Clone Name | rbart60c04 |
---|---|
Clone Library Name | barley_pub |
>emb|X69087.1|HVCGSA H.vulgare mRNA for cytoplasmic glutamine synthetase Length = 1456 Score = 355 bits (179), Expect = 6e-95 Identities = 192/197 (97%) Strand = Plus / Minus Query: 166 gagatgaccatgatgatgtgacctacctaagcggactaggagtagtatgcaaccaaacgt 225 |||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||| Sbjct: 1288 gagatgaccatgatgatgtgacctacctaagcggactaggagtagtatncanccacacgt 1229 Query: 226 aaaaggaaaatgctggaagaattttcgcccaaggcacgaatcctccaatggccaccaccg 285 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1228 aaaaggaaaatgctggaagaattttcgcccaaggcacgaatcctccaatggccaccaccg 1169 Query: 286 gaccccatcaccgacggtccatcacacggcgaccggagcttcagggcttccacaggatgg 345 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 1168 gaccccatcaccgacggtccatcacacggcgatcggagcttcagggcttccacaggatgg 1109 Query: 346 tggtctcggcgatcatg 362 |||||| |||||||||| Sbjct: 1108 tggtctgggcgatcatg 1092 Score = 113 bits (57), Expect = 4e-22 Identities = 62/64 (96%) Strand = Plus / Minus Query: 106 tgctttgacacgccccttgccacccatcacccaccacccacccaaagacgagaacgagaa 165 |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| Sbjct: 1368 tgctttgacacgccccttgccacccatcacccaccacccacccanagacgagagcgagaa 1309 Query: 166 gaga 169 |||| Sbjct: 1308 gaga 1305 Score = 105 bits (53), Expect = 1e-19 Identities = 64/68 (94%) Strand = Plus / Minus Query: 39 gattacacgagaccatagcatccagacggcaagggaaaacaatcaaccaaatactgtagt 98 ||||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||| Sbjct: 1454 gattacacgagaccatagcatccagacggcaagggttaacaatcacccanatactgtagt 1395 Query: 99 aatcttgt 106 |||||||| Sbjct: 1394 aatcttgt 1387
>gb|DQ124210.1| Triticum aestivum glutamine synthetase isoform GS1b (GS1) mRNA, complete cds Length = 1496 Score = 113 bits (57), Expect = 4e-22 Identities = 81/89 (91%), Gaps = 5/89 (5%) Strand = Plus / Minus Query: 1 gctgcggtacggaccattttattaccatatcaatcgatgattacacgagac-----cata 55 |||||||||||||||||||||||||||||||||| |||||||||||||||| || | Sbjct: 1471 gctgcggtacggaccattttattaccatatcaattgatgattacacgagacgagaccaga 1412 Query: 56 gcatccagacggcaagggaaaacaatcaa 84 ||| ||||||||||||||||||||||||| Sbjct: 1411 gcacccagacggcaagggaaaacaatcaa 1383 Score = 83.8 bits (42), Expect = 4e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 177 gatgatgtgacctacctaagcggactaggagtagtatgcaaccaaacgtaaaaggaaa 234 ||||||||||||||||||| ||||||| | |||||||||||||||||| ||||||||| Sbjct: 1296 gatgatgtgacctacctaaacggactacgcgtagtatgcaaccaaacggaaaaggaaa 1239 Score = 77.8 bits (39), Expect = 2e-11 Identities = 39/39 (100%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcat 361 ||||||||||||||||||||||||||||||||||||||| Sbjct: 1149 gcttcagggcttccacaggatggtggtctcggcgatcat 1111 Score = 44.1 bits (22), Expect = 0.31 Identities = 28/30 (93%) Strand = Plus / Minus Query: 109 tttgacacgccccttgccacccatcaccca 138 ||||||||||| ||||||||||| |||||| Sbjct: 1367 tttgacacgcctcttgccacccaccaccca 1338
>gb|DQ124209.1| Triticum aestivum glutamine synthetase isoform GS1a (GS1) mRNA, complete cds Length = 1292 Score = 83.8 bits (42), Expect = 4e-13 Identities = 67/74 (90%), Gaps = 1/74 (1%) Strand = Plus / Minus Query: 177 gatgatgtgacctacctaagcggactaggagtagtatgcaaccaaacgtaaaaggaaa-a 235 ||||||| ||||||||||||||||||| | |||||||||||||||||| ||||| ||| | Sbjct: 1290 gatgatgcgacctacctaagcggactacgcgtagtatgcaaccaaacggaaaagcaaata 1231 Query: 236 tgctggaagaattt 249 || ||||||||||| Sbjct: 1230 tgttggaagaattt 1217 Score = 77.8 bits (39), Expect = 2e-11 Identities = 39/39 (100%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcat 361 ||||||||||||||||||||||||||||||||||||||| Sbjct: 1137 gcttcagggcttccacaggatggtggtctcggcgatcat 1099
>gb|DQ124211.1| Triticum aestivum glutamine synthetase isoform GS1c (GS1) mRNA, complete cds Length = 1223 Score = 79.8 bits (40), Expect = 6e-12 Identities = 40/40 (100%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 |||||||||||||||||||||||||||||||||||||||| Sbjct: 1074 gcttcagggcttccacaggatggtggtctcggcgatcatg 1035 Score = 75.8 bits (38), Expect = 9e-11 Identities = 53/58 (91%) Strand = Plus / Minus Query: 177 gatgatgtgacctacctaagcggactaggagtagtatgcaaccaaacgtaaaaggaaa 234 ||||||||||||||||||| ||||||| | |||||||||||||||||| ||| ||||| Sbjct: 1221 gatgatgtgacctacctaaacggactacgcgtagtatgcaaccaaacggaaacggaaa 1164
>ref|XM_467663.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1276 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||| | |||||||||||||||||||||| Sbjct: 1165 gcttcagggcttccagatgatggtggtctcggcgatcatg 1126
>ref|XM_507528.1| PREDICTED Oryza sativa (japonica cultivar-group), P0487D09.8 mRNA Length = 1427 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||| | |||||||||||||||||||||| Sbjct: 1316 gcttcagggcttccagatgatggtggtctcggcgatcatg 1277
