Clone Name	rbart59h03
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ...	280	3e-72
2	gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds	236	4e-59
3	gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei...	236	4e-59
4	ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic...	220	2e-54
5	gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins...	198	9e-48
6	gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein...	190	2e-45
7	dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,...	190	2e-45
8	gb|AY109332.1| Zea mays CL502_5 mRNA sequence	190	2e-45
9	dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd	190	2e-45
10	gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein...	182	5e-43
11	ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA	174	1e-40
12	dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon...	174	1e-40
13	gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence	172	5e-40
14	gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple...	143	4e-31
15	ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA	125	1e-25
16	ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group...	125	1e-25
17	ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group...	125	1e-25
18	dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon...	125	1e-25
19	dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon...	125	1e-25
20	dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon...	125	1e-25
21	dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon...	125	1e-25
22	dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon...	125	1e-25
23	gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp...	125	1e-25
24	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	121	2e-24
25	emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,...	121	2e-24
26	gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co...	119	6e-24
27	gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel...	119	6e-24
28	gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA	119	6e-24
29	emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p...	117	3e-23
30	ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G3...	115	1e-22
31	emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for p...	115	1e-22
32	emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides m...	115	1e-22
33	emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Co...	115	1e-22
34	emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Co...	115	1e-22
35	emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Co...	115	1e-22
36	emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Co...	115	1e-22
37	emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Co...	115	1e-22
38	emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Co...	115	1e-22
39	emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Co...	115	1e-22
40	gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete s...	115	1e-22
41	gb|BT016583.1| Zea mays clone Contig416 mRNA sequence	113	4e-22
42	gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds	113	4e-22
43	gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein...	113	4e-22
44	gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds	109	6e-21
45	ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA	109	6e-21
46	gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat...	109	6e-21
47	dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ...	109	6e-21
48	dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon...	109	6e-21
49	ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic...	107	2e-20
50	emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major ...	107	2e-20
51	dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon...	107	2e-20
52	dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon...	107	2e-20
53	dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon...	107	2e-20
54	dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon...	107	2e-20
55	gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm...	107	2e-20
56	gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr...	105	1e-19
57	gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins...	105	1e-19
58	emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic...	103	4e-19
59	dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane in...	103	4e-19
60	emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein	101	2e-18
61	gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)...	101	2e-18
62	emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrins...	100	6e-18
63	gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat...	98	2e-17
64	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	98	2e-17
65	gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein...	98	2e-17
66	dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D...	98	2e-17
67	ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G5...	94	4e-16
68	ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A)...	94	4e-16
69	emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrins...	94	4e-16
70	gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic pr...	94	4e-16
71	gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 ...	94	4e-16
72	gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co...	94	4e-16
73	dbj|AK220982.1| Arabidopsis thaliana mRNA for plasma membrane in...	94	4e-16
74	gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic pr...	94	4e-16
75	gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, co...	94	4e-16
76	emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Co...	94	4e-16
77	emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Co...	94	4e-16
78	emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Co...	94	4e-16
79	emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Co...	94	4e-16
80	emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Co...	94	4e-16
81	gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete s...	94	4e-16
82	dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds	94	4e-16
83	dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane ...	94	4e-16
84	ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37...	92	1e-15
85	gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (...	92	1e-15
86	gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma m...	92	1e-15
87	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	92	1e-15
88	gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete s...	92	1e-15
89	dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative tran...	92	1e-15
90	dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D...	92	1e-15
91	dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds	92	1e-15
92	gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds	92	1e-15
93	dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membran...	92	1e-15
94	ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA	90	6e-15
95	ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group...	90	6e-15
96	gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic prot...	90	6e-15
97	gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin...	90	6e-15
98	dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon...	90	6e-15
99	gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c...	88	2e-14
100	dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane ...	88	2e-14
101	ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channe...	86	9e-14
102	ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channe...	86	9e-14
103	ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic...	86	9e-14
104	dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds	86	9e-14
105	gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp...	86	9e-14
106	gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp...	86	9e-14
107	gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp...	86	9e-14
108	emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Co...	86	9e-14
109	gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete s...	86	9e-14
110	emb|AJ605565.1| Ricinus communis partial mRNA for putative aquap...	86	9e-14
111	dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon...	86	9e-14
112	dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon...	86	9e-14
113	dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon...	86	9e-14
114	dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon...	86	9e-14
115	gb|U27347.1|GMU27347 Glycine max putative water channel protein ...	86	9e-14
116	gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr...	84	4e-13
117	gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (...	84	4e-13
118	gb|DQ450066.1| Arachis hypogaea clone 10A4R1GZ putative aquapori...	84	4e-13
119	gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic ...	84	4e-13
120	gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr...	84	4e-13
121	gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence	82	1e-12
122	gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence	82	1e-12
123	gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ...	82	1e-12
124	dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D...	82	1e-12
125	dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membran...	82	1e-12
126	ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTR...	80	6e-12
127	ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe...	80	6e-12
128	gb|AY081593.1| Arabidopsis thaliana water channel-like protein (...	80	6e-12
129	gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic pr...	80	6e-12
130	gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic pr...	80	6e-12
131	gb|AY059948.1| Arabidopsis thaliana water channel - like protein...	80	6e-12
132	gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 ...	80	6e-12
133	gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intr...	80	6e-12
134	emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co...	80	6e-12
135	emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Co...	80	6e-12
136	emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co...	80	6e-12
137	emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Co...	80	6e-12
138	emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Co...	80	6e-12
139	emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co...	80	6e-12
140	emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Co...	80	6e-12
141	emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co...	80	6e-12
142	gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete se...	80	6e-12
143	gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se...	80	6e-12
144	dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds	80	6e-12
145	dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	80	6e-12
146	gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrin...	80	6e-12
147	gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel...	80	6e-12
148	gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrins...	80	6e-12
149	gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map...	78	2e-11
150	dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li...	78	2e-11
151	gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds	78	2e-11
152	emb|AJ605568.1| Ricinus communis partial mRNA for putative aquap...	78	2e-11
153	gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com...	78	2e-11
154	emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p...	76	9e-11
155	gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein...	76	9e-11
156	gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann...	76	9e-11
157	dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote...	76	9e-11
158	dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquapo...	76	9e-11
159	gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, ...	74	3e-10
