ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart59h04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF377447.1| Zea mays subsp. mays clone GUA131 anonymous genom... 44 0.32
2ref|XM_653411.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 1.3
3gb|AC149806.16| Medicago truncatula clone mth2-150h12, complete ... 42 1.3
4gb|AC120541.8| Mus musculus, clone RP23-286L18, complete sequence 42 1.3
5emb|AL844570.9| Zebrafish DNA sequence from clone DKEY-20D18, co... 42 1.3
6gb|AC006366.4| Homo sapiens BAC clone RP11-86G22 from Y, complet... 40 5.0
7gb|AC147669.4| Pan troglodytes BAC clone CH251-71E10 from Y, com... 40 5.0
8gb|AC147664.2| Pan troglodytes BAC clone CH251-238C14 from Y, co... 40 5.0
9gb|AC146243.2| Pan troglodytes BAC clone CH251-166E5 from Y, com... 40 5.0
10gb|AC142346.1| Pan troglodytes BAC clone RP43-2A2 from Y, comple... 40 5.0
11gb|AC142332.1| Pan troglodytes BAC clone RP43-31L22 from Y, comp... 40 5.0
12emb|AL118512.9|HSG248A21 Human DNA sequence from clone GS1-248A2... 40 5.0
13gb|AF332231.1| Homo sapiens testis transcript Y 4 (TTY4) mRNA, p... 40 5.0
14emb|AL662803.11| Mouse DNA sequence from clone RP23-215N10 on ch... 40 5.0
15emb|BX323866.5| Zebrafish DNA sequence from clone CH211-278M12 i... 40 5.0
16gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 5.0
17gb|AC090355.9| Homo sapiens chromosome 18, clone RP11-745C22, co... 40 5.0
18gb|AC092506.3| Homo sapiens chromosome 1 clone RP11-364B6, compl... 40 5.0
19ref|NR_001525.1| Homo sapiens testis-specific transcript, Y-link... 40 5.0
20ref|NR_002177.1| Homo sapiens testis-specific transcript, Y-link... 40 5.0
21ref|NR_002178.1| Homo sapiens testis-specific transcript, Y-link... 40 5.0
22gb|AC010153.3|AC010153 Homo sapiens BAC clone RP11-535I13 from Y... 40 5.0
23gb|AC016728.4|AC016728 Homo sapiens BAC clone RP11-363G6 from Y,... 40 5.0
24ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P... 40 5.0
25gb|AC172863.1| Brassica rapa subsp. pekinensis clone KBrB070M24,... 40 5.0
26gb|AC090939.2| Homo sapiens chromosome 3 clone RP11-127I14 map 3... 40 5.0

>gb|AF377447.1| Zea mays subsp. mays clone GUA131 anonymous genomic RFLP marker
           Asg26
          Length = 769

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 245 tggtcaatacaacagtgtggttgtgc 270
           |||||||||||| |||||||||||||
Sbjct: 454 tggtcaatacaagagtgtggttgtgc 479



to top

>ref|XM_653411.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0899.2), mRNA
          Length = 2385

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 121  cctcgaacctcttcacttcag 141
            |||||||||||||||||||||
Sbjct: 1324 cctcgaacctcttcacttcag 1344



to top

>gb|AC149806.16| Medicago truncatula clone mth2-150h12, complete sequence
          Length = 113593

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 66    atagaaaagtggcaggaaaccaaat 90
             ||||||||||||||| |||||||||
Sbjct: 66056 atagaaaagtggcagcaaaccaaat 66032



to top

>gb|AC120541.8| Mus musculus, clone RP23-286L18, complete sequence
          Length = 171942

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 258   agtgtggttgtgcatgctgtt 278
             |||||||||||||||||||||
Sbjct: 55875 agtgtggttgtgcatgctgtt 55855



to top

>emb|AL844570.9| Zebrafish DNA sequence from clone DKEY-20D18, complete sequence
          Length = 240816

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 130    tcttcacttcagacctccagc 150
              |||||||||||||||||||||
Sbjct: 107081 tcttcacttcagacctccagc 107061



to top

>gb|AC006366.4| Homo sapiens BAC clone RP11-86G22 from Y, complete sequence
          Length = 166458

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     aagaaatgttgcctcttata 22
             ||||||||||||||||||||
Sbjct: 55394 aagaaatgttgcctcttata 55375



to top

>gb|AC147669.4| Pan troglodytes BAC clone CH251-71E10 from Y, complete sequence
          Length = 151872

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     aagaaatgttgcctcttata 22
             ||||||||||||||||||||
Sbjct: 55413 aagaaatgttgcctcttata 55394



to top

>gb|AC147664.2| Pan troglodytes BAC clone CH251-238C14 from Y, complete sequence
          Length = 159873

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      aagaaatgttgcctcttata 22
              ||||||||||||||||||||
Sbjct: 118162 aagaaatgttgcctcttata 118143



to top

>gb|AC146243.2| Pan troglodytes BAC clone CH251-166E5 from Y, complete sequence
          Length = 161714

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      aagaaatgttgcctcttata 22
              ||||||||||||||||||||
Sbjct: 121754 aagaaatgttgcctcttata 121735



to top

>gb|AC142346.1| Pan troglodytes BAC clone RP43-2A2 from Y, complete sequence
          Length = 162911

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     aagaaatgttgcctcttata 22
             ||||||||||||||||||||
Sbjct: 55408 aagaaatgttgcctcttata 55389



to top

>gb|AC142332.1| Pan troglodytes BAC clone RP43-31L22 from Y, complete sequence
          Length = 153093

