ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart60d05 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF542967.1| Triticum aestivum annexin P35-like mRNA, partial sequence Length = 766 Score = 254 bits (128), Expect = 2e-64 Identities = 168/180 (93%), Gaps = 1/180 (0%) Strand = Plus / Minus Query: 249 tccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcg 308 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 642 tccagcgggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcg 583 Query: 309 gcacgagtggttatcaccctagt-aagggtgtgctcgtctgtaccgacaccaccaagagc 367 || ||||||||||| ||||| || |||||||| ||||||||| ||||| || ||||| || Sbjct: 582 gcgcgagtggttatgaccctcgtaaagggtgttctcgtctgtgccgacgcctccaagggc 523 Query: 368 caaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccct 427 ||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 522 caaccggatgatcttctcaaagtatctgtcagggcaagtgaaacaccttatgatcgccct 463
>ref|XM_467846.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1223 Score = 165 bits (83), Expect = 1e-37 Identities = 206/247 (83%) Strand = Plus / Minus Query: 181 actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 240 |||||||||| || || ||||| | ||||| || |||||||||||||| || || | || Sbjct: 1058 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 999 Query: 241 cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 300 |||| ||||| ||||| ||||| ||||||||||| ||||||||||||| |||||||| Sbjct: 998 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 939 Query: 301 ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 360 | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || | || | Sbjct: 938 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 879 Query: 361 caagagccaaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatga 420 | |||||||| || ||||| ||||||||||||||||| ||||||||||| || ||||||| Sbjct: 878 ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 819 Query: 421 tcgccct 427 ||||||| Sbjct: 818 tcgccct 812
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 165 bits (83), Expect = 1e-37 Identities = 206/247 (83%) Strand = Plus / Plus Query: 181 actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 240 |||||||||| || || ||||| | ||||| || |||||||||||||| || || | || Sbjct: 31716862 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 31716921 Query: 241 cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 300 |||| ||||| ||||| ||||| ||||||||||| ||||||||||||| |||||||| Sbjct: 31716922 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 31716981 Query: 301 ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 360 | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || | || | Sbjct: 31716982 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 31717041 Query: 361 caagagccaaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatga 420 | |||||||| || ||||| ||||||||||||||||| ||||||||||| || ||||||| Sbjct: 31717042 ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 31717101 Query: 421 tcgccct 427 ||||||| Sbjct: 31717102 tcgccct 31717108
>dbj|AP005012.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0627E03 Length = 159861 Score = 165 bits (83), Expect = 1e-37 Identities = 206/247 (83%) Strand = Plus / Plus Query: 181 actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 240 |||||||||| || || ||||| | ||||| || |||||||||||||| || || | || Sbjct: 12660 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 12719 Query: 241 cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 300 |||| ||||| ||||| ||||| ||||||||||| ||||||||||||| |||||||| Sbjct: 12720 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 12779 Query: 301 ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 360 | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || | || | Sbjct: 12780 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 12839 Query: 361 caagagccaaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatga 420 | |||||||| || ||||| ||||||||||||||||| ||||||||||| || ||||||| Sbjct: 12840 ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 12899 Query: 421 tcgccct 427 ||||||| Sbjct: 12900 tcgccct 12906
>dbj|AP004119.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1288_G09 Length = 109672 Score = 165 bits (83), Expect = 1e-37 Identities = 206/247 (83%) Strand = Plus / Plus Query: 181 actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 240 |||||||||| || || ||||| | ||||| || |||||||||||||| || || | || Sbjct: 96649 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 96708 Query: 241 cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 300 |||| ||||| ||||| ||||| ||||||||||| ||||||||||||| |||||||| Sbjct: 96709 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 96768 Query: 301 ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 360 | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || | || | Sbjct: 96769 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 96828 Query: 361 caagagccaaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatga 420 | |||||||| || ||||| ||||||||||||||||| ||||||||||| || ||||||| Sbjct: 96829 ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 96888 Query: 421 tcgccct 427 ||||||| Sbjct: 96889 tcgccct 96895
