>gb|AC164701.4| Mus musculus BAC clone RP24-108J12 from chromosome 17, complete sequence
          Length = 184296

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 119    aagaacttgctagcctctctg 139
              |||||||||||||||||||||
Sbjct: 111832 aagaacttgctagcctctctg 111852

>gb|AC121945.2| Mus musculus BAC clone RP24-211I4 from 17, complete sequence
          Length = 157262

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 119   aagaacttgctagcctctctg 139
             |||||||||||||||||||||
Sbjct: 43024 aagaacttgctagcctctctg 43044

>gb|AC073608.19| Homo sapiens 12 BAC RP11-36P3 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 111182

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 39   ggggcctgaattttctaacca 59
            |||||||||||||||||||||
Sbjct: 9915 ggggcctgaattttctaacca 9935


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,182,625
Number of Sequences: 3902068
Number of extensions: 1182625
Number of successful extensions: 75107
Number of sequences better than 10.0: 3
Number of HSP's better than 10.0 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75100
Number of HSP's gapped (non-prelim): 7
length of query: 206
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 184
effective length of database: 17,147,199,772
effective search space: 3155084758048
effective search space used: 3155084758048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)