>ref|XM_506959.2| PREDICTED Oryza sativa (japonica cultivar-group), P0487D09.8 mRNA Length = 1545 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||| | |||||||||||||||||||||| Sbjct: 1137 gcttcagggcttccagatgatggtggtctcggcgatcatg 1098
>emb|X14245.1|OSSIGS28 Oryza sativa shoot GS1 mRNA for cytosolic glutamine synthetase (EC 6.3.1.2) (clone lambda-GS28) Length = 1553 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||| | |||||||||||||||||||||| Sbjct: 1128 gcttcagggcttccagatgatggtggtctcggcgatcatg 1089
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||| | |||||||||||||||||||||| Sbjct: 30693698 gcttcagggcttccagatgatggtggtctcggcgatcatg 30693737
>dbj|AP004880.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0487D09 Length = 161531 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||| | |||||||||||||||||||||| Sbjct: 33845 gcttcagggcttccagatgatggtggtctcggcgatcatg 33884
>dbj|AB037664.2| Oryza sativa (japonica cultivar-group) OsGS1;1 gene for cytosolic glutamine synthetase 1;1, complete cds Length = 6652 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||| | |||||||||||||||||||||| Sbjct: 5746 gcttcagggcttccagatgatggtggtctcggcgatcatg 5707
>dbj|AB037595.1| Oryza sativa (japonica cultivar-group) OsGS1;1 mRNA for cytosolic glutamine synthethase 1;1, complete cds Length = 1275 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||| | |||||||||||||||||||||| Sbjct: 1083 gcttcagggcttccagatgatggtggtctcggcgatcatg 1044
>dbj|AK109397.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H07, full insert sequence Length = 1556 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||| | |||||||||||||||||||||| Sbjct: 1131 gcttcagggcttccagatgatggtggtctcggcgatcatg 1092
>dbj|AK104987.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-001-A03, full insert sequence Length = 1538 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||| | |||||||||||||||||||||| Sbjct: 1131 gcttcagggcttccagatgatggtggtctcggcgatcatg 1092
>dbj|AK071969.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013083D11, full insert sequence Length = 1427 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||| | |||||||||||||||||||||| Sbjct: 1316 gcttcagggcttccagatgatggtggtctcggcgatcatg 1277
>dbj|AK061157.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-G06, full insert sequence Length = 1276 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 323 gcttcagggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||| | |||||||||||||||||||||| Sbjct: 1165 gcttcagggcttccagatgatggtggtctcggcgatcatg 1126
>gb|AY835454.1| Saccharum officinarum glutamine synthetase (GS1.b) mRNA, complete cds Length = 1422 Score = 61.9 bits (31), Expect = 1e-06 Identities = 31/31 (100%) Strand = Plus / Minus Query: 332 cttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||||||||||||||||||| Sbjct: 1131 cttccacaggatggtggtctcggcgatcatg 1101
>gb|AY339214.1| Zea mays glufosinate-resistant glutamine synthetase gene, partial cds Length = 1019 Score = 61.9 bits (31), Expect = 1e-06 Identities = 31/31 (100%) Strand = Plus / Minus Query: 332 cttccacaggatggtggtctcggcgatcatg 362 ||||||||||||||||||||||||||||||| Sbjct: 1013 cttccacaggatggtggtctcggcgatcatg 983
>emb|X65926.1|ZMGS11 Z.mays mRNA gs1-1 for glutamine synthetase Length = 1359 Score = 60.0 bits (30), Expect = 5e-06 Identities = 30/30 (100%) Strand = Plus / Minus Query: 333 ttccacaggatggtggtctcggcgatcatg 362 |||||||||||||||||||||||||||||| Sbjct: 1073 ttccacaggatggtggtctcggcgatcatg 1044
>gb|AY109349.1| Zea mays CL1911_3 mRNA sequence Length = 1527 Score = 60.0 bits (30), Expect = 5e-06 Identities = 30/30 (100%) Strand = Plus / Minus Query: 333 ttccacaggatggtggtctcggcgatcatg 362 |||||||||||||||||||||||||||||| Sbjct: 1109 ttccacaggatggtggtctcggcgatcatg 1080
>dbj|D14579.1|MZEGS1D Zea mays mRNA for glutamine synthetase, complete cds Length = 1416 Score = 60.0 bits (30), Expect = 5e-06 Identities = 30/30 (100%) Strand = Plus / Minus Query: 333 ttccacaggatggtggtctcggcgatcatg 362 |||||||||||||||||||||||||||||| Sbjct: 1132 ttccacaggatggtggtctcggcgatcatg 1103
>gb|AY835453.1| Saccharum officinarum glutamine synthetase (GS1.a) mRNA, complete cds Length = 1596 Score = 58.0 bits (29), Expect = 2e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 326 tcagggcttccacaggatggtggtctcggcgatcatg 362 |||||||||||| ||||||||||| |||||||||||| Sbjct: 1153 tcagggcttccagaggatggtggtgtcggcgatcatg 1117
>emb|X65929.1|ZMGS14 Z.mays mRNA gs1-4 for glutamine synthetase Length = 1490 Score = 58.0 bits (29), Expect = 2e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 326 tcagggcttccacaggatggtggtctcggcgatcatg 362 |||||||||||| | |||||||||||||||||||||| Sbjct: 1152 tcagggcttccagacgatggtggtctcggcgatcatg 1116