160	gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat...	74	3e-10
161	gb|BT014251.1| Lycopersicon esculentum clone 133453R, mRNA sequence	72	1e-09
162	gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence	72	1e-09
163	emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening memb...	72	1e-09
164	emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening memb...	72	1e-09
165	emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for p...	72	1e-09
166	emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet...	72	1e-09
167	gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds	72	1e-09
168	gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m...	72	1e-09
169	dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon...	72	1e-09
170	dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon...	72	1e-09
171	dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon...	72	1e-09
172	emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BA...	72	1e-09
173	gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ...	72	1e-09
174	dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ...	72	1e-09
175	gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence	70	5e-09
176	gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-...	70	5e-09
177	gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic pro...	70	5e-09
178	emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p...	70	5e-09
179	dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane in...	70	5e-09
180	gb|AF118382.1|AF118382 Brassica napus plasma membrane intrinsic ...	70	5e-09
181	ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA	68	2e-08
182	gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1...	68	2e-08
183	emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein	68	2e-08
184	emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins...	68	2e-08
185	ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA	68	2e-08
186	gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRN...	68	2e-08
187	gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, compl...	68	2e-08
188	gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:1290...	68	2e-08
189	gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocula...	68	2e-08
190	dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane in...	68	2e-08
191	dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membra...	68	2e-08
192	dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra...	68	2e-08
193	gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 m...	68	2e-08
194	gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot...	68	2e-08
195	gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip...	68	2e-08
196	emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1	66	8e-08
197	emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ...	66	8e-08
198	emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BA...	66	8e-08
199	emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BA...	66	8e-08
200	emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp...	66	8e-08
201	gb|AF367457.1| Prunus persica clone Mip1 membrane intrinsic prot...	66	8e-08
202	dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clon...	66	8e-08
203	dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clon...	66	8e-08
204	dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clon...	66	8e-08
205	gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, compl...	66	8e-08
206	gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com...	66	8e-08
207	dbj|AB002148.1| Nicotiana excelsior mRNA for water channel prote...	66	8e-08
208	gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mR...	64	3e-07
209	emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p...	64	3e-07
210	gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ...	64	3e-07
211	gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein ...	64	3e-07
212	gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds	62	1e-06
213	gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ...	62	1e-06
214	emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic...	62	1e-06
215	emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel...	62	1e-06
216	emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,...	62	1e-06
217	gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds	62	1e-06
218	gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c...	62	1e-06
219	gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ...	62	1e-06
220	gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein...	62	1e-06
221	gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein...	62	1e-06
222	gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein...	62	1e-06
223	gb|AY103580.1| Zea mays PCO072544 mRNA sequence	62	1e-06
224	ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G6...	60	5e-06
225	ref|XM_519026.1| PREDICTED: Pan troglodytes aquaporin 1 (LOC4633...	60	5e-06
226	ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative...	60	5e-06
227	ref|NM_198098.1| Homo sapiens aquaporin 1 (Colton blood group) (...	60	5e-06
228	gb|AY312581.1| Homo sapiens aquaporin 1 splice variant 3 (AQP1) ...	60	5e-06
229	gb|AY312580.1| Homo sapiens aquaporin 1 splice variant 2 (AQP1) ...	60	5e-06
230	gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds	60	5e-06
231	gb|BC022486.1| Homo sapiens aquaporin 1 (Colton blood group), mR...	60	5e-06
232	emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,...	60	5e-06
233	emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene)	60	5e-06
234	emb|CR859936.1| Pongo pygmaeus mRNA; cDNA DKFZp469G0320 (from cl...	60	5e-06
235	gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 geno...	60	5e-06
236	emb|CR617260.1| full-length cDNA clone CS0DI057YC23 of Placenta ...	60	5e-06
237	gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com...	60	5e-06
238	gb|AF480415.1| Homo sapiens aquaporin 1 (AQP1) gene, partial cds	60	5e-06
239	gb|AF452012.1|AF452012 Petunia x hybrida aquaporin-like protein ...	60	5e-06
240	gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, com...	60	5e-06
241	gb|U41518.1|HSU41518 Human channel-like integral membrane protei...	60	5e-06
242	gb|S73482.1| uterine water channel=28 kda erythrocyte integral m...	60	5e-06
243	gb|AY034596.1| Macaca radiata aquaporin 1 mRNA, partial cds	60	5e-06
244	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	60	5e-06
245	emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Co...	60	5e-06
246	emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Co...	60	5e-06
247	gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence	60	5e-06
248	gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete se...	60	5e-06
249	gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma...	60	5e-06
250	gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA...	60	5e-06
251	dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	5e-06
252	gb|AF440271.1| Nicotiana tabacum aquaporin (NtPIP1;1) mRNA, comp...	60	5e-06
253	gb|U41517.1|HSU41517 Human channel-like integral membrane protei...	60	5e-06
254	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	60	5e-06
255	gb|U97023.1|PVU97023 Phaseolus vulgaris putative aquaporin-1 (Mi...	60	5e-06
256	gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, com...	60	5e-06
257	gb|M77829.1|HUMCHIP28A Human channel-like integral membrane prot...	60	5e-06
258	dbj|AB058679.1| Pyrus communis Py-PIP1-1 mRNA for plasma membran...	60	5e-06
259	gb|AY961922.1| Picea abies probable aquaporin (Aqp) mRNA, partia...	58	2e-05
260	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	58	2e-05
261	dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D...	58	2e-05
262	emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene...	58	2e-05
263	dbj|AK119719.1| Oryza sativa (japonica cultivar-group) cDNA clon...	58	2e-05
264	gb|AY107589.1| Zea mays PCO085320 mRNA sequence	58	2e-05
265	dbj|AB109206.2| Oryza sativa (japonica cultivar-group) genomic D...	58	2e-05
266	gb|L77969.2|SPIAQUA Spinacia oleracea aquaporin mRNA, complete cds	58	2e-05
267	gb|U60147.1|BVU60147 Beta vulgaris plasma membrane major intrins...	58	2e-05
268	ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0...	56	8e-05
269	gb|AY781788.1| Glycyrrhiza uralensis plasma membrane intrinsic p...	56	8e-05
270	emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B	56	8e-05
271	gb|AF452010.1|AF452010 Petunia x hybrida channel-like protein (P...	56	8e-05
272	gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr...	56	8e-05
273	gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP...	56	8e-05
274	gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl...	56	8e-05
275	gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, c...	56	8e-05
276	emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co...	56	8e-05
277	gb|AF255796.1|AF255796 Allium cepa aquaporin 2 (Aqp2) mRNA, comp...	56	8e-05
278	emb|AJ605569.1| Ricinus communis partial mRNA for putative aquap...	56	8e-05
279	emb|AJ699398.2| Chenopodium rubrum mRNA for aquaporin PIP1 (PIP1...	56	8e-05
280	gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr...	56	8e-05
281	gb|AY856055.1| Notomys alexis aquaporin 1 mRNA, partial cds	54	3e-04
282	ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channe...	54	3e-04
283	ref|NM_127238.2| Arabidopsis thaliana PIP2;8/PIP3B; water channe...	54	3e-04
284	gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (...	54	3e-04
285	gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758)...	54	3e-04
286	gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP prote...	54	3e-04
287	gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP prote...	54	3e-04
288	gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic prot...	54	3e-04
289	gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, comp...	54	3e-04
290	gb|AF218774.1|AF218774 Lycopersicon esculentum putative water ch...	54	3e-04
291	gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ...	54	3e-04
292	emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Co...	54	3e-04
293	gb|BT005214.1| Arabidopsis thaliana At2g16850 mRNA, complete cds	54	3e-04
294	gb|AY089124.1| Arabidopsis thaliana clone 36296 mRNA, complete s...	54	3e-04
295	gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete s...	54	3e-04
296	gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins...	54	3e-04
297	dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone...	54	3e-04
298	gb|AC092193.4| Bos taurus clone RP42-459A17, complete sequence	52	0.001
299	gb|AC153004.18| Medicago truncatula clone mth2-101j9, complete s...	52	0.001
300	gb|AC138580.19| Medicago truncatula clone mth2-14e15, complete s...	52	0.001
301	emb|X75881.1|ATPIP1A A.thaliana mRNA for plasma membrane intrins...	52	0.001
302	emb|AL132962.1|ATF2A19 Arabidopsis thaliana DNA chromosome 3, BA...	52	0.001
303	ref|NM_176253.1| Drosophila melanogaster CG17664-RB, transcript ...	52	0.001
304	ref|NM_137967.2| Drosophila melanogaster CG17664-RA, transcript ...	52	0.001
305	gb|AF452013.1|AF452013 Petunia x hybrida aquaporin-like protein ...	52	0.001
306	gb|AC148995.2| Medicago truncatula chromosome 7 BAC clone mth2-4...	52	0.001
307	gb|AC005639.2|AC005639 Drosophila melanogaster, chromosome 2R, r...	52	0.001
308	emb|BX824209.1|CNS0A5OV Arabidopsis thaliana Full-length cDNA Co...	52	0.001
309	gb|AY069151.1| Drosophila melanogaster GH16993 full insert cDNA	52	0.001
310	gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69...	52	0.001
311	gb|U60149.1|BVU60149 Beta vulgaris plasma membrane major intrins...	52	0.001
312	gb|U18403.1|ACU18403 Atriplex canescens aquaporin mRNA, complete...	52	0.001
313	gb|AY585335.1| Sus scrofa aquaporin-1 (AQP1) mRNA, complete cds	50	0.005
314	emb|Z83830.1|PAMIP1 P.abies mRNA for porin Mip1	50	0.005