>dbj|AK101787.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033065F07, full insert sequence Length = 1223 Score = 165 bits (83), Expect = 1e-37 Identities = 206/247 (83%) Strand = Plus / Minus Query: 181 actctgctcccagaagtgcaagcatcatatcttcatagtctctggttgtgtccttggaaa 240 |||||||||| || || ||||| | ||||| || |||||||||||||| || || | || Sbjct: 1058 actctgctccaaggagggcaaggagtatatcctcgtagtctctggttgtatctttagcaa 999 Query: 241 cagccttctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggt 300 |||| ||||| ||||| ||||| ||||||||||| ||||||||||||| |||||||| Sbjct: 998 cagctcgctccaatgggacactgtttctcttctggtaggcctcctttatcagcttcaggt 939 Query: 301 ccacctcggcacgagtggttatcaccctagtaagggtgtgctcgtctgtaccgacaccac 360 | |||||||||||||| ||||| | ||| ||||| | || ||||||||| || | || | Sbjct: 938 ctacctcggcacgagttgttatgatccttgtaagagagttctcgtctgtgcccattcctc 879 Query: 361 caagagccaaccggatgaccttctcaaagtatctgtcggggcaagtgaaacaccttatga 420 | |||||||| || ||||| ||||||||||||||||| ||||||||||| || ||||||| Sbjct: 878 ctagagccaatcgaatgactttctcaaagtatctgtcagggcaagtgaagcatcttatga 819 Query: 421 tcgccct 427 ||||||| Sbjct: 818 tcgccct 812
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 107 bits (54), Expect = 3e-20 Identities = 90/102 (88%) Strand = Plus / Minus Query: 248 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 307 |||||| ||||| |||||||||||||||||||||||| | |||| |||||| |||||||| Sbjct: 6264228 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 6264169 Query: 308 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 349 |||||||||||| || | |||||| |||| || ||||||||| Sbjct: 6264168 ggcacgagtggtaatgatcctagtgagggagttctcgtctgt 6264127
>dbj|AP004727.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0516A04 Length = 145107 Score = 107 bits (54), Expect = 3e-20 Identities = 90/102 (88%) Strand = Plus / Minus Query: 248 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 307 |||||| ||||| |||||||||||||||||||||||| | |||| |||||| |||||||| Sbjct: 58304 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 58245 Query: 308 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 349 |||||||||||| || | |||||| |||| || ||||||||| Sbjct: 58244 ggcacgagtggtaatgatcctagtgagggagttctcgtctgt 58203
>dbj|AK072559.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132A10, full insert sequence Length = 1274 Score = 107 bits (54), Expect = 3e-20 Identities = 90/102 (88%) Strand = Plus / Minus Query: 248 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 307 |||||| ||||| |||||||||||||||||||||||| | |||| |||||| |||||||| Sbjct: 977 ctccagcgggacactgttcctcttctggtacgcctccgtgatcagcttcagatccacctc 918 Query: 308 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 349 |||||||||||| || | |||||| |||| || ||||||||| Sbjct: 917 ggcacgagtggtaatgatcctagtgagggagttctcgtctgt 876
>emb|X98245.1|ZMANNP35 Z.mays mRNA for annexin p35 Length = 1257 Score = 89.7 bits (45), Expect = 7e-15 Identities = 183/229 (79%) Strand = Plus / Minus Query: 198 gcaagcatcatatcttcatagtctctggttgtgtccttggaaacagccttctccaggggg 257 |||||||| ||||| ||||| ||||| ||||| || |||| ||||| |||||| || Sbjct: 1057 gcaagcataatatcctcataatctctagttgtatctttggccacagcacgctccagcggc 998 Query: 258 acgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacgagtg 317 || ||||| |||||||| || ||||||||||||| ||||||||| |||||||| ||||| Sbjct: 997 acactgtttctcttctgataagcctcctttatcagcttcaggtcgacctcggcgcgagta 938 Query: 318 gttatcaccctagtaagggtgtgctcgtctgtaccgacaccaccaagagccaaccggatg 377 |||| ||||| || ||| | ||| || || || | || |||||||||| || ||| Sbjct: 937 gttacgaccctggtgaggtcatcctcatcagtgcccatgcctccaagagccagtcgaatg 878 Query: 378 accttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccc 426 || ||||| ||||||||||| ||||| ||||| |||| |||||||||| Sbjct: 877 actttctcgaagtatctgtcagggcaggtgaagcaccggatgatcgccc 829
>gb|AY105105.1| Zea mays PCO122403 mRNA sequence Length = 1401 Score = 89.7 bits (45), Expect = 7e-15 Identities = 183/229 (79%) Strand = Plus / Minus Query: 198 gcaagcatcatatcttcatagtctctggttgtgtccttggaaacagccttctccaggggg 257 |||||||| ||||| ||||| ||||| ||||| || |||| ||||| |||||| || Sbjct: 1151 gcaagcataatatcctcataatctctagttgtatctttggccacagcacgctccagcggc 1092 Query: 258 acgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctcggcacgagtg 317 || ||||| |||||||| || ||||||||||||| ||||||||| |||||||| ||||| Sbjct: 1091 acactgtttctcttctgataagcctcctttatcagcttcaggtcgacctcggcgcgagta 1032 Query: 318 gttatcaccctagtaagggtgtgctcgtctgtaccgacaccaccaagagccaaccggatg 377 |||| ||||| || ||| | ||| || || || | || |||||||||| || ||| Sbjct: 1031 gttacgaccctggtgaggtcatcctcatcagtgcccatgcctccaagagccagtcgaatg 972 Query: 378 accttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccc 426 || ||||| ||||||||||| ||||| ||||| |||| |||||||||| Sbjct: 971 actttctcgaagtatctgtcagggcaggtgaagcaccggatgatcgccc 923