>emb|X65928.1|ZMGS13 Z.mays mRNA gs1-3 for glutamine synthetase Length = 1317 Score = 58.0 bits (29), Expect = 2e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 326 tcagggcttccacaggatggtggtctcggcgatcatg 362 |||||||||||| | |||||||||||||||||||||| Sbjct: 1133 tcagggcttccagatgatggtggtctcggcgatcatg 1097
>emb|AJ318053.1|VVI318053 Vitis vinifera mRNA for glutamine synthetase (gs gene) Length = 1338 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 330 ggcttccacaggatggtggtctcggcgatcatg 362 |||||||| |||||||||||||||||||||||| Sbjct: 1093 ggcttccagaggatggtggtctcggcgatcatg 1061
>gb|AY103627.1| Zea mays PCO073484 mRNA sequence Length = 1571 Score = 58.0 bits (29), Expect = 2e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 326 tcagggcttccacaggatggtggtctcggcgatcatg 362 |||||||||||| | |||||||||||||||||||||| Sbjct: 1157 tcagggcttccagacgatggtggtctcggcgatcatg 1121
>dbj|D14577.1|MZEGS1B Zea mays mRNA for glutamine synthetase, complete cds Length = 1350 Score = 58.0 bits (29), Expect = 2e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 326 tcagggcttccacaggatggtggtctcggcgatcatg 362 |||||||||||| | |||||||||||||||||||||| Sbjct: 1098 tcagggcttccagatgatggtggtctcggcgatcatg 1062
>dbj|D14576.1|MZEGS1A Zea mays mRNA for glutamine synthetase, complete cds Length = 1422 Score = 58.0 bits (29), Expect = 2e-05 Identities = 35/37 (94%) Strand = Plus / Minus Query: 326 tcagggcttccacaggatggtggtctcggcgatcatg 362 |||||||||||| | |||||||||||||||||||||| Sbjct: 1145 tcagggcttccagacgatggtggtctcggcgatcatg 1109
>emb|X65930.1|ZMGS15 Z.mays mRNA gs1-5 for glutamine synthatase Length = 895 Score = 54.0 bits (27), Expect = 3e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 332 cttccacaggatggtggtctcggcgatcatg 362 |||||||||||||||||| |||||||||||| Sbjct: 729 cttccacaggatggtggtgtcggcgatcatg 699
>dbj|D14578.1|MZEGS1C Zea mays mRNA for glutamine synthetase, complete cds Length = 1433 Score = 54.0 bits (27), Expect = 3e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 332 cttccacaggatggtggtctcggcgatcatg 362 |||||||||||||||||| |||||||||||| Sbjct: 1160 cttccacaggatggtggtgtcggcgatcatg 1130
>ref|XM_469528.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1113 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 329 gggcttccacaggatggtggtctcggcgatcatg 362 ||||| ||| |||||||||||||||||||||||| Sbjct: 1074 gggctcccagaggatggtggtctcggcgatcatg 1041
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Plus Query: 329 gggcttccacaggatggtggtctcggcgatcatg 362 ||||| ||| |||||||||||||||||||||||| Sbjct: 28527796 gggctcccagaggatggtggtctcggcgatcatg 28527829 Score = 40.1 bits (20), Expect = 4.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 331 gcttccacaggatggtggtctcggcgatcatg 362 |||||||||| | |||||||||||||||||| Sbjct: 6426503 gcttccacagcagcgtggtctcggcgatcatg 6426534
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Plus Query: 329 gggcttccacaggatggtggtctcggcgatcatg 362 ||||| ||| |||||||||||||||||||||||| Sbjct: 28619120 gggctcccagaggatggtggtctcggcgatcatg 28619153 Score = 40.1 bits (20), Expect = 4.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 331 gcttccacaggatggtggtctcggcgatcatg 362 |||||||||| | |||||||||||||||||| Sbjct: 6425716 gcttccacagcagcgtggtctcggcgatcatg 6425747
>gb|AC082645.13|AC082645 Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete sequence Length = 143681 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Plus Query: 329 gggcttccacaggatggtggtctcggcgatcatg 362 ||||| ||| |||||||||||||||||||||||| Sbjct: 121926 gggctcccagaggatggtggtctcggcgatcatg 121959
>dbj|AB180689.1| Oryza sativa (japonica cultivar-group) OsGS1;3 mRNA for cytosolic glutamine synthetase 1;3, complete cds Length = 1543 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 329 gggcttccacaggatggtggtctcggcgatcatg 362 ||||| ||| |||||||||||||||||||||||| Sbjct: 1242 gggctcccagaggatggtggtctcggcgatcatg 1209
>dbj|AK099290.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023127P21, full insert sequence Length = 1457 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 329 gggcttccacaggatggtggtctcggcgatcatg 362 ||||| ||| |||||||||||||||||||||||| Sbjct: 1195 gggctcccagaggatggtggtctcggcgatcatg 1162
>dbj|AK063913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-A09, full insert sequence Length = 1494 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 329 gggcttccacaggatggtggtctcggcgatcatg 362 ||||| ||| |||||||||||||||||||||||| Sbjct: 1195 gggctcccagaggatggtggtctcggcgatcatg 1162
>emb|X94321.1|VVGS2 V.vinifera mRNA for cytosolic glutamine synthetase (clone pGS1;2) Length = 1305 Score = 50.1 bits (25), Expect = 0.005 Identities = 31/33 (93%) Strand = Plus / Minus Query: 330 ggcttccacaggatggtggtctcggcgatcatg 362 |||||||||||||||||| |||| ||||||||| Sbjct: 1090 ggcttccacaggatggtgctctccgcgatcatg 1058