315	emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel...	50	0.005
316	emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ...	50	0.005
317	emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B...	50	0.005
318	emb|AJ314584.1|POC314584 Posidonia oceanica mRNA for putative pl...	50	0.005
319	emb|AJ289695.1|POC289695 Posidonia oceanica partial aq2 gene for...	50	0.005
320	emb|AJ222973.1|LAAJ2973 Lupinus albus mRNA for aquaporin, partial	50	0.005
321	dbj|AB206098.1| Mimosa pudica pip1;1 mRNA for plasma membrane in...	50	0.005
322	ref|NM_214454.1| Sus scrofa aquaporin 1 (AQP1), mRNA	50	0.005
323	dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic D...	50	0.005
324	dbj|AP005108.2| Oryza sativa (japonica cultivar-group) genomic D...	50	0.005
325	gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN...	50	0.005
326	ref|NM_202760.1| Arabidopsis thaliana TMP-C AT4G00430 (TMP-C) tr...	48	0.020
327	ref|NM_116268.2| Arabidopsis thaliana TMP-C; water channel AT4G0...	48	0.020
328	ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4...	48	0.020
329	ref|XM_468463.1| Oryza sativa (japonica cultivar-group), mRNA	48	0.020
330	gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence	48	0.020
331	emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein	48	0.020
332	gb|BT000330.1| Arabidopsis thaliana probable plasma membrane int...	48	0.020
333	gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (...	48	0.020
334	emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A	48	0.020
335	gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m...	48	0.020
336	emb|AL138650.1|ATT5N23 Arabidopsis thaliana DNA chromosome 3, BA...	48	0.020
337	emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, B...	48	0.020
338	emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for p...	48	0.020
339	emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intri...	48	0.020
340	emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative trans...	48	0.020
341	gb|AY120785.1| Arabidopsis thaliana probable plasma membrane int...	48	0.020
342	gb|AY099825.1| Arabidopsis thaliana probable plasma membrane int...	48	0.020
343	gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),...	48	0.020
344	gb|BT006313.1| Arabidopsis thaliana At4g00430 mRNA, complete cds	48	0.020
345	gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein...	48	0.020
346	emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co...	48	0.020
347	emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co...	48	0.020
348	emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co...	48	0.020
349	emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co...	48	0.020
350	emb|BX827573.1|CNS0A3MW Arabidopsis thaliana Full-length cDNA Co...	48	0.020
351	emb|BX829233.1|CNS0A3FQ Arabidopsis thaliana Full-length cDNA Co...	48	0.020
352	gb|AY084470.1| Arabidopsis thaliana clone 108944 mRNA, complete ...	48	0.020
353	gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp...	48	0.020
354	dbj|AP004026.3| Oryza sativa (japonica cultivar-group) genomic D...	48	0.020
355	dbj|D85192.1| Arabidopsis thaliana mRNA for transmembrane protei...	48	0.020
356	dbj|AK102174.1| Oryza sativa (japonica cultivar-group) cDNA clon...	48	0.020
357	gb|AY107675.1| Zea mays PCO112712 mRNA sequence	48	0.020
358	dbj|D26609.1|ATHTMP Arabidopsis thaliana mRNA for transmembrane ...	48	0.020
359	dbj|AB029325.1| Oryza sativa gene for water channel protein RWC3...	48	0.020
360	dbj|AB002147.1| Nicotiana excelsior mRNA for water channel prote...	48	0.020
361	dbj|AB016623.1| Oryza sativa gene for RWC-3, complete cds	48	0.020
362	ref|NM_001003130.1| Canis familiaris aquaporin 1 (Colton blood g...	46	0.077
363	ref|NM_007472.1| Mus musculus aquaporin 1 (Aqp1), mRNA	46	0.077
364	gb|AC146187.2| Pan troglodytes BAC clone RP43-25A10 from 7, comp...	46	0.077
365	gb|BC007125.1| Mus musculus aquaporin 1, mRNA (cDNA clone MGC:56...	46	0.077
366	ref|XM_850474.1| PREDICTED: Canis familiaris aquaporin 1 (AQP1),...	46	0.077
367	emb|X67948.1|RNCHIP28 R.norvegicus mRNA for channel integral mem...	46	0.077
368	emb|X70257.1|RNCHIP28K R.norvegicus mRNA for channel integral pr...	46	0.077
369	emb|X71069.1|RNCHIPA R.norvegicus CHIP 28 mRNA	46	0.077
370	emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p...	46	0.077
371	emb|AJ515031.1|CAR515031 Cicer arietinum partial mRNA for aquopo...	46	0.077
372	dbj|AK128905.1| Mus musculus cDNA fis, clone TRACH2020336, highl...	46	0.077
373	ref|NM_012778.1| Rattus norvegicus aquaporin 1 (Aqp1), mRNA	46	0.077
374	dbj|AK158226.1| Mus musculus adult inner ear cDNA, RIKEN full-le...	46	0.077
375	dbj|AK172361.1| Mus musculus activated spleen cDNA, RIKEN full-l...	46	0.077
376	dbj|AK158389.1| Mus musculus adult inner ear cDNA, RIKEN full-le...	46	0.077
377	dbj|AK157333.1| Mus musculus activated spleen cDNA, RIKEN full-l...	46	0.077
378	dbj|AK166280.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD...	46	0.077
379	dbj|AK171627.1| Mus musculus activated spleen cDNA, RIKEN full-l...	46	0.077
380	dbj|AK081886.1| Mus musculus 16 days embryo head cDNA, RIKEN ful...	46	0.077
381	dbj|AK086688.1| Mus musculus 15 days embryo head cDNA, RIKEN ful...	46	0.077
382	gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mR...	46	0.077
383	dbj|AB206100.1| Mimosa pudica pip2;2 mRNA for plasma membrane in...	46	0.077
384	gb|AC092408.3| Papio anubis clone RP41-446H8, complete sequence	46	0.077
385	gb|AC091620.3| Papio anubis clone RP41-400H11, complete sequence	46	0.077
386	gb|AF180528.1|AF180528 Canis familiaris water channel aquaporin-...	46	0.077
387	emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene...	46	0.077
388	gb|AC005155.1|AC005155 Homo sapiens PAC clone RP5-877J2 from 7p1...	46	0.077
389	gb|AY953319.1| Homo sapiens aquaporin 1 (channel-forming integra...	46	0.077
390	gb|BC090068.1| Rattus norvegicus aquaporin 1, mRNA (cDNA clone M...	46	0.077
391	gb|U60148.1|BVU60148 Beta vulgaris plasma membrane major intrins...	46	0.077
392	gb|L02914.1|MUSGROEARB Mus musculus aquaporin-1 (AQ1) mRNA, comp...	46	0.077
393	gb|L07268.1|RATCHIP28A Rattus norvegicus water channel (CHIP28) ...	46	0.077
394	dbj|AB030695.1| Raphanus sativus PAQ1b mRNA for plasma membrane ...	46	0.077
395	dbj|AB011374.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, p...	46	0.077
396	dbj|AB011373.1| Canis familiaris aquaporin1 mRNA for AQP-CHIP, c...	46	0.077
397	gb|AY839872.1| Vitis vinifera aquaporin (TIP1;1) mRNA, complete cds	44	0.31
398	emb|AJ000031.1|CPPMIP1 Carica papaya mRNA for membrane channel p...	44	0.31
399	emb|Z93764.1|PAZ93764 P.abies mRNA for membrane intrinsic protein	44	0.31
400	emb|BX640441.1| Bordetella bronchiseptica strain RB50, complete ...	44	0.31
401	emb|BX640426.1| Bordetella parapertussis strain 12822, complete ...	44	0.31
402	emb|AJ275315.1|CAR275315 Cicer arietinum partial mRNA for putati...	44	0.31
403	gb|AF141898.1|AF141898 Vitis berlandieri x Vitis rupestris putat...	44	0.31
404	gb|AF271660.1|AF271660 Vitis berlandieri x Vitis rupestris putat...	44	0.31
405	gb|AF452011.1|AF452011 Petunia x hybrida aquaporin-like protein ...	44	0.31
406	dbj|AK222086.1| Arabidopsis thaliana mRNA for aquaporin, partial...	44	0.31
407	dbj|AB030696.1| Raphanus sativus PAQ1c mRNA for plasma membrane ...	44	0.31
408	ref|NM_105978.2| Arabidopsis thaliana water channel AT1G73190 mR...	42	1.2
409	gb|AY489268.1| Physcomitrella patens aquaporin PIP 2 mRNA, compl...	42	1.2
410	ref|NM_021818.2| Homo sapiens salvador homolog 1 (Drosophila) (S...	42	1.2
411	gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker	42	1.2
412	gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker	42	1.2
413	ref|XM_606158.2| PREDICTED: Bos taurus similar to aquaporin 6 (L...	42	1.2
414	gb|DQ018113.1| Physcomitrella patens plasma membrane aquaporin (...	42	1.2
415	gb|AC121842.3| Mus musculus BAC clone RP24-80L24 from chromosome...	42	1.2
416	gb|AY117339.1| Arabidopsis thaliana putative tonoplast intrinsic...	42	1.2
417	gb|AY064054.1| Arabidopsis thaliana putative tonoplast intrinsic...	42	1.2
418	emb|X63551.1|ATATIPARA A.thaliana gene for tonoplast intrinsic p...	42	1.2
419	dbj|AK023071.1| Homo sapiens cDNA FLJ13009 fis, clone NT2RP3000487	42	1.2
420	gb|AC010556.6|AC010556 Arabidopsis thaliana chromosome 1 BAC T18...	42	1.2
421	emb|BX818487.1|CNS0AB8P Arabidopsis thaliana Full-length cDNA Co...	42	1.2
422	emb|BX817607.1|CNS0AB8S Arabidopsis thaliana Full-length cDNA Co...	42	1.2
423	gb|AY995196.1| Phaseolus vulgaris putative aquaporin (PIP1;2) mR...	42	1.2
424	gb|AC091759.2| Sus scrofa clone RP44-484M10, complete sequence	42	1.2
425	emb|AL606834.1|CNS07EGV Human chromosome 14 DNA sequence BAC R-2...	42	1.2
426	emb|CT010588.10| Mouse DNA sequence from clone RP23-150H18 on ch...	42	1.2
427	gb|AF067184.1|AF067184 Samanea saman aquaporin 1 (Aqp1) mRNA, co...	42	1.2
428	gb|DQ294252.1| Solanum tuberosum clone 068H03 plasma membrane in...	42	1.2
429	gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ...	42	1.2
430	gb|L36095.1|CIPMIPA Mesembryanthemum crystallinum mipA mRNA, com...	42	1.2
431	gb|AC115744.9| Mus musculus chromosome 12, clone RP23-479M19, co...	42	1.2
432	emb|AL833378.1|HSM804691 Homo sapiens mRNA; cDNA DKFZp667J2214 (...	42	1.2
433	gb|M84343.1|ATHATIP Arabidopsis thaliana tonoplast intrinsic pro...	42	1.2
434	dbj|AB012044.1| Raphanus sativus mRNA for plasma membrane aquapo...	42	1.2
435	ref|XM_509051.1| PREDICTED: Pan troglodytes similar to aquaporin...	40	4.8
436	ref|XM_470514.1| Oryza sativa (japonica cultivar-group), mRNA	40	4.8
437	gb|AC120539.4| Oryza sativa (japonica cultivar-group) chromosome...	40	4.8
438	gb|AY725511.1| Lycopersicon esculentum putative aquaporin PIP-ty...	40	4.8
439	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	40	4.8
440	gb|AF000191.1| Caenorhabditis elegans cosmid T23C6, complete seq...	40	4.8
441	gb|BC065275.1| Homo sapiens aquaporin 6, kidney specific, mRNA (...	40	4.8
442	emb|CR931997.1| Corynebacterium jeikeium K411 complete genome	40	4.8
443	ref|XM_750476.1| Aspergillus fumigatus Af293 hypothetical protei...	40	4.8
444	gb|AE014075.1| Escherichia coli CFT073, complete genome	40	4.8
445	emb|X62873.1|PVTIP P.vulgaris mRNA for tonoplast intrinsic protein	40	4.8
446	emb|AL589844.4| Human DNA sequence from clone RP11-436F21 on chr...	40	4.8
447	emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein	40	4.8
448	emb|X16399.1|XXGDH Gene for glutamate dehydrogenase (EC 1.4.1.4)...	40	4.8
449	gb|AC092263.7| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom...	40	4.8
450	emb|AJ243307.1|PSA243307 Pisum sativum mRNA for putative plasma ...	40	4.8
451	emb|AJ001293.1|CPPIPB Craterostigma plantagineum mRNA for major ...	40	4.8
452	gb|AC092436.5| Homo sapiens BAC clone RP11-302F12 from 4, comple...	40	4.8
453	gb|AF141899.1|AF141899 Vitis berlandieri x Vitis rupestris putat...	40	4.8
454	ref|NM_001652.3| Homo sapiens aquaporin 6, kidney specific (AQP6...	40	4.8
455	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	40	4.8
456	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	40	4.8
457	dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane in...	40	4.8
458	gb|AC091059.12| Homo sapiens chromosome 17, clone RP11-567L7, co...	40	4.8
459	gb|AF188844.1|AF188844 Vitis vinifera cultivar Pinot Noir plasma...	40	4.8
460	dbj|AK109024.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	4.8
461	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	40	4.8
462	gb|U48408.1|HSU48408 Human kidney water channel (hKID) mRNA, com...	40	4.8
463	gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, co...	40	4.8
464	gb|AC021573.10| Homo sapiens chromosome 11, clone RP11-411D10, c...	40	4.8
465	dbj|AB024534.1| Rattus norvegicus gene for thiazide-sensitive Na...	40	4.8