>emb|X98244.2|ZMANNP33 Z.mays mRNA for annexin p33 Length = 1277 Score = 75.8 bits (38), Expect = 1e-10 Identities = 86/102 (84%) Strand = Plus / Minus Query: 248 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 307 |||||| || ||||||||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 960 ctccagcggcacgctgttcctcttctggtacgcctccttaatcagtttgaggtccacctc 901 Query: 308 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 349 || || ||||| || ||||| || |||| || ||| ||||| Sbjct: 900 agcgcgggtggtgatgaccctggtcagggagttctcatctgt 859 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 accttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccc 426 |||||||||||||| ||||| |||||| |||| |||| |||||||||| Sbjct: 830 accttctcaaagtacctgtcagggcaactgaagcaccggatgatcgccc 782
>gb|AY105151.1| Zea mays PCO072293 mRNA sequence Length = 1369 Score = 75.8 bits (38), Expect = 1e-10 Identities = 86/102 (84%) Strand = Plus / Minus Query: 248 ctccagggggacgctgttcctcttctggtacgcctcctttatcaccttcaggtccacctc 307 |||||| || ||||||||||||||||||||||||||||| |||| || ||||||||||| Sbjct: 977 ctccagcggcacgctgttcctcttctggtacgcctccttaatcagtttgaggtccacctc 918 Query: 308 ggcacgagtggttatcaccctagtaagggtgtgctcgtctgt 349 || || ||||| || ||||| || |||| || ||| ||||| Sbjct: 917 agcgcgggtggtgatgaccctggtcagggagttctcatctgt 876 Score = 50.1 bits (25), Expect = 0.006 Identities = 43/49 (87%) Strand = Plus / Minus Query: 378 accttctcaaagtatctgtcggggcaagtgaaacaccttatgatcgccc 426 |||||||||||||| ||||| |||||| |||| |||| |||||||||| Sbjct: 847 accttctcaaagtacctgtcagggcaactgaagcaccggatgatcgccc 799
>gb|AF373160.1| Rana macrocnemis macrocnemis haplotype M5 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373159.1| Rana macrocnemis camerani haplotype M4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373158.1| Rana macrocnemis macrocnemis haplotype M3 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373157.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373156.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373155.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373154.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373153.1| Rana macrocnemis macrocnemis haplotype M2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373152.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373151.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373150.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373149.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373148.1| Rana macrocnemis camerani haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373147.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373146.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373145.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373144.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373143.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373142.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373141.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373140.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373139.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373138.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373137.1| Rana macrocnemis macrocnemis haplotype M1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373136.1| Rana macrocnemis camerani haplotype C6 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373135.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373134.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373133.1| Rana macrocnemis camerani haplotype C5 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373132.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373131.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373130.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373129.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373128.1| Rana macrocnemis camerani haplotype C4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373127.1| Rana macrocnemis macrocnemis haplotype C4 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373126.1| Rana macrocnemis macrocnemis haplotype C3 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373125.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373124.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373123.1| Rana macrocnemis macrocnemis haplotype C2 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373122.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373121.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373120.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373119.1| Rana macrocnemis camerani haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373118.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373117.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373116.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373115.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AF373114.1| Rana macrocnemis macrocnemis haplotype C1 cytochrome b gene, partial cds; mitochondrial gene for mitochondrial product Length = 504 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 440 atctcttattcctccatcaaaca 462
>gb|AY147969.1| Rana macrocnemis pseudodalmatina cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 465 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 378 atctcttattcctccatcaaaca 400
