||||||||||||||||||| Sbjct: 21479 attgctaggacagacagcag 21460
>gb|AC009999.2|T20M3 Sequence of BAC T20M3 from Arabidopsis thaliana chromosome 1, complete sequence Length = 79554 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 102 gtacaaacattaatcttgac 121 |||||||||||||||||||| Sbjct: 5058 gtacaaacattaatcttgac 5039
>emb|BX936412.46| Zebrafish DNA sequence from clone DKEY-235H13, complete sequence Length = 178114 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 7 tgcttgtcataaatatgatg 26 |||||||||||||||||||| Sbjct: 136119 tgcttgtcataaatatgatg 136100 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,411,450 Number of Sequences: 3902068 Number of extensions: 3411450 Number of successful extensions: 57634 Number of sequences better than 10.0: 17 Number of HSP's better than 10.0 without gapping: 17 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 57572 Number of HSP's gapped (non-prelim): 62 length of query: 338 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 316 effective length of database: 17,147,199,772 effective search space: 5418515127952 effective search space used: 5418515127952 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)