---

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score =  280 bits (141), Expect = 3e-72
 Identities = 180/193 (93%)
 Strand = Plus / Minus

                                                                       
Query: 167 ccgaaggaggcagacgagccaagcttggtggcactcgccctcaggacgtactggtggtag 226
           |||||||||||||||||||| | ||||||||| || |||||||| |||||||||||||| 
Sbjct: 936 ccgaaggaggcagacgagccgaacttggtggcgctggccctcagcacgtactggtggtac 877

                                                                       
Query: 227 gcggcggcaatggcggctccgatgaatggccccacccagaagatccagtggtcatcccag 286
             |||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 876 aaggcggcgatggcggccccgatgaatggccccacccagaacatccagtggtcatcccag 817

                                                                       
Query: 287 gccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtg 346
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 816 gccttctcgttgttgtagatcacggcagctccgaagctcctcgccgggttgatgccggtg 757

                        
Query: 347 ccggtgattggga 359
           |||||||| ||||
Sbjct: 756 ccggtgatcggga 744

---

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score =  236 bits (119), Expect = 4e-59
 Identities = 173/191 (90%)
 Strand = Plus / Minus

                                                                       
Query: 169 gaaggaggcagacgagccaagcttggtggcactcgccctcaggacgtactggtggtaggc 228
           ||||||||||||||| || ||||||| ||| || |||||||| |||||||||||||| ||
Sbjct: 852 gaaggaggcagacgatcccagcttggcggcgctggccctcagcacgtactggtggtacgc 793

                                                                       
Query: 229 ggcggcaatggcggctccgatgaatggccccacccagaagatccagtggtcatcccaggc 288
            ||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 792 cgcggcgatggcggcgccgatgaatggacccacccagaagatccagtggtcatcccaggc 733

                                                                       
Query: 289 cttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgcc 348
           ||| |||||||||||||| || ||||| || |||||||| ||||||||||||||||||||
Sbjct: 732 cttgtcgttgttgtagatgacagcagcgcccaagctcctggccgggttgatgccggtgcc 673

                      
Query: 349 ggtgattggga 359
           |||||| ||||
Sbjct: 672 ggtgatgggga 662

---

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score =  236 bits (119), Expect = 4e-59
 Identities = 173/191 (90%)
 Strand = Plus / Minus

                                                                       
Query: 169 gaaggaggcagacgagccaagcttggtggcactcgccctcaggacgtactggtggtaggc 228
           ||||||||||||||| || ||||||| ||| || |||||||| |||||||||||||| ||
Sbjct: 907 gaaggaggcagacgatcccagcttggcggcgctggccctcagcacgtactggtggtacgc 848

                                                                       
Query: 229 ggcggcaatggcggctccgatgaatggccccacccagaagatccagtggtcatcccaggc 288
            ||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 847 cgcggcgatggcggcgccgatgaatggacccacccagaagatccagtggtcatcccaggc 788

                                                                       
Query: 289 cttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgcc 348
           ||| |||||||||||||| || ||||| || |||||||| ||||||||||||||||||||
Sbjct: 787 cttgtcgttgttgtagatgacagcagcgcccaagctcctggccgggttgatgccggtgcc 728

                      
Query: 349 ggtgattggga 359
           |||||| ||||
Sbjct: 727 ggtgatgggga 717

---

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score =  220 bits (111), Expect = 2e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 169 gaaggaggcagacgagccaagcttggtggcactcgccctcaggacgtactggtggtaggc 228
           ||||||||  || ||||| ||||||| ||| || ||||||||||||||||||||||||||
Sbjct: 864 gaaggaggaggaagagccgagcttggcggcgctggccctcaggacgtactggtggtaggc 805

                                                                       
Query: 229 ggcggcaatggcggctccgatgaatggccccacccagaagatccagtggtcatcccaggc 288
           |||||| |||||||| |||||||  |||||||||||||||||||||||||||| ||| ||
Sbjct: 804 ggcggcgatggcggcgccgatgaggggccccacccagaagatccagtggtcatgccatgc 745

                                                                       
Query: 289 cttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgcc 348
           ||| |  | |||||||||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 744 cttgtgctggttgtagatcaccgcagctcccaagctccttgccgggttgatgccggtgcc 685

                      
Query: 349 ggtgattggga 359
           |||||| ||||
Sbjct: 684 ggtgatcggga 674

---

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score =  198 bits (100), Expect = 9e-48
 Identities = 154/172 (89%)
 Strand = Plus / Minus

                                                                       
Query: 188 agcttggtggcactcgccctcaggacgtactggtggtaggcggcggcaatggcggctccg 247
           ||||||| ||| || |||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 883 agcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccg 824

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           || |  |||||||||||||||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 823 atcagcggccccacccagaagatccattggtcatcccaggccttgtctttgttgtagatg 764

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || |||||||| ||||| || |||||||||||||||||||||||||| ||||
Sbjct: 763 acagcagctcccaagcttctcgccgggttgatgccggtgccggtgatgggga 712

---

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  190 bits (96), Expect = 2e-45
 Identities = 153/172 (88%)
 Strand = Plus / Minus

                                                                       
Query: 188 agcttggtggcactcgccctcaggacgtactggtggtaggcggcggcaatggcggctccg 247
           ||||||||||| || || ||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 919 agcttggtggcgctggctctcagcacgtactggtggtaggcggcggcgatggcggcgccg 860

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           || | ||| ||||||||||||||||| ||||| ||||||||||| || ||||||||||| 
Sbjct: 859 atcagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatg 800

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || || ||||| |||||||| |||||||||||||||||||||||||| ||||
Sbjct: 799 accgcggctcccaagctcctcgccgggttgatgccggtgccggtgatgggga 748

---

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score =  190 bits (96), Expect = 2e-45
 Identities = 153/172 (88%)
 Strand = Plus / Minus

                                                                       
Query: 188 agcttggtggcactcgccctcaggacgtactggtggtaggcggcggcaatggcggctccg 247
           ||||||| ||| || |||||||| || ||||||||||||||||||||||||||||| |||
Sbjct: 971 agcttggcggcgctggccctcagcacatactggtggtaggcggcggcaatggcggcgccg 912

