>dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009
          Length = 1913118

 Score = 38.2 bits (19), Expect = 0.84
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 8       ccatcaattccttgatcaa 26
               |||||||||||||||||||
Sbjct: 1073836 ccatcaattccttgatcaa 1073818

>ref|XM_628133.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd1_3170),
            partial mRNA
          Length = 4860

 Score = 38.2 bits (19), Expect = 0.84
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 16   tccttgatcaaatttcaaa 34
            |||||||||||||||||||
Sbjct: 1476 tccttgatcaaatttcaaa 1458

>ref|XM_660742.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.40190)
           partial mRNA
          Length = 1014

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 14  attccttgatcaaatttc 31
           ||||||||||||||||||
Sbjct: 849 attccttgatcaaatttc 866

>emb|AL391995.7| Human DNA sequence from clone RP11-522N4 on chromosome 13, complete
              sequence
          Length = 178920

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 18     cttgatcaaatttcaaaa 35
              ||||||||||||||||||
Sbjct: 165531 cttgatcaaatttcaaaa 165514

>emb|AL109915.10|HSDJ120N9 Human DNA sequence from clone RP1-120N9 on chromosome 6q13-15 Contains
             the SNAP91 gene for synaptosomal-associated protein, 91 kD
             homolog (mouse) (KIAA0656) and a CpG island, complete
             sequence
          Length = 167018

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 14    attccttgatcaaatttc 31
             ||||||||||||||||||
Sbjct: 76548 attccttgatcaaatttc 76531

>emb|CR925678.1| Ehrlichia ruminantium str. Welgevonden, complete genome
          Length = 1512977

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 18     cttgatcaaatttcaaaa 35
              ||||||||||||||||||
Sbjct: 315878 cttgatcaaatttcaaaa 315861

>emb|CR767821.1| Ehrlichia ruminantium strain Welgevonden, complete genome
          Length = 1516355

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 18     cttgatcaaatttcaaaa 35
              ||||||||||||||||||
Sbjct: 335885 cttgatcaaatttcaaaa 335868

>ref|XM_625763.1| Cryptosporidium parvum Iowa II putative yeast Brr6p, 2
           transmembrane domains and a NFX like finger (cgd4_1680),
           partial mRNA
          Length = 1011

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 14  attccttgatcaaatttc 31
           ||||||||||||||||||
Sbjct: 846 attccttgatcaaatttc 863

>gb|AC147892.2| Xenopus tropicalis clone CH216-35D21, complete sequence
          Length = 178580

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 9     catcaattccttgatcaaattt 30
             |||| |||||||||||||||||
Sbjct: 59154 catccattccttgatcaaattt 59133

>gb|AC159461.1| Mus musculus BAC clone RP23-273I10 from chromosome 13, complete sequence
          Length = 152402

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 13     aattccttgatcaaattt 30
              ||||||||||||||||||
Sbjct: 136325 aattccttgatcaaattt 136308

>gb|AC154539.3| Mus musculus BAC clone RP23-452F20 from chromosome 13, complete sequence
          Length = 176106

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 13     aattccttgatcaaattt 30
              ||||||||||||||||||
Sbjct: 120627 aattccttgatcaaattt 120610

>gb|AC154241.2| Mus musculus BAC clone RP24-171B8 from 13, complete sequence
          Length = 158846

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 13     aattccttgatcaaattt 30
              ||||||||||||||||||
Sbjct: 142719 aattccttgatcaaattt 142736

>emb|AL161669.5|CNS01RHC Human chromosome 14 DNA sequence BAC R-736N17 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 192462

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    atcaattccttgatcaaa 27
             ||||||||||||||||||
Sbjct: 27187 atcaattccttgatcaaa 27170

>emb|AL138976.5|CNS01DWY Human chromosome 14 DNA sequence BAC R-45P15 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 167357

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 10    atcaattccttgatcaaa 27
             ||||||||||||||||||
Sbjct: 25823 atcaattccttgatcaaa 25840


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 411,072
Number of Sequences: 3902068
Number of extensions: 411072
Number of successful extensions: 93551
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93499
Number of HSP's gapped (non-prelim): 52
length of query: 35
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 15
effective length of database: 17,155,003,908
effective search space: 257325058620
effective search space used: 257325058620
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)