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     aagaaatgttgcctcttata 22
             ||||||||||||||||||||
Sbjct: 39964 aagaaatgttgcctcttata 39983



to top

>emb|AL118512.9|HSG248A21 Human DNA sequence from clone GS1-248A21 on chromosome 1q31.1-31.3
             Contains part of the gene for hemicentin (FIBL-6),
             complete sequence
          Length = 83063

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 219   gctcttccttctcagtttcatatc 242
             ||||||||||||||||||| ||||
Sbjct: 35311 gctcttccttctcagtttcttatc 35288



to top

>gb|AF332231.1| Homo sapiens testis transcript Y 4 (TTY4) mRNA, partial sequence
          Length = 1370

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    aagaaatgttgcctcttata 22
            ||||||||||||||||||||
Sbjct: 1029 aagaaatgttgcctcttata 1048



to top

>emb|AL662803.11| Mouse DNA sequence from clone RP23-215N10 on chromosome 11 Contains a
              novel gene, complete sequence
          Length = 155034

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 61     atgacatagaaaagtggcag 80
              ||||||||||||||||||||
Sbjct: 111066 atgacatagaaaagtggcag 111085



to top

>emb|BX323866.5| Zebrafish DNA sequence from clone CH211-278M12 in linkage group 13,
             complete sequence
          Length = 98734

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 19    tatataagttataattaaaattga 42
             ||||||||| ||||||||||||||
Sbjct: 36319 tatataagtaataattaaaattga 36342



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 3        aagaaatgttgcctcttata 22
                ||||||||||||||||||||
Sbjct: 11061327 aagaaatgttgcctcttata 11061346



 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 3       aagaaatgttgcctcttata 22
               ||||||||||||||||||||
Sbjct: 3093204 aagaaatgttgcctcttata 3093223



to top

>gb|AC090355.9| Homo sapiens chromosome 18, clone RP11-745C22, complete sequence
          Length = 186783

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 68     agaaaagtggcaggaaacca 87
              ||||||||||||||||||||
Sbjct: 109462 agaaaagtggcaggaaacca 109481



to top

>gb|AC092506.3| Homo sapiens chromosome 1 clone RP11-364B6, complete sequence
          Length = 198279

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 40     tgagtatgtgattcctgtaa 59
              ||||||||||||||||||||
Sbjct: 149998 tgagtatgtgattcctgtaa 150017



to top

>ref|NR_001525.1| Homo sapiens testis-specific transcript, Y-linked 4 (TTTY4) on
            chromosome Y
          Length = 1370

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    aagaaatgttgcctcttata 22
            ||||||||||||||||||||
Sbjct: 1029 aagaaatgttgcctcttata 1048



to top

>ref|NR_002177.1| Homo sapiens testis-specific transcript, Y-linked 4C (TTTY4C) on
            chromosome Y
          Length = 1346

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    aagaaatgttgcctcttata 22
            ||||||||||||||||||||
Sbjct: 1029 aagaaatgttgcctcttata 1048



to top

>ref|NR_002178.1| Homo sapiens testis-specific transcript, Y-linked 4B (TTTY4B) on
            chromosome Y
          Length = 1346

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 3    aagaaatgttgcctcttata 22
            ||||||||||||||||||||
Sbjct: 1029 aagaaatgttgcctcttata 1048



to top

>gb|AC010153.3|AC010153 Homo sapiens BAC clone RP11-535I13 from Y, complete sequence
          Length = 104147

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     aagaaatgttgcctcttata 22
             ||||||||||||||||||||
Sbjct: 59464 aagaaatgttgcctcttata 59483



to top

>gb|AC016728.4|AC016728 Homo sapiens BAC clone RP11-363G6 from Y, complete sequence
          Length = 152052

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     aagaaatgttgcctcttata 22
             ||||||||||||||||||||
Sbjct: 46044 aagaaatgttgcctcttata 46025



to top

>ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P3 and inverted repeat IR2
               (P1-P2-P3-IR2@) on chromosome Y
          Length = 4538292

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 3       aagaaatgttgcctcttata 22
               ||||||||||||||||||||
Sbjct: 3252514 aagaaatgttgcctcttata 3252495



 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 3       aagaaatgttgcctcttata 22
               ||||||||||||||||||||
Sbjct: 2795822 aagaaatgttgcctcttata 2795841



 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 3       aagaaatgttgcctcttata 22
               ||||||||||||||||||||
Sbjct: 1162081 aagaaatgttgcctcttata 1162100



to top

>gb|AC172863.1| Brassica rapa subsp. pekinensis clone KBrB070M24, complete sequence
          Length = 97697

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 17    cttatataagttataattaa 36
             ||||||||||||||||||||
Sbjct: 36816 cttatataagttataattaa 36797



to top

>gb|AC090939.2| Homo sapiens chromosome 3 clone RP11-127I14 map 3p, complete sequence
          Length = 161366

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 207    atggatgatgatgctcttccttct 230
              ||||||||||||||| ||||||||
Sbjct: 106588 atggatgatgatgctattccttct 106611


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,482,250
Number of Sequences: 3902068
Number of extensions: 3482250
Number of successful extensions: 71222
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71080
Number of HSP's gapped (non-prelim): 142
length of query: 372
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 350
effective length of database: 17,147,199,772
effective search space: 6001519920200
effective search space used: 6001519920200
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top