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           || | ||||||||||||||||||||| ||||||||||||||||| ||  |||||||||| 
Sbjct: 911 atcagtggccccacccagaagatccattggtcatcccaggccttgtcagtgttgtagatg 852

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || |||||||| ||||| || || ||||||||||||||||||||||| ||||
Sbjct: 851 acagcagctcccaagcttctcgcggggttgatgccggtgccggtgatgggga 800

---

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  190 bits (96), Expect = 2e-45
 Identities = 153/172 (88%)
 Strand = Plus / Minus

                                                                       
Query: 188 agcttggtggcactcgccctcaggacgtactggtggtaggcggcggcaatggcggctccg 247
           ||||||||||| || || ||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 347 agcttggtggcgctggctctcagcacgtactggtggtaggcggcggcgatggcggcgccg 288

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           || | ||| ||||||||||||||||| ||||| ||||||||||| || ||||||||||| 
Sbjct: 287 atcagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatg 228

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || || ||||| |||||||| |||||||||||||||||||||||||| ||||
Sbjct: 227 accgcggctcccaagctcctcgccgggttgatgccggtgccggtgatgggga 176



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 121/145 (83%)
 Strand = Plus / Minus

                                                                        
Query: 209  aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
            |||| |||||||||||||  ||| || ||||| || || | ||  || ||||||||||| 
Sbjct: 1599 aggatgtactggtggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaa 1540

                                                                        
Query: 269  atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
            ||||||||||||||||| | ||| || ||||||||||  ||||| || || | |||||| 
Sbjct: 1539 atccagtggtcatcccatggcttgtccttgttgtagacgacggcggcgcccaggctcctg 1480

                                     
Query: 329  gccgggttgatgccggtgccggtga 353
            |||||||||||||||||||||||||
Sbjct: 1479 gccgggttgatgccggtgccggtga 1455

---

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score =  190 bits (96), Expect = 2e-45
 Identities = 153/172 (88%)
 Strand = Plus / Minus

                                                                       
Query: 188 agcttggtggcactcgccctcaggacgtactggtggtaggcggcggcaatggcggctccg 247
           ||||||| ||| || |||||||| || ||||||||||||||||||||||||||||| |||
Sbjct: 891 agcttggcggcgctggccctcagcacatactggtggtaggcggcggcaatggcggcgccg 832

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           || | ||||||||||||||||||||| ||||||||||||||||| ||  |||||||||| 
Sbjct: 831 atcagtggccccacccagaagatccattggtcatcccaggccttgtcagtgttgtagatg 772

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || |||||||| ||||| || || ||||||||||||||||||||||| ||||
Sbjct: 771 acagcagctcccaagcttctcgcggggttgatgccggtgccggtgatgggga 720

---

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  182 bits (92), Expect = 5e-43
 Identities = 152/172 (88%)
 Strand = Plus / Minus

                                                                       
Query: 188 agcttggtggcactcgccctcaggacgtactggtggtaggcggcggcaatggcggctccg 247
           ||||||||||| || |||||||| ||||||||||||||||||||||| |||||||| || 
Sbjct: 929 agcttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgcca 870

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           || | ||| ||||||||||||||||| ||||| ||||||||||| || ||||||||||| 
Sbjct: 869 atcagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatg 810

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || || ||||| | |||||| |||||||||||||||||||||||||| ||||
Sbjct: 809 accgcggctcccaggctcctcgccgggttgatgccggtgccggtgatgggga 758

---

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score =  174 bits (88), Expect = 1e-40
 Identities = 151/172 (87%)
 Strand = Plus / Minus

                                                                       
Query: 188 agcttggtggcactcgccctcaggacgtactggtggtaggcggcggcaatggcggctccg 247
           ||||||| ||| || |||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 909 agcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccg 850

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           || |  || ||||||||||||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 849 atcagggggcccacccagaagatccattggtcatcccaggccttgtccttgttgtagata 790

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || || | ||| |||||||| |||||||| ||||||||||||||||| ||||
Sbjct: 789 accgcggttcccaagctcctcgccgggttaatgccggtgccggtgatgggga 738

---

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score =  174 bits (88), Expect = 1e-40
 Identities = 151/172 (87%)
 Strand = Plus / Minus

                                                                       
Query: 188 agcttggtggcactcgccctcaggacgtactggtggtaggcggcggcaatggcggctccg 247
           ||||||| ||| || |||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 909 agcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccg 850

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           || |  || ||||||||||||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 849 atcagggggcccacccagaagatccattggtcatcccaggccttgtccttgttgtagata 790

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || || | ||| |||||||| |||||||| ||||||||||||||||| ||||
Sbjct: 789 accgcggttcccaagctcctcgccgggttaatgccggtgccggtgatgggga 738

---

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score =  172 bits (87), Expect = 5e-40
 Identities = 147/167 (88%)
 Strand = Plus / Minus

                                                                       
Query: 188 agcttggtggcactcgccctcaggacgtactggtggtaggcggcggcaatggcggctccg 247
           ||||||||||| || |||||||| ||||||||||||||||||||||| |||||||| || 
Sbjct: 937 agcttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgcca 878

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           || | ||| ||||||||||||||||| ||||| ||||||||||| || ||||||||||| 
Sbjct: 877 atcagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatg 818

                                                          
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
           || || ||||| | | |||| ||||||||||||||||||||||||||
Sbjct: 817 accgcggctcccaggatcctcgccgggttgatgccggtgccggtgat 771

---

>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds
          Length = 901

 Score =  143 bits (72), Expect = 4e-31
 Identities = 123/140 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 tactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccag 274
           ||||||||||||   || |||||||| ||||| |||||||| || |||||||| ||||| 
Sbjct: 813 tactggtggtagaatgcagcaatggcagctccaatgaatggtccgacccagaacatccaa 754

                                                                       
Query: 275 tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccggg 334
           ||||||||||||||||| |||||||| ||||| || |||||||||||||| || ||||||
Sbjct: 753 tggtcatcccaggccttgtcgttgttatagatgacagcagctccgaagcttctagccggg 694

                               
Query: 335 ttgatgccggtgccggtgat 354
           ||||| ||||||||||||||
Sbjct: 693 ttgataccggtgccggtgat 674

---

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score =  125 bits (63), Expect = 1e-25
 Identities = 129/151 (85%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||   || || |||||||| |||| ||| || || |||||||||
Sbjct: 931 aggatgtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaag 872

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||| ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| 
Sbjct: 871 atccaatggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctg 812

                                          
Query: 329 gccgggttgatgccggtgccggtgattggga 359
           |||||||||||||||||||||||||| ||||
Sbjct: 811 gccgggttgatgccggtgccggtgatcggga 781

---

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score =  125 bits (63), Expect = 1e-25
 Identities = 129/151 (85%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||   || || |||||||| |||| ||| || || |||||||||
Sbjct: 933 aggatgtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaag 874

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||| ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| 
Sbjct: 873 atccaatggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctg 814

                                          
Query: 329 gccgggttgatgccggtgccggtgattggga 359
           |||||||||||||||||||||||||| ||||
Sbjct: 813 gccgggttgatgccggtgccggtgatcggga 783

---

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score =  125 bits (63), Expect = 1e-25
 Identities = 129/151 (85%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||   || || |||||||| |||| ||| || || |||||||||
Sbjct: 934 aggatgtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaag 875

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||| ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| 
Sbjct: 874 atccaatggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctg 815

                                          
Query: 329 gccgggttgatgccggtgccggtgattggga 359
           |||||||||||||||||||||||||| ||||
Sbjct: 814 gccgggttgatgccggtgccggtgatcggga 784

---

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score =  125 bits (63), Expect = 1e-25
 Identities = 129/151 (85%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||   || || |||||||| |||| ||| || || |||||||||
Sbjct: 931 aggatgtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaag 872

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||| ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| 
Sbjct: 871 atccaatggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctg 812

                                          
Query: 329 gccgggttgatgccggtgccggtgattggga 359
           |||||||||||||||||||||||||| ||||
Sbjct: 811 gccgggttgatgccggtgccggtgatcggga 781

---

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score =  125 bits (63), Expect = 1e-25
 Identities = 129/151 (85%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||   || || |||||||| |||| ||| || || |||||||||
Sbjct: 525 aggatgtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaag 466

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||| ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| 
Sbjct: 465 atccaatggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctg 406

                                          
Query: 329 gccgggttgatgccggtgccggtgattggga 359
           |||||||||||||||||||||||||| ||||
Sbjct: 405 gccgggttgatgccggtgccggtgatcggga 375

---

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score =  125 bits (63), Expect = 1e-25
 Identities = 129/151 (85%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||   || || |||||||| |||| ||| || || |||||||||
Sbjct: 931 aggatgtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaag 872

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||| ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| 
Sbjct: 871 atccaatggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctg 812