>gb|AY491970.1| Triticum aestivum glutamine synthetase isoform GSe1 (GS) gene, complete cds Length = 1299 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Minus Query: 339 aggatggtggtctcggcgatcatg 362 |||||||||||||||||||||||| Sbjct: 1139 aggatggtggtctcggcgatcatg 1116
>gb|AC096777.1| Mus musculus clone RP23-106L19, complete sequence Length = 209671 Score = 46.1 bits (23), Expect = 0.078 Identities = 23/23 (100%) Strand = Plus / Minus Query: 125 ccacccatcacccaccacccacc 147 ||||||||||||||||||||||| Sbjct: 96144 ccacccatcacccaccacccacc 96122
>emb|BX255951.13| Zebrafish DNA sequence from clone DKEYP-31E5 in linkage group 5, complete sequence Length = 171425 Score = 46.1 bits (23), Expect = 0.078 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 gagaagagatgaccatgatgatg 183 ||||||||||||||||||||||| Sbjct: 151412 gagaagagatgaccatgatgatg 151434
>ref|NM_118686.2| Arabidopsis thaliana MSH3 AT4G25540 (MSH3) mRNA, complete cds Length = 3487 Score = 44.1 bits (22), Expect = 0.31 Identities = 25/26 (96%) Strand = Plus / Plus Query: 169 atgaccatgatgatgtgacctaccta 194 |||| ||||||||||||||||||||| Sbjct: 2986 atgatcatgatgatgtgacctaccta 3011
>gb|AC121481.6| Rattus norvegicus NOVECTOR CH230-218J9 (Children's Hospital Oakland Research Institute) complete sequence Length = 236244 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 126 cacccatcacccaccacccacc 147 |||||||||||||||||||||| Sbjct: 35906 cacccatcacccaccacccacc 35927
>gb|AC131786.3| Mus musculus BAC clone RP24-397H7 from chromosome 5, complete sequence Length = 176338 Score = 44.1 bits (22), Expect = 0.31 Identities = 25/26 (96%) Strand = Plus / Plus Query: 125 ccacccatcacccaccacccacccaa 150 ||||||| |||||||||||||||||| Sbjct: 162207 ccacccaccacccaccacccacccaa 162232
>gb|AY491971.1| Triticum aestivum glutamine synthetase isoform GSe2 (GS) gene, complete cds Length = 1278 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 339 aggatggtggtctcggcgatca 360 |||||||||||||||||||||| Sbjct: 1173 aggatggtggtctcggcgatca 1152
>emb|AJ007791.1|ATH7791 Arabidopsis thaliana mRNA for mismatch repair protein (Msh3) Length = 3521 Score = 44.1 bits (22), Expect = 0.31 Identities = 25/26 (96%) Strand = Plus / Plus Query: 169 atgaccatgatgatgtgacctaccta 194 |||| ||||||||||||||||||||| Sbjct: 2986 atgatcatgatgatgtgacctaccta 3011
>emb|AL161563.2|ATCHRIV63 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 63 Length = 198777 Score = 44.1 bits (22), Expect = 0.31 Identities = 25/26 (96%) Strand = Plus / Minus Query: 169 atgaccatgatgatgtgacctaccta 194 |||| ||||||||||||||||||||| Sbjct: 125460 atgatcatgatgatgtgacctaccta 125435
>emb|AL022197.2|ATM7J2 Arabidopsis thaliana DNA chromosome 4, P1 clone M7J2 (ESSA project) Length = 80386 Score = 44.1 bits (22), Expect = 0.31 Identities = 25/26 (96%) Strand = Plus / Plus Query: 169 atgaccatgatgatgtgacctaccta 194 |||| ||||||||||||||||||||| Sbjct: 29358 atgatcatgatgatgtgacctaccta 29383
>dbj|AK222004.1| Arabidopsis thaliana mRNA for putative DNA mismatch repair protein, partial cds, clone: RAFL22-65-J17 Length = 1307 Score = 44.1 bits (22), Expect = 0.31 Identities = 25/26 (96%) Strand = Plus / Plus Query: 169 atgaccatgatgatgtgacctaccta 194 |||| ||||||||||||||||||||| Sbjct: 803 atgatcatgatgatgtgacctaccta 828
>gb|AF081566.1|AF081566 Canavalia lineata cytosolic glutamine synthetase mRNA, complete cds Length = 1345 Score = 44.1 bits (22), Expect = 0.31 Identities = 34/38 (89%) Strand = Plus / Minus Query: 325 ttcagggcttccacaggatggtggtctcggcgatcatg 362 |||| |||||||| |||||||||||||| || |||||| Sbjct: 1151 ttcatggcttccagaggatggtggtctctgcaatcatg 1114
>gb|AC118685.10| Mus musculus chromosome 5, clone RP23-412L2, complete sequence Length = 200341 Score = 44.1 bits (22), Expect = 0.31 Identities = 25/26 (96%) Strand = Plus / Plus Query: 125 ccacccatcacccaccacccacccaa 150 ||||||| |||||||||||||||||| Sbjct: 26695 ccacccaccacccaccacccacccaa 26720
>gb|AC154050.1| Drosophila melanogaster clone BACR22M24, complete sequence Length = 161653 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 127 acccatcacccaccacccacc 147 ||||||||||||||||||||| Sbjct: 82833 acccatcacccaccacccacc 82853
>emb|CT010519.5| Mouse DNA sequence from clone RP23-305D10 on chromosome 14, complete sequence Length = 224463 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 125 ccacccatcacccaccacccaccca 149 ||||||| ||||||||||||||||| Sbjct: 128545 ccacccaccacccaccacccaccca 128569
>emb|Y08681.1|AGGLN1 A.glutinosa mRNA for glutamine synthetase Length = 1346 Score = 42.1 bits (21), Expect = 1.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 330 ggcttccacaggatggtggtctcggcgatcatg 362 ||||||||||||| |||||| || ||||||||| Sbjct: 1116 ggcttccacaggagggtggtttccgcgatcatg 1084