>gb|AY147968.1| Rana macrocnemis macrocnemis cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 465 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 378 atctcttattcctccatcaaaca 400
>gb|AY147964.1| Rana holtzi cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 465 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 378 atctcttattcctccatcaaaca 400
>gb|AY147960.1| Rana macrocnemis cytochrome b (cytb) gene, partial cds; mitochondrial gene for mitochondrial product Length = 465 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaaca 152 ||||||||||||||||||||||| Sbjct: 378 atctcttattcctccatcaaaca 400
>gb|AF021076.1| Megarthrus americanus cytochrome b (cytb) gene, mitochondrial gene encoding mitochondrial protein, partial cds Length = 465 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 130 atctcttattcctccatcaaac 151 |||||||||||||||||||||| Sbjct: 185 atctcttattcctccatcaaac 206
>gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, complete sequence Length = 191054 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 253 gggggacgctgttcctcttct 273 ||||||||||||||||||||| Sbjct: 157842 gggggacgctgttcctcttct 157822
>gb|DQ106808.1| Ephippiger provincialis clone Eprov7 cytochrome b (Cytb) gene, partial cds; mitochondrial Length = 427 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 132 ctcttattcctccatcaaaca 152 ||||||||||||||||||||| Sbjct: 144 ctcttattcctccatcaaaca 164
>gb|AC104833.6| Mus Musculus Strain C57BL6/J Chromosome 15 BAC, RP23-319B16, Complete Sequence, complete sequence Length = 171061 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 253 gggggacgctgttcctcttct 273 ||||||||||||||||||||| Sbjct: 36422 gggggacgctgttcctcttct 36402
>dbj|AK082224.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230026C11 product:hypothetical Beta tubulin containing protein, full insert sequence Length = 1819 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 253 gggggacgctgttcctcttct 273 ||||||||||||||||||||| Sbjct: 1159 gggggacgctgttcctcttct 1139
>dbj|AB201221.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial cds, specimen_voucher:KUHE34324 Length = 629 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 132 ctcttattcctccatcaaaca 152 ||||||||||||||||||||| Sbjct: 456 ctcttattcctccatcaaaca 476
>dbj|AB201218.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial cds, specimen_voucher:KUHE34130 Length = 625 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 132 ctcttattcctccatcaaaca 152 ||||||||||||||||||||| Sbjct: 452 ctcttattcctccatcaaaca 472
>dbj|AB201216.1| Microhyla ornata mitochondrial cytb gene for cytochrome b, partial cds, specimen_voucher:KUHE21982 Length = 629 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 132 ctcttattcctccatcaaaca 152 ||||||||||||||||||||| Sbjct: 456 ctcttattcctccatcaaaca 476
>emb|AL136039.4|CNS01DVU Human chromosome 14 DNA sequence BAC R-799P8 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 174788 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 146 tcaaacataaggtagatcaaacata 170 |||||||| |||||||||||||||| Sbjct: 56048 tcaaacattaggtagatcaaacata 56024
>gb|AC134914.5| Mus musculus BAC clone RP23-227C5 from 9, complete sequence Length = 206831 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tatttctgcagcttaaatgacgaaa 39 ||||| ||||||||||||||||||| Sbjct: 165234 tatttatgcagcttaaatgacgaaa 165210
>ref|XM_775596.1| PREDICTED: Strongylocentrotus purpuratus similar to tudor domain containing 1 (LOC575181), mRNA Length = 7881 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 286 ttatcaccttcaggtccacc 305 |||||||||||||||||||| Sbjct: 5800 ttatcaccttcaggtccacc 5781
>emb|AJ298865.1|XLA298865 Xenopus laevis mRNA for winged helix transcription factor (foxd3a gene) Length = 3240 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 97 aaacaacacactcgccagttttat 120 |||||||||||||||| ||||||| Sbjct: 478 aaacaacacactcgcctgttttat 455
>gb|AC011415.3| Homo sapiens chromosome 5 clone CTB-87P21, complete sequence Length = 116976 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 tctgctcccagaagtgcaag 202 |||||||||||||||||||| Sbjct: 94606 tctgctcccagaagtgcaag 94587
>gb|AC149341.2| Phakopsora pachyrhizi clone JGIAFNA-25D19, complete sequence Length = 38997 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 131 tctcttattcctccatcaaa 150 |||||||||||||||||||| Sbjct: 21072 tctcttattcctccatcaaa 21091 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,704,058 Number of Sequences: 3902068 Number of extensions: 3704058 Number of successful extensions: 92888 Number of sequences better than 10.0: 78 Number of HSP's better than 10.0 without gapping: 78 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 92768 Number of HSP's gapped (non-prelim): 119 length of query: 427 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 405 effective length of database: 17,147,199,772 effective search space: 6944615907660 effective search space used: 6944615907660 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