                                          
Query: 329 gccgggttgatgccggtgccggtgattggga 359
           |||||||||||||||||||||||||| ||||
Sbjct: 811 gccgggttgatgccggtgccggtgatcggga 781

---

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score =  125 bits (63), Expect = 1e-25
 Identities = 129/151 (85%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||   || || |||||||| |||| ||| || || |||||||||
Sbjct: 933 aggatgtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaag 874

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||| ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| 
Sbjct: 873 atccaatggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctg 814

                                          
Query: 329 gccgggttgatgccggtgccggtgattggga 359
           |||||||||||||||||||||||||| ||||
Sbjct: 813 gccgggttgatgccggtgccggtgatcggga 783

---

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score =  125 bits (63), Expect = 1e-25
 Identities = 129/151 (85%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||   || || |||||||| |||| ||| || || |||||||||
Sbjct: 934 aggatgtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaag 875

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||| ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| 
Sbjct: 874 atccaatggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctg 815

                                          
Query: 329 gccgggttgatgccggtgccggtgattggga 359
           |||||||||||||||||||||||||| ||||
Sbjct: 814 gccgggttgatgccggtgccggtgatcggga 784

---

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score =  125 bits (63), Expect = 1e-25
 Identities = 129/151 (85%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||   || || |||||||| |||| ||| || || |||||||||
Sbjct: 921 aggatgtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaag 862

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||| ||||  | ||| ||||||||||||||| |||| ||||| ||||||| |||||| 
Sbjct: 861 atccaatggttgtgccacgccttctcgttgttgaagatgacggccgctccgatgctcctg 802

                                          
Query: 329 gccgggttgatgccggtgccggtgattggga 359
           |||||||||||||||||||||||||| ||||
Sbjct: 801 gccgggttgatgccggtgccggtgatcggga 771

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  121 bits (61), Expect = 2e-24
 Identities = 94/105 (89%)
 Strand = Plus / Minus

                                                                            
Query: 169      gaaggaggcagacgagccaagcttggtggcactcgccctcaggacgtactggtggtaggc 228
                ||||||||  || ||||| ||||||| ||| || ||||||||||||||||||||||||||
Sbjct: 26074856 gaaggaggaggaagagccgagcttggcggcgctggccctcaggacgtactggtggtaggc 26074797

                                                             
Query: 229      ggcggcaatggcggctccgatgaatggccccacccagaagatcca 273
                |||||| |||||||| |||||||  ||||||||||||||||||||
Sbjct: 26074796 ggcggcgatggcggcgccgatgaggggccccacccagaagatcca 26074752



 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                            
Query: 298      gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
                |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||
Sbjct: 26074218 gttgtagatcaccgcagctcccaagctccttgccgggttgatgccggtgccggtgatcgg 26074159

                  
Query: 358      ga 359
                ||
Sbjct: 26074158 ga 26074157



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                            
Query: 297      tgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattg 356
                |||||||||| | |||||| || | |||||| || ||||||||||||||||||||||| |
Sbjct: 28020774 tgttgtagatgatggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatgg 28020715

                   
Query: 357      gga 359
                |||
Sbjct: 28020714 gga 28020712



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                           
Query: 274     gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgg 333
               |||||| ||||| |||||||  | ||||||||| ||||| || |||| |||||  || ||
Sbjct: 8906894 gtggtcgtcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagg 8906953

                                         
Query: 334     gttgatgccggtgccggtgattggga 359
               ||||||||| ||||||||||| ||||
Sbjct: 8906954 gttgatgcccgtgccggtgatgggga 8906979



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                               
Query: 242     gctccgatgaatggccccacccagaagatcca 273
               ||||||||||| |||||| |||||||||||||
Sbjct: 8906779 gctccgatgaacggccccgcccagaagatcca 8906810

---

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score =  121 bits (61), Expect = 2e-24
 Identities = 94/105 (89%)
 Strand = Plus / Minus

                                                                          
Query: 169    gaaggaggcagacgagccaagcttggtggcactcgccctcaggacgtactggtggtaggc 228
              ||||||||  || ||||| ||||||| ||| || ||||||||||||||||||||||||||
Sbjct: 109183 gaaggaggaggaagagccgagcttggcggcgctggccctcaggacgtactggtggtaggc 109124

                                                           
Query: 229    ggcggcaatggcggctccgatgaatggccccacccagaagatcca 273
              |||||| |||||||| |||||||  ||||||||||||||||||||
Sbjct: 109123 ggcggcgatggcggcgccgatgaggggccccacccagaagatcca 109079



 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 59/62 (95%)
 Strand = Plus / Minus

                                                                          
Query: 298    gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
              |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||
Sbjct: 108545 gttgtagatcaccgcagctcccaagctccttgccgggttgatgccggtgccggtgatcgg 108486

                
Query: 358    ga 359
              ||
Sbjct: 108485 ga 108484

---

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score =  119 bits (60), Expect = 6e-24
 Identities = 99/112 (88%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| ||||||||||||||||| |||||||||||||| ||||  | |||| |||| 
Sbjct: 826 atgaatggtcccacccagaagatccaatggtcatcccaggctttctgttggttgaagata 767

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || ||||||||||  ||||| ||||||||||||||||||||||||| |||||
Sbjct: 766 acagcagctccgagactcctggccgggttgatgccggtgccggtgactggga 715

---

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score =  119 bits (60), Expect = 6e-24
 Identities = 99/112 (88%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| || |||||||| ||||| || ||||||||||||||||  | ||||||||||
Sbjct: 850 atgaatggtccaacccagaaaatccaatgatcatcccaggccttctgttggttgtagatc 791

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           |||||||||||||| || || || ||||||||||| ||||||||||||||||
Sbjct: 790 acggcagctccgaaacttctagctgggttgatgccagtgccggtgattggga 739

---

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score =  119 bits (60), Expect = 6e-24
 Identities = 99/112 (88%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| || |||||||| ||||| || ||||||||||||||||  | ||||||||||
Sbjct: 366 atgaatggtccaacccagaaaatccaatgatcatcccaggccttctgttggttgtagatc 307

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           |||||||||||||| || || || ||||||||||| ||||||||||||||||
Sbjct: 306 acggcagctccgaaacttctagctgggttgatgccagtgccggtgattggga 255

---

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score =  117 bits (59), Expect = 3e-23
 Identities = 110/127 (86%)
 Strand = Plus / Minus

                                                                       
Query: 233 gcaatggcggctccgatgaatggccccacccagaagatccagtggtcatcccaggccttc 292
           ||||| ||||| || ||||| ||||| |||||||||||||| ||||||||||| ||||| 
Sbjct: 833 gcaattgcggccccaatgaaaggcccgacccagaagatccaatggtcatcccatgccttg 774

                                                                       
Query: 293 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 352
           || | |||||| ||||| |||||||| |||||||| ||||||||||| || || ||||||
Sbjct: 773 tcttcgttgtatatcacagcagctccaaagctcctagccgggttgataccagttccggtg 714

                  
Query: 353 attggga 359
           |||||||
Sbjct: 713 attggga 707

---

>ref|NM_129273.3| Arabidopsis thaliana PIP2B; water channel AT2G37170 (PIP2B) mRNA,
           complete cds
          Length = 1143

 Score =  115 bits (58), Expect = 1e-22
 Identities = 102/114 (89%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| | ||| ||| |||||
Sbjct: 833 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 775

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
            ||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 774 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgat 721

---

>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.3 gene)
          Length = 1187

 Score =  115 bits (58), Expect = 1e-22
 Identities = 88/98 (89%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||| ||||||||||||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                                                 
Query: 320 aagctccttgccgggttgatgccggtgccggtgattgg 357
           |||||||| || |||||||| || || |||||||||||
Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattgg 703

---

>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic
           protein 1 (mip1 gene)
          Length = 1187

 Score =  115 bits (58), Expect = 1e-22
 Identities = 88/98 (89%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||| ||||||||||||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagatcaccgcagctccg 741

                                                 
Query: 320 aagctccttgccgggttgatgccggtgccggtgattgg 357
           |||||||| || |||||||| || || |||||||||||
Sbjct: 740 aagctcctagcagggttgataccagtaccggtgattgg 703

---

>emb|BX818826.1|CNS0A9YK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB17ZB02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1041

 Score =  115 bits (58), Expect = 1e-22
 Identities = 102/114 (89%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| | ||| ||| |||||
Sbjct: 818 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 760

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
            ||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 759 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgat 706

---

>emb|BX820743.1|CNS0A9N0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH65ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1079

 Score =  115 bits (58), Expect = 1e-22
 Identities = 102/114 (89%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| | ||| ||| |||||
Sbjct: 818 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 760

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
            ||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 759 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgat 706

---

>emb|BX820621.1|CNS0A9PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZA12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score =  115 bits (58), Expect = 1e-22
 Identities = 102/114 (89%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| | ||| ||| |||||
Sbjct: 809 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 751

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
            ||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 750 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgat 697