>emb|AL606460.3|OSJN00003 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072F16, complete sequence Length = 176383 Score = 42.1 bits (21), Expect = 1.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 211 tatgcaaccaaacgtaaaaggaaaatgctggaa 243 ||||||||||||||||| || |||||| ||||| Sbjct: 55014 tatgcaaccaaacgtaacagtaaaatgatggaa 54982
>emb|AL591126.18| Mouse DNA sequence from clone RP23-188A3 on chromosome 11 Contains a glyceraldehyde-3-phosphate dehydrogenase (Gapd) pseudogene, the 5' end of the Nf1 gene for neurofibromatosis 1 and a ribosomal protein L17 (Rpl17) pseudogene, complete sequence Length = 190048 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 125 ccacccatcacccaccacccaccca 149 ||||||||||||||||| ||||||| Sbjct: 169205 ccacccatcacccaccatccaccca 169181 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 125 ccacccatcacccaccacccaccca 149 ||||||||||||||||| ||||||| Sbjct: 169146 ccacccatcacccaccatccaccca 169122 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 125 ccacccatcacccaccacccaccca 149 ||||||||||||||||| ||||||| Sbjct: 169080 ccacccatcacccaccatccaccca 169056
>emb|AL807395.8| Mouse DNA sequence from clone RP23-81P12 on chromosome 11 Contains the 5' end of the Tcn2 gene for transcobalamin 2, two novel genes, a glyceraldehyde-3-phosphate dehydrogenase (Gapd) pseudogene, the Pes1 gene for BRCT domain containing pescadillo homolog 1 (zebrafish), the Gcst gene for galactosylceramide sulfotransferase, a ubiquitin-conjugating enzyme E2L 3 (Ube2l3) pseuogene, the Sec14l4 and Sec14l2 genes for SEC14-like 4 (S. cerevisiae) and 2, the ortholog of human and rat SEC14-like 3 (S. cerevisiae) SEC14L3, a ribosomal protein L29 (Rpl29) pseudogene, a transformer 2 alpha homolog (Drosophila) (Tra2a) pseudogene and a CpG island, complete sequence Length = 201238 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 125 ccacccatcacccaccacccaccca 149 ||||||||||||||||| ||||||| Sbjct: 139785 ccacccatcacccaccatccaccca 139761
>gb|AC151529.20| Medicago truncatula clone mth2-7n23, complete sequence Length = 134908 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 161 gagaagagatgaccatgatga 181 ||||||||||||||||||||| Sbjct: 30097 gagaagagatgaccatgatga 30117
>gb|AC021639.5| Drosophila melanogaster, chromosome X, region 12E-12E, BAC clone BACR02C24, complete sequence Length = 234783 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 127 acccatcacccaccacccacc 147 ||||||||||||||||||||| Sbjct: 152206 acccatcacccaccacccacc 152186
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 1.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 211 tatgcaaccaaacgtaaaaggaaaatgctggaa 243 ||||||||||||||||| || |||||| ||||| Sbjct: 22960558 tatgcaaccaaacgtaacagtaaaatgatggaa 22960526
>dbj|BA000026.2| Mycoplasma penetrans HF-2 DNA, complete genome Length = 1358633 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 cattttattaccatatcaatc 35 ||||||||||||||||||||| Sbjct: 345742 cattttattaccatatcaatc 345722
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome Length = 6413771 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 69 aagggaaaacaatcaaccaaa 89 ||||||||||||||||||||| Sbjct: 3994553 aagggaaaacaatcaaccaaa 3994573
>emb|AJ277561.1|LES277561 Lycopersicon esculentum partial mRNA for putative glutamine synthase (gts1 gene) Length = 905 Score = 42.1 bits (21), Expect = 1.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 333 ttccacaggatggtggtctcggcgatcat 361 |||||||||||||| ||||| |||||||| Sbjct: 318 ttccacaggatggtagtctccgcgatcat 290
>gb|AC116411.7| Mus musculus chromosome 3, clone RP24-485O3, complete sequence Length = 143601 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 128 cccatcacccaccacccaccc 148 ||||||||||||||||||||| Sbjct: 82487 cccatcacccaccacccaccc 82507
>gb|AE003494.4| Drosophila melanogaster chromosome X, section 46 of 74 of the complete sequence Length = 310498 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 127 acccatcacccaccacccacc 147 ||||||||||||||||||||| Sbjct: 181498 acccatcacccaccacccacc 181518
>gb|AY620818.1| Elaeagnus umbellata glutamine synthetase mRNA, complete cds Length = 1359 Score = 42.1 bits (21), Expect = 1.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 330 ggcttccacaggatggtggtctcggcgatcatg 362 |||||||||||||||||||| || || |||||| Sbjct: 1099 ggcttccacaggatggtggtttcagcaatcatg 1067
>gb|AC165078.2| Mus musculus BAC clone RP24-287O1 from chromosome 12, complete sequence Length = 172492 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 125 ccacccatcacccaccacccaccc 148 ||||||| |||||||||||||||| Sbjct: 105273 ccacccaccacccaccacccaccc 105296
>ref|NM_187697.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1050 Score = 40.1 bits (20), Expect = 4.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 331 gcttccacaggatggtggtctcggcgatcatg 362 |||||||||| | |||||||||||||||||| Sbjct: 1042 gcttccacagcagcgtggtctcggcgatcatg 1011
