>emb|AL161513.2|ATCHRIV25 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 25
          Length = 179771

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 39    tagtacacaaattacataatta 60
             ||||||||||||||||||||||
Sbjct: 98278 tagtacacaaattacataatta 98257

>gb|AF128396.1|T3H13 Arabidopsis thaliana BAC T3H13
          Length = 118737

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 39    tagtacacaaattacataatta 60
             ||||||||||||||||||||||
Sbjct: 64572 tagtacacaaattacataatta 64551

>gb|AF488412.1| Sorghum bicolor BAC 131L1, complete sequence
          Length = 130987

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 28     tacaattgtagtagtacacaaatta 52
              |||| ||||||||||||||||||||
Sbjct: 127418 tacagttgtagtagtacacaaatta 127442

>emb|AL357115.24| Human DNA sequence from clone RP11-102P23 on chromosome Xq13.3-21.1
             Contains the 5' end of the NSBP1 gene for nucleosomal
             binding protein 1 and the SH3BGRL gene for SH3 domain
             binding glutamic acid-rich protein like, complete sequence
          Length = 164012

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 123   atcttcacaactccttaggaaacac 147
             ||||||||||||| |||||||||||
Sbjct: 79042 atcttcacaactctttaggaaacac 79066

>gb|AY810015.1| Schistosoma japonicum SJCHGC04103 protein mRNA, partial cds
          Length = 804

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 18  ttgactttgatacaattgta 37
           ||||||||||||||||||||
Sbjct: 294 ttgactttgatacaattgta 275

>emb|CT009533.6| Platypus DNA sequence from clone XX-522J9, complete sequence
          Length = 149919

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 191  tgatcagaaacccacagcaa 210
            ||||||||||||||||||||
Sbjct: 7563 tgatcagaaacccacagcaa 7582

>gb|AC067807.10| Homo sapiens chromosome 11, clone RP11-738J16, complete sequence
          Length = 166312

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   tgcattatatcatatatctt 127
             ||||||||||||||||||||
Sbjct: 98300 tgcattatatcatatatctt 98319

>gb|AC079400.6| Homo sapiens BAC clone RP11-485M18 from 2, complete sequence
          Length = 113114

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 102    agtaggtgcattatatcata 121
              ||||||||||||||||||||
Sbjct: 105866 agtaggtgcattatatcata 105847

>emb|BX649512.4| Mouse DNA sequence from clone RP24-87G15 on chromosome 2, complete
             sequence
          Length = 132230

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    cattgactttgatacaattg 35
             ||||||||||||||||||||
Sbjct: 20043 cattgactttgatacaattg 20024

>dbj|AP003718.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-203F8, complete
             sequence
          Length = 85000

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 108   tgcattatatcatatatctt 127
             ||||||||||||||||||||
Sbjct: 18588 tgcattatatcatatatctt 18569


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,068,047
Number of Sequences: 3902068
Number of extensions: 2068047
Number of successful extensions: 40257
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 40246
Number of HSP's gapped (non-prelim): 11
length of query: 261
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 239
effective length of database: 17,147,199,772
effective search space: 4098180745508
effective search space used: 4098180745508
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)