---

>emb|BX820573.1|CNS0A9O0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH49ZD05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1074

 Score =  115 bits (58), Expect = 1e-22
 Identities = 102/114 (89%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| | ||| ||| |||||
Sbjct: 818 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 760

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
            ||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 759 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgat 706

---

>emb|BX820548.1|CNS0A9HO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH47ZD11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1095

 Score =  115 bits (58), Expect = 1e-22
 Identities = 102/114 (89%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| | ||| ||| |||||
Sbjct: 818 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 760

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
            ||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 759 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgat 706

---

>emb|BX819847.1|CNS0A9GD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS38ZC08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 821

 Score =  115 bits (58), Expect = 1e-22
 Identities = 102/114 (89%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| | ||| ||| |||||
Sbjct: 510 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 452

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
            ||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 451 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgat 398

---

>emb|BX820418.1|CNS0A81D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1083

 Score =  115 bits (58), Expect = 1e-22
 Identities = 102/114 (89%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| | ||| ||| |||||
Sbjct: 819 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 761

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
            ||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 760 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgat 707

---

>gb|AY086460.1| Arabidopsis thaliana clone 25220 mRNA, complete sequence
          Length = 1104

 Score =  115 bits (58), Expect = 1e-22
 Identities = 102/114 (89%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| | ||| ||| |||||
Sbjct: 834 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 776

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
            ||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 775 atagattacggcagctccgaaactcctagccgggttgatgccggttccggtgat 722

---

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score =  113 bits (57), Expect = 4e-22
 Identities = 123/145 (84%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||  ||| || ||||| || || | ||  || ||||||||||||
Sbjct: 877 aggatgtactggtggtagaaggccgcgatggcagcgcccacgagggggcccacccagaag 818

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||||||||| ||||||| ||| || ||||||||||| ||||| || || | |||||| 
Sbjct: 817 atccagtggtcgtcccagggcttgtccttgttgtagatgacggcggcgcccaggctcctg 758

                                    
Query: 329 gccgggttgatgccggtgccggtga 353
           |||||||||||||||||||||||||
Sbjct: 757 gccgggttgatgccggtgccggtga 733

---

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score =  113 bits (57), Expect = 4e-22
 Identities = 123/145 (84%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||  ||| || ||||| || || | ||  || ||||||||||||
Sbjct: 825 aggatgtactggtggtagaaggccgcgatggcagcgcccacgagagggcccacccagaag 766

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||||||||| ||||||| ||| || ||||||||||| ||||| || || | |||||| 
Sbjct: 765 atccagtggtcgtcccagggcttgtccttgttgtagatgacggcggcgcccaggctcctg 706

                                    
Query: 329 gccgggttgatgccggtgccggtga 353
           |||||||||||||||||||||||||
Sbjct: 705 gccgggttgatgccggtgccggtga 681

---

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score =  113 bits (57), Expect = 4e-22
 Identities = 123/145 (84%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||  ||| || ||||| || || | ||  || ||||||||||||
Sbjct: 896 aggatgtactggtggtagaaggccgcgatggcagcgcccacgagagggcccacccagaag 837

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||||||||| ||||||| ||| || ||||||||||| ||||| || || | |||||| 
Sbjct: 836 atccagtggtcgtcccagggcttgtccttgttgtagatgacggcggcgcccaggctcctg 777

                                    
Query: 329 gccgggttgatgccggtgccggtga 353
           |||||||||||||||||||||||||
Sbjct: 776 gccgggttgatgccggtgccggtga 752

---

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score =  109 bits (55), Expect = 6e-21
 Identities = 118/139 (84%)
 Strand = Plus / Minus

                                                                       
Query: 216 actggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagt 275
           |||||||||||  ||| |||||||| || || ||||| || || ||||| |||||||| |
Sbjct: 868 actggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagatccact 809

                                                                       
Query: 276 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 335
           ||||||||||||||||||| ||||||||||| || ||||| || || ||||| || ||||
Sbjct: 808 ggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggcagggt 749

                              
Query: 336 tgatgccggtgccggtgat 354
           |||| |||||||| |||||
Sbjct: 748 tgataccggtgccagtgat 730

---

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score =  109 bits (55), Expect = 6e-21
 Identities = 100/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||||||| ||||| |||||||||||||| || |||  ||||||||| | ||||||||||
Sbjct: 873 ccgatgaacggcccaacccagaagatccactgatcactccaggccttgttgttgttgtag 814

                                                                  
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           | ||||||  | |||| |||||| |||||||||||||||||||||||||| ||||
Sbjct: 813 accacggcgacgccgaggctcctggccgggttgatgccggtgccggtgatcggga 759

---

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score =  109 bits (55), Expect = 6e-21
 Identities = 118/139 (84%)
 Strand = Plus / Minus

                                                                       
Query: 216 actggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagt 275
           |||||||||||  ||| |||||||| || || ||||| || || ||||| |||||||| |
Sbjct: 864 actggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagatccact 805

                                                                       
Query: 276 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 335
           ||||||||||||||||||| ||||||||||| || ||||| || || ||||| || ||||
Sbjct: 804 ggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggcagggt 745

                              
Query: 336 tgatgccggtgccggtgat 354
           |||| |||||||| |||||
Sbjct: 744 tgataccggtgccagtgat 726

---

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score =  109 bits (55), Expect = 6e-21
 Identities = 127/151 (84%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||   || || |||||||| |||| ||| || || |||||||||
Sbjct: 497 aggatgtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaag 438

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||| ||||  | ||||||||||||||||||| |||| ||||| | ||||  | |||| 
Sbjct: 437 atccattggttgtgccaggccttctcgttgttgaagatgacggccggtccggtggtcctg 378

                                          
Query: 329 gccgggttgatgccggtgccggtgattggga 359
           |||||||||||||||||||||||||| ||||
Sbjct: 377 gccgggttgatgccggtgccggtgatcggga 347

---

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score =  109 bits (55), Expect = 6e-21
 Identities = 100/115 (86%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||||||| ||||| |||||||||||||| || |||  ||||||||| | ||||||||||
Sbjct: 873 ccgatgaacggcccaacccagaagatccactgatcactccaggccttgttgttgttgtag 814

                                                                  
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           | ||||||  | |||| |||||| |||||||||||||||||||||||||| ||||
Sbjct: 813 accacggcgacgccgaggctcctggccgggttgatgccggtgccggtgatcggga 759

---

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score =  107 bits (54), Expect = 2e-20
 Identities = 102/118 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||||||||| |||||| ||||||||||||||||||| ||||| |||||||  | ||||
Sbjct: 761 gctccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttg 702

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| ||||| || |||| |||||  || ||||||||||| ||||||||||| ||||
Sbjct: 701 tagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatgggga 644

---

>emb|AJ001294.1|CPPIPC Craterostigma plantagineum mRNA for major intrinsic protein PIPc
          Length = 800

 Score =  107 bits (54), Expect = 2e-20
 Identities = 96/110 (87%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||| ||||||||| |||||||| ||||| ||||||||||| || ||  |||||||| ||
Sbjct: 516 ccgaggaatggcccaacccagaaaatccaatggtcatcccaagcttttccgttgttgaag 457

                                                             
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
           |||||||| || ||||||||||| |||||||| || ||||||||||||||
Sbjct: 456 atcacggcggcgccgaagctcctcgccgggttaatcccggtgccggtgat 407

---

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score =  107 bits (54), Expect = 2e-20
 Identities = 102/118 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||||||||| |||||| ||||||||||||||||||| ||||| |||||||  | ||||
Sbjct: 747 gctccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttg 688

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| ||||| || |||| |||||  || ||||||||||| ||||||||||| ||||
Sbjct: 687 tagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatgggga 630

---

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score =  107 bits (54), Expect = 2e-20
 Identities = 102/118 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||||||||| |||||| ||||||||||||||||||| ||||| |||||||  | ||||
Sbjct: 860 gctccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttg 801

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| ||||| || |||| |||||  || ||||||||||| ||||||||||| ||||
Sbjct: 800 tagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatgggga 743

---

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score =  107 bits (54), Expect = 2e-20
 Identities = 102/118 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||||||||| |||||| ||||||||||||||||||| ||||| |||||||  | ||||
Sbjct: 854 gctccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttg 795

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| ||||| || |||| |||||  || ||||||||||| ||||||||||| ||||
Sbjct: 794 tagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatgggga 737

---

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score =  107 bits (54), Expect = 2e-20
 Identities = 102/118 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||||||||| |||||| ||||||||||||||||||| ||||| |||||||  | ||||
Sbjct: 848 gctccgatgaacggccccgcccagaagatccagtggtcgtcccatgccttcttctggttg 789

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| ||||| || |||| |||||  || ||||||||||| ||||||||||| ||||
Sbjct: 788 tagatgacggcggcgccgatgctccgggcagggttgatgcccgtgccggtgatgggga 731

---

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score =  107 bits (54), Expect = 2e-20
 Identities = 111/130 (85%)
 Strand = Plus / Minus