>gb|AC119876.9| Mus musculus chromosome 3, clone RP24-309A12, complete sequence Length = 165926 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 129 ccatcacccaccacccaccc 148 |||||||||||||||||||| Sbjct: 105970 ccatcacccaccacccaccc 105989
>gb|AC010124.6| Drosophila melanogaster clone BACR06O03, complete sequence Length = 193483 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 171765 gccacccaccacccaccacccacc 171788
>ref|XM_718384.1| Candida albicans SC5314 hypothetical protein (CaO19_4791), mRNA Length = 2931 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 gaaaacaatcaaccaaatac 92 |||||||||||||||||||| Sbjct: 1212 gaaaacaatcaaccaaatac 1193
>ref|XM_718195.1| Candida albicans SC5314 hypothetical protein (CaO19_12255), mRNA Length = 2931 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 gaaaacaatcaaccaaatac 92 |||||||||||||||||||| Sbjct: 1212 gaaaacaatcaaccaaatac 1193
>gb|AY491969.1| Triticum aestivum glutamine synthetase isoform GSr2 (GS) gene, complete cds Length = 1341 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 339 aggatggtggtctcggcgatcatg 362 |||| ||||||||||||||||||| Sbjct: 1085 aggagggtggtctcggcgatcatg 1062
>emb|BX255935.27| Zebrafish DNA sequence from clone DKEYP-46H4 in linkage group 14, complete sequence Length = 163552 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 73 gaaaacaatcaaccaaatactgta 96 ||||||||||||| |||||||||| Sbjct: 5832 gaaaacaatcaacgaaatactgta 5855
>emb|Z71258.1|CEC01H6 Caenorhabditis elegans Cosmid C01H6, complete sequence Length = 40359 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 acaatcaaccaaatactgta 96 |||||||||||||||||||| Sbjct: 34250 acaatcaaccaaatactgta 34269
>gb|AC108949.4| Mus musculus BAC clone RP23-451K2 from 6, complete sequence Length = 181571 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 128 cccatcacccaccacccacc 147 |||||||||||||||||||| Sbjct: 151460 cccatcacccaccacccacc 151479
>gb|AC092728.2| Canis familiaris clone RP81-237O17, complete sequence Length = 141578 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 125 ccacccatcacccaccacccaccc 148 ||||||| |||||||||||||||| Sbjct: 122983 ccacccaccacccaccacccaccc 123006
>gb|AC103419.6| Rattus norvegicus 9 BAC CH230-145A24 (Children's Hospital Oakland Research Institute) complete sequence Length = 217001 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 125 ccacccatcacccaccacccaccc 148 ||||||| |||||||||||||||| Sbjct: 85757 ccacccaccacccaccacccaccc 85734
>emb|X14244.1|OSRIGS8 Oryza sativa root GS1 mRNA for cytosolic glutamine synthetase (EC 6.3.1.2) (clone lambda-GS8) Length = 1169 Score = 40.1 bits (20), Expect = 4.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 331 gcttccacaggatggtggtctcggcgatcatg 362 |||||||||| | |||||||||||||||||| Sbjct: 1124 gcttccacagcagcgtggtctcggcgatcatg 1093
>gb|AC105364.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1743A09, complete sequence Length = 146568 Score = 40.1 bits (20), Expect = 4.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 331 gcttccacaggatggtggtctcggcgatcatg 362 |||||||||| | |||||||||||||||||| Sbjct: 106629 gcttccacagcagcgtggtctcggcgatcatg 106660
>emb|AL513025.13| Mouse DNA sequence from clone RP23-235O1 on chromosome 13 Contains the 5' end of a novel gene, the E2f3 gene for E2F transcription factor 3, a novel gene and two CpG islands, complete sequence Length = 197940 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 322 agcttcagggcttccacagg 341 |||||||||||||||||||| Sbjct: 2780 agcttcagggcttccacagg 2799
>emb|BX088603.12| Zebrafish DNA sequence from clone DKEYP-44D3, complete sequence Length = 177056 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 73 gaaaacaatcaaccaaatactgta 96 ||||||||||||| |||||||||| Sbjct: 15890 gaaaacaatcaacgaaatactgta 15867
>emb|CR381704.5| Zebrafish DNA sequence from clone CH211-202F6 in linkage group 14, complete sequence Length = 130789 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 catgatgatgtgacctacct 193 |||||||||||||||||||| Sbjct: 105516 catgatgatgtgacctacct 105497
>emb|BX324195.8| Zebrafish DNA sequence from clone CH211-288O15 in linkage group 14, complete sequence Length = 156128 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 catgatgatgtgacctacct 193 |||||||||||||||||||| Sbjct: 73533 catgatgatgtgacctacct 73552
>gb|AC161763.3| Mus musculus BAC clone RP23-294B14 from chromosome 7, complete sequence Length = 221679 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 125 ccacccatcacccaccacccaccc 148 ||||||| |||||||||||||||| Sbjct: 180420 ccacccaccacccaccacccaccc 180397
>gb|AC010032.10| Drosophila melanogaster 3L BAC RP98-2N23 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 192399 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 100732 gccacccaacacccaccacccacc 100709
>gb|AC010688.6| Drosophila melanogaster 3L BAC RP98-11G5 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 201313 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 159539 gccacccaccacccaccacccacc 159562
>gb|AC091127.3| Drosophila melanogaster 3L BAC RP98-27E18 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 177835 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 18241 gccacccaacacccaccacccacc 18218
>gb|AC010751.5| Drosophila melanogaster 3L BAC RP98-9A23 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 181437 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 170190 gccacccaccacccaccacccacc 170167
>gb|AC009560.10| Homo sapiens chromosome 15, clone RP11-219B17, complete sequence Length = 177308 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 214 gcaaccaaacgtaaaaggaaaatg 237 ||||||||||||||||||| |||| Sbjct: 141191 gcaaccaaacgtaaaaggacaatg 141168
>gb|AC010594.7| Homo sapiens chromosome 5 clone CTC-478B9, complete sequence Length = 78389 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 72 ggaaaacaatcaaccaaata 91 |||||||||||||||||||| Sbjct: 41909 ggaaaacaatcaaccaaata 41890
>gb|AC093101.1| Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone BACR06I01, complete sequence Length = 175167 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 153346 gccacccaccacccaccacccacc 153323
>gb|AC018763.6| Homo sapiens chromosome 5 clone CTD-2305C23, complete sequence Length = 119974 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 220 aaacgtaaaaggaaaatgct 239 |||||||||||||||||||| Sbjct: 112536 aaacgtaaaaggaaaatgct 112555
>gb|AC092247.1|AC092247 Drosophila melanogaster, chromosome 2L, region 35X-35X, BAC clone BACR36B06, complete sequence Length = 183436 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 412 gccacccaccacccaccacccacc 389
>gb|AC009209.6|AC009209 Drosophila melanogaster, chromosome 2R, region 47D-47D, BAC clone BACR24G16, complete sequence Length = 165974 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 14666 gccacccaccacccaccacccacc 14689
>ref|NM_059640.2| Caenorhabditis elegans C01H6.7 (Bromodomain) mRNA, complete cds Length = 2177 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 acaatcaaccaaatactgta 96 |||||||||||||||||||| Sbjct: 733 acaatcaaccaaatactgta 752
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 128 cccatcacccaccacccacc 147 |||||||||||||||||||| Sbjct: 38034700 cccatcacccaccacccacc 38034719 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 227 aaaggaaaatgctggaagaatttt 250 |||||||||||||||| ||||||| Sbjct: 2219791 aaaggaaaatgctggatgaatttt 2219814
>gb|AC034247.4|AC034247 Homo sapiens chromosome 5 clone RP11-343P16, complete sequence Length = 171482 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 aaacgtaaaaggaaaatgct 239 |||||||||||||||||||| Sbjct: 171450 aaacgtaaaaggaaaatgct 171431
>gb|AC008260.5|AC008260 Drosophila melanogaster, chromosome 2R, region 47B-47C, BAC clone BACR13J10, complete sequence Length = 140940 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 131284 gccacccaccacccaccacccacc 131307
>emb|BX004830.7| Zebrafish DNA sequence from clone CH211-159I8 in linkage group 14, complete sequence Length = 201070 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 catgatgatgtgacctacct 193 |||||||||||||||||||| Sbjct: 137181 catgatgatgtgacctacct 137200
>gb|AC008316.3|AC008316 Drosophila melanogaster, chromosome 3R, region 85F-85F, BAC clone BACR23O04, complete sequence Length = 160817 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 137788 gccacccaccacccaccacccacc 137765
>gb|AC008824.6|AC008824 Homo sapiens chromosome 5 clone CTD-2132K6, complete sequence Length = 121178 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 72 ggaaaacaatcaaccaaata 91 |||||||||||||||||||| Sbjct: 44746 ggaaaacaatcaaccaaata 44765
>gb|AC026753.5|AC026753 Homo sapiens chromosome 5 clone RP11-72L14, complete sequence Length = 148491 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 aaacgtaaaaggaaaatgct 239 |||||||||||||||||||| Sbjct: 141619 aaacgtaaaaggaaaatgct 141600
>dbj|AP003297.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0698A10 Length = 137348 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 128 cccatcacccaccacccacc 147 |||||||||||||||||||| Sbjct: 115644 cccatcacccaccacccacc 115663
>dbj|AP003261.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0471B04 Length = 138025 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 128 cccatcacccaccacccacc 147 |||||||||||||||||||| Sbjct: 2734 cccatcacccaccacccacc 2753
>gb|AC097004.3| Papio anubis clone RP41-290N16, complete sequence Length = 166987 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 126 cacccatcacccaccacccaccca 149 |||||| ||||||||||||||||| Sbjct: 85198 cacccaccacccaccacccaccca 85175
>dbj|AB180688.1| Oryza sativa (japonica cultivar-group) OsGS1;2 mRNA for cytosolic glutamine synthetase 1;2, complete cds Length = 2005 Score = 40.1 bits (20), Expect = 4.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 331 gcttccacaggatggtggtctcggcgatcatg 362 |||||||||| | |||||||||||||||||| Sbjct: 1722 gcttccacagcagcgtggtctcggcgatcatg 1691
>dbj|AP002913.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0480E02 Length = 141862 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 227 aaaggaaaatgctggaagaatttt 250 |||||||||||||||| ||||||| Sbjct: 140903 aaaggaaaatgctggatgaatttt 140926
>dbj|AP002483.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0019D06 Length = 167405 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 227 aaaggaaaatgctggaagaatttt 250 |||||||||||||||| ||||||| Sbjct: 3375 aaaggaaaatgctggatgaatttt 3398
>emb|AL929536.7| Zebrafish DNA sequence from clone CH211-158E23, complete sequence Length = 151341 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 75 aaacaatcaaccaaatactgtagt 98 |||||| ||||||||||||||||| Sbjct: 48151 aaacaaacaaccaaatactgtagt 48128
>emb|CR385078.23| Zebrafish DNA sequence from clone DKEYP-104F11 in linkage group 20, complete sequence Length = 182152 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 73 gaaaacaatcaaccaaatactgta 96 ||||||||||||| |||||||||| Sbjct: 4936 gaaaacaatcaacgaaatactgta 4959
>gb|AC006933.3|AC006933 Drosophila melanogaster, chromosome 3L, region 73B7-73D6, BAC clone BACR48E21, complete sequence Length = 186002 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 152682 gccacccaccacccaccacccacc 152659
>gb|AE003684.4| Drosophila melanogaster chromosome 3R, section 22 of 118 of the complete sequence Length = 214323 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 157511 gccacccaccacccaccacccacc 157488
>gb|AE003646.3| Drosophila melanogaster chromosome 2L, section 55 of 83 of the complete sequence Length = 265413 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 198399 gccacccaccacccaccacccacc 198376
>gb|AE003827.3| Drosophila melanogaster chromosome 2R, section 23 of 73 of the complete sequence Length = 256227 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 34387 gccacccaccacccaccacccacc 34410
>gb|AE003526.4| Drosophila melanogaster chromosome 3L, section 59 of 83 of the complete sequence Length = 281100 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 163412 gccacccaccacccaccacccacc 163435
>gb|AE003470.4| Drosophila melanogaster chromosome 3L, section 4 of 83 of the complete sequence Length = 318699 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 32888 gccacccaacacccaccacccacc 32865
>gb|AC005860.1|AC005860 Drosophila melanogaster DNA sequence (P1s DS04504 (D346) and DS00068 (D348)), complete sequence Length = 83099 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 124 gccacccatcacccaccacccacc 147 |||||||| ||||||||||||||| Sbjct: 35494 gccacccaccacccaccacccacc 35517
>gb|AC149593.5| Mus musculus BAC clone RP23-34O23 from 7, complete sequence Length = 231000 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 125 ccacccatcacccaccacccaccc 148 ||||||| |||||||||||||||| Sbjct: 202692 ccacccaccacccaccacccaccc 202715
>emb|AL953853.8| Mouse DNA sequence from clone RP23-6M16 on chromosome 2, complete sequence Length = 195971 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 125 ccacccatcacccaccacccaccc 148 ||||||| |||||||||||||||| Sbjct: 174878 ccacccaccacccaccacccaccc 174855
>emb|AL845292.4| Mouse DNA sequence from clone RP23-386I21 on chromosome 2, complete sequence Length = 186607 Score = 40.1 bits (20), Expect = 4.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cccatcacccaccacccacc 147 |||||||||||||||||||| Sbjct: 153652 cccatcacccaccacccacc 153633
>gb|AC124539.4| Mus musculus BAC clone RP23-359M14 from chromosome 12, complete sequence Length = 183684 Score = 40.1 bits (20), Expect = 4.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 125 ccacccatcacccaccacccaccc 148 ||||||| |||||||||||||||| Sbjct: 77077 ccacccaccacccaccacccaccc 77054 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,895,665 Number of Sequences: 3902068 Number of extensions: 2895665 Number of successful extensions: 56984 Number of sequences better than 10.0: 122 Number of HSP's better than 10.0 without gapping: 125 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 56555 Number of HSP's gapped (non-prelim): 408 length of query: 362 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 340 effective length of database: 17,147,199,772 effective search space: 5830047922480 effective search space used: 5830047922480 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)