ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart60b09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_729219.1| Plasmodium chabaudi chabaudi hypothetical prote... 44 0.092
2gb|AC161493.6| Mus musculus chromosome 1, clone RP24-77I21, comp... 44 0.092
3ref|NM_128396.1| Arabidopsis thaliana unknown protein AT2G28360 ... 42 0.36
4gb|AC135962.4| Mus musculus BAC clone RP23-342H15 from chromosom... 42 0.36
5gb|AC124681.3| Mus musculus BAC clone RP24-261H7 from chromosome... 42 0.36
6gb|AY136417.1| Arabidopsis thaliana unknown protein (At2g28360) ... 42 0.36
7gb|AC006283.6| Arabidopsis thaliana chromosome 2 clone T1B3 map ... 42 0.36
8gb|BT003400.1| Arabidopsis thaliana unknown protein (At2g28360) ... 42 0.36
9gb|AC146603.3| Mus musculus BAC clone RP23-304P17 from 8, comple... 40 1.4
10gb|AC152987.1| Mus musculus 6 BAC RP23-133N21 (Roswell Park Canc... 38 5.6
11gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chr... 38 5.6
12gb|AC112520.5| Mus musculus BAC clone RP23-2N4 from 12, complete... 38 5.6
13gb|AC102384.8| Mus musculus chromosome 6, clone RP24-446I4, comp... 38 5.6
14dbj|AK135446.1| Mus musculus 12 days embryo female mullerian duc... 38 5.6
15gb|AC154105.2| Mus musculus BAC clone RP24-457N12 from chromosom... 38 5.6
16gb|AC161265.2| Mus musculus BAC clone RP23-271F18 from chromosom... 38 5.6
17gb|AC144480.5| Mus musculus BAC clone RP23-239L21 from chromosom... 38 5.6
18emb|BX470215.5| Mouse DNA sequence from clone RP24-558L5 on chro... 38 5.6
19gb|AC158407.1| Mus musculus BAC RP23-23E11 (Roswell Park Cancer... 38 5.6
20gb|AC171779.5| Mus musculus chromosome 5, clone RP24-364L20, com... 38 5.6
21gb|AE000512.1| Thermotoga maritima MSB8, complete genome 38 5.6
22gb|AC132354.2| Mus musculus BAC clone RP24-112H7 from 12, comple... 38 5.6
23gb|AC136020.5| Mus musculus BAC clone RP24-434I13 from 12, compl... 38 5.6
24gb|AC162179.2| Mus musculus BAC clone RP23-197K11 from chromosom... 38 5.6
25dbj|AB015795.1| Porphyra haitanensis gene for small subunit rRNA... 38 5.6

>ref|XM_729219.1| Plasmodium chabaudi chabaudi hypothetical protein (PC405185.00.0)
           partial mRNA
          Length = 312

 Score = 44.1 bits (22), Expect = 0.092
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 97  gtattgtacaatgcatacatgt 118
           ||||||||||||||||||||||
Sbjct: 17  gtattgtacaatgcatacatgt 38



to top

>gb|AC161493.6| Mus musculus chromosome 1, clone RP24-77I21, complete sequence
          Length = 226794

 Score = 44.1 bits (22), Expect = 0.092
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 97    gtattgtacaatgcatacatgt 118
             ||||||||||||||||||||||
Sbjct: 45450 gtattgtacaatgcatacatgt 45429



to top

>ref|NM_128396.1| Arabidopsis thaliana unknown protein AT2G28360 mRNA, complete cds
          Length = 2481

 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 6    ccactgggaaaaaaccaccac 26
            |||||||||||||||||||||
Sbjct: 1448 ccactgggaaaaaaccaccac 1468



to top

>gb|AC135962.4| Mus musculus BAC clone RP23-342H15 from chromosome 16, complete
             sequence
          Length = 202525

 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 95    aggtattgtacaatgcataca 115
             |||||||||||||||||||||
Sbjct: 24910 aggtattgtacaatgcataca 24930



to top

>gb|AC124681.3| Mus musculus BAC clone RP24-261H7 from chromosome 16, complete sequence
          Length = 173837

 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 95     aggtattgtacaatgcataca 115
              |||||||||||||||||||||
Sbjct: 152030 aggtattgtacaatgcataca 152050



to top

>gb|AY136417.1| Arabidopsis thaliana unknown protein (At2g28360) mRNA, complete cds
          Length = 3033

 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 6    ccactgggaaaaaaccaccac 26
            |||||||||||||||||||||
Sbjct: 1772 ccactgggaaaaaaccaccac 1792



to top

>gb|AC006283.6| Arabidopsis thaliana chromosome 2 clone T1B3 map mi54, complete
             sequence
          Length = 93122

 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 6     ccactgggaaaaaaccaccac 26
             |||||||||||||||||||||
Sbjct: 44083 ccactgggaaaaaaccaccac 44103



to top

>gb|BT003400.1| Arabidopsis thaliana unknown protein (At2g28360) mRNA, complete cds
          Length = 1635

 Score = 42.1 bits (21), Expect = 0.36
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 6   ccactgggaaaaaaccaccac 26
           |||||||||||||||||||||
Sbjct: 440 ccactgggaaaaaaccaccac 460



to top

>gb|AC146603.3| Mus musculus BAC clone RP23-304P17 from 8, complete sequence
          Length = 167842

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 21     caccacaaagatgataatgg 40
              ||||||||||||||||||||
Sbjct: 150998 caccacaaagatgataatgg 150979



to top

>gb|AC152987.1| Mus musculus 6 BAC RP23-133N21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 196532

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 104   acaatgcatacatgtgtca 122
             |||||||||||||||||||
Sbjct: 24903 acaatgcatacatgtgtca 24921



to top

>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete
              sequence
          Length = 1438950

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 25     acaaagatgataatggatg 43
              |||||||||||||||||||
Sbjct: 312404 acaaagatgataatggatg 312422



to top

>gb|AC112520.5| Mus musculus BAC clone RP23-2N4 from 12, complete sequence
          Length = 233153

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 102  gtacaatgcatacatgtgt 120
            |||||||||||||||||||
Sbjct: 2544 gtacaatgcatacatgtgt 2526



to top

>gb|AC102384.8| Mus musculus chromosome 6, clone RP24-446I4, complete sequence
          Length = 150552

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 16    aaaaccaccacaaagatga 34
             |||||||||||||||||||
Sbjct: 39966 aaaaccaccacaaagatga 39948



to top

>dbj|AK135446.1| Mus musculus 12 days embryo female mullerian duct includes
           surrounding region cDNA, RIKEN full-length enriched
           library, clone:6820422C14 product:unclassifiable, full
           insert sequence
          Length = 985

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 104 acaatgcatacatgtgtca 122
           |||||||||||||||||||
Sbjct: 324 acaatgcatacatgtgtca 306



to top

>gb|AC154105.2| Mus musculus BAC clone RP24-457N12 from chromosome 12, complete sequence
          Length = 237236

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 102    gtacaatgcatacatgtgt 120
              |||||||||||||||||||
Sbjct: 176653 gtacaatgcatacatgtgt 176635



to top

>gb|AC161265.2| Mus musculus BAC clone RP23-271F18 from chromosome 9, complete sequence
          Length = 203839

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 14    aaaaaaccaccacaaagat 32
             |||||||||||||||||||
Sbjct: 86467 aaaaaaccaccacaaagat 86449



to top

>gb|AC144480.5| Mus musculus BAC clone RP23-239L21 from chromosome 5, complete sequence
          Length = 195527

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 11     gggaaaaaaccaccacaaagatg 33
              ||||||| |||||||||||||||
Sbjct: 129592 gggaaaacaccaccacaaagatg 129570



to top

>emb|BX470215.5| Mouse DNA sequence from clone RP24-558L5 on chromosome X, complete
             sequence
          Length = 137502

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 11    gggaaaaaaccaccacaaagatg 33
             |||||||||||| ||||||||||
Sbjct: 46244 gggaaaaaaccaacacaaagatg 46266



to top

>gb|AC158407.1| Mus musculus  BAC RP23-23E11 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 187033

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 16    aaaaccaccacaaagatga 34
             |||||||||||||||||||
Sbjct: 32967 aaaaccaccacaaagatga 32985



to top

>gb|AC171779.5| Mus musculus chromosome 5, clone RP24-364L20, complete sequence
          Length = 173141

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 11    gggaaaaaaccaccacaaagatg 33
             ||||||| |||||||||||||||
Sbjct: 30744 gggaaaacaccaccacaaagatg 30766



to top

>gb|AE000512.1| Thermotoga maritima MSB8, complete genome
          Length = 1860725

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 75      cgatttaggaacttttgac 93
               |||||||||||||||||||
Sbjct: 1526180 cgatttaggaacttttgac 1526198



to top

>gb|AC132354.2| Mus musculus BAC clone RP24-112H7 from 12, complete sequence
          Length = 180298

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 38     tggatgacctgtccattta 56
              |||||||||||||||||||
Sbjct: 164364 tggatgacctgtccattta 164346



to top

>gb|AC136020.5| Mus musculus BAC clone RP24-434I13 from 12, complete sequence
          Length = 193375

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 38     tggatgacctgtccattta 56
              |||||||||||||||||||
Sbjct: 162741 tggatgacctgtccattta 162759



to top

>gb|AC162179.2| Mus musculus BAC clone RP23-197K11 from chromosome 9, complete
           sequence
          Length = 210741

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 14  aaaaaaccaccacaaagat 32
           |||||||||||||||||||
Sbjct: 370 aaaaaaccaccacaaagat 352



to top

>dbj|AB015795.1| Porphyra haitanensis gene for small subunit rRNA, partial sequence
          Length = 2354

 Score = 38.2 bits (19), Expect = 5.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1    ccaatccactgggaaaaaa 19
            |||||||||||||||||||
Sbjct: 1005 ccaatccactgggaaaaaa 1023


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,124,077
Number of Sequences: 3902068
Number of extensions: 1124077
Number of successful extensions: 80541
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80478
Number of HSP's gapped (non-prelim): 63
length of query: 122
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 101
effective length of database: 17,151,101,840
effective search space: 1732261285840
effective search space used: 1732261285840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top