                                                                       
Query: 230 gcggcaatggcggctccgatgaatggccccacccagaagatccagtggtcatcccaggcc 289
           ||||||||||| || || |  ||||| || |||||||||||||| ||||||||||| |||
Sbjct: 776 gcggcaatggcagcaccaacaaatggtccaacccagaagatccactggtcatcccatgcc 717

                                                                       
Query: 290 ttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccg 349
           || || |||||||| || || ||||||||||| ||||| || |||||||| |||||||||
Sbjct: 716 ttgtccttgttgtaaattacagcagctccgaaactcctggctgggttgataccggtgccg 657

                     
Query: 350 gtgattggga 359
           || |||||||
Sbjct: 656 gtaattggga 647

---

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score =  105 bits (53), Expect = 1e-19
 Identities = 98/113 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||||||||||||||| |||||||| |||||||| |||||||| ||||| |||  ||||
Sbjct: 843 gctccgatgaatggcccgacccagaaaatccagtgttcatcccacgccttgtcgccgttg 784

                                                                
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
            | |||||||| || ||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 783 aaaatcacggccgccccgaaactcctcgccgggttgattccggtaccggtgat 731

---

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1283

 Score =  105 bits (53), Expect = 1e-19
 Identities = 131/157 (83%)
 Strand = Plus / Minus

                                                                       
Query: 203 gccctcaggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacc 262
           ||||| |||| |||||||||||||  ||| || || || || ||||| |  || || |||
Sbjct: 904 gccctgaggatgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacc 845

                                                                       
Query: 263 cagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaag 322
           ||||||||||| || |||||||||||||| || ||||||||||| ||||| || || | |
Sbjct: 844 cagaagatccactgatcatcccaggccttgtccttgttgtagatgacggcggcccccagg 785

                                                
Query: 323 ctccttgccgggttgatgccggtgccggtgattggga 359
           ||||  |||||||||||||||||||||||||| ||||
Sbjct: 784 ctccgggccgggttgatgccggtgccggtgatgggga 748

---

>emb|Y18312.1|STU18312 Solanum tuberosum mRNA for major intrinsic protein 2
          Length = 1214

 Score =  103 bits (52), Expect = 4e-19
 Identities = 100/116 (86%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||||||||||||||| |||||||| |||||||| || ||||| ||||| |||  ||||
Sbjct: 809 gctccgatgaatggcccgacccagaaaatccagtgttcgtcccatgccttgtcgccgttg 750

                                                                   
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
            | |||||||| || ||||| ||||| ||||||||||| ||||| |||||||||||
Sbjct: 749 aaaatcacggccgccccgaaactcctcgccgggttgattccggtaccggtgattgg 694

---

>dbj|AB206101.1| Mimosa pudica pip2;3 mRNA for plasma membrane intrinsic protein
           2;3, complete cds
          Length = 1218

 Score =  103 bits (52), Expect = 4e-19
 Identities = 97/112 (86%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| ||||||||||||||||| || | ||||||||| ||||  | |||| |||||
Sbjct: 865 atgaatggtcccacccagaagatccaatgtttatcccaggctttctgttggttgaagatc 806

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || ||||||||||| ||||| |||||||| |||||||| ||||||| |||||
Sbjct: 805 acagcagctccgaaactcctggccgggttaatgccggtaccggtgactggga 754

---

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score =  101 bits (51), Expect = 2e-18
 Identities = 120/143 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtg 276
           ||||||||||  |||||| |  ||||| |||||||| || || |||||||||||||||||
Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccagtg 839

                                                                       
Query: 277 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggtt 336
           |||   |||||| | |||  |||||||||| | ||| || |||| |||||| ||||||||
Sbjct: 838 gtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctcctcgccgggtt 779

                                  
Query: 337 gatgccggtgccggtgattggga 359
           |||||||||||||||||| ||||
Sbjct: 778 gatgccggtgccggtgatgggga 756

---

>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score =  101 bits (51), Expect = 2e-18
 Identities = 117/139 (84%)
 Strand = Plus / Minus

                                                                       
Query: 216 actggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagt 275
           |||||||||||  ||| |||||||| || || ||||| || || ||||| |||||||| |
Sbjct: 418 actggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagatccact 359

                                                                       
Query: 276 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 335
           ||||||||||||||||||| ||||||||||| || ||||| || || ||||| || ||||
Sbjct: 358 ggtcatcccaggccttctcattgttgtagataacagcagcccccaaactcctggcagggt 299

                              
Query: 336 tgatgccggtgccggtgat 354
           |||| ||||| || |||||
Sbjct: 298 tgataccggtaccagtgat 280

---

>emb|X75884.1|ATPIP2B A.thaliana mRNA for plasma membrane intrinsic protein 2b
          Length = 1095

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 100/114 (87%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatccca-ggccttctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| ||| | ||| |||||
Sbjct: 785 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 727

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
            ||||| ||||  |||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 726 atagattacggacgctccgaaactcctagccgggttgatgccggttccggtgat 673

---

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 94/109 (86%)
 Strand = Plus / Minus

                                                                       
Query: 251 aatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacg 310
           ||||| || |||||||||||||| ||||| |||||  | || || ||||||||||| |||
Sbjct: 793 aatggtccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacg 734

                                                            
Query: 311 gcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || || ||||||||||| || ||||||||||||||||||||||| ||||
Sbjct: 733 gcggcgccgaagctcctggcggggttgatgccggtgccggtgatgggga 685

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                            
Query: 287      gccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtg 346
                ||||||||||||||| |||| ||||| ||||||| |||||| ||||||||||||||||||
Sbjct: 15355603 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 15355544

                             
Query: 347      ccggtgattggga 359
                |||||||| ||||
Sbjct: 15355543 ccggtgatcggga 15355531



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                            
Query: 283      ccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgcc 342
                ||||||||| | ||||||||||| ||||||  | |||| |||||| ||||||||||||||
Sbjct: 15306318 ccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgatgcc 15306259

                                 
Query: 343      ggtgccggtgattggga 359
                |||||||||||| ||||
Sbjct: 15306258 ggtgccggtgatcggga 15306242



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                            
Query: 295      gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
                ||||||||| || ||||| || |||| |||||| ||||||||||||||||||||||||||
Sbjct: 15316357 gttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgat 15316298

                     
Query: 355      tggga 359
                 ||||
Sbjct: 15316297 cggga 15316293



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                           
Query: 295      gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtga 353
                |||||||||||  ||||| || |||| |||||| |||||||||||||||||||||||||
Sbjct: 15324237 gttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtga 15324179



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                            
Query: 209      aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
                |||| |||||||||||||   || || |||||||| |||| ||| || || |||||||||
Sbjct: 15355805 aggatgtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaag 15355746

                     
Query: 269      atcca 273
                |||||
Sbjct: 15355745 atcca 15355741



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 245      ccgatgaatggccccacccagaagatcca 273
                |||||||| ||||| ||||||||||||||
Sbjct: 15324419 ccgatgaacggcccaacccagaagatcca 15324391



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 245      ccgatgaatggccccacccagaagatcca 273
                |||||||| ||||| ||||||||||||||
Sbjct: 15316506 ccgatgaacggcccgacccagaagatcca 15316478



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 245      ccgatgaatggccccacccagaagatcca 273
                |||||||| ||||| ||||||||||||||
Sbjct: 15306470 ccgatgaacggcccaacccagaagatcca 15306442

---

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 121/145 (83%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| |||||||||||||  ||| || ||||| || || | ||  || ||||||||||| 
Sbjct: 949 aggatgtactggtggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaa 890

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||||||||||||||| | ||| || ||||||||||  ||||| || || | |||||| 
Sbjct: 889 atccagtggtcatcccatggcttgtccttgttgtagacgacggcggcgcccaggctcctg 830

                                    
Query: 329 gccgggttgatgccggtgccggtga 353
           |||||||||||||||||||||||||
Sbjct: 829 gccgggttgatgccggtgccggtga 805

---

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 67/73 (91%)
 Strand = Plus / Minus

                                                                         
Query: 287   gccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtg 346
             ||||||||||||||| |||| ||||| ||||||| |||||| ||||||||||||||||||
Sbjct: 62602 gccttctcgttgttgaagatgacggccgctccgatgctcctggccgggttgatgccggtg 62543

                          
Query: 347   ccggtgattggga 359
             |||||||| ||||
Sbjct: 62542 ccggtgatcggga 62530



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                         
Query: 283   ccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgcc 342
             ||||||||| | ||||||||||| ||||||  | |||| |||||| ||||||||||||||
Sbjct: 13317 ccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgatgcc 13258

                              
Query: 343   ggtgccggtgattggga 359
             |||||||||||| ||||
Sbjct: 13257 ggtgccggtgatcggga 13241



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                         
Query: 295   gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
             ||||||||| || ||||| || |||| |||||| ||||||||||||||||||||||||||
Sbjct: 23356 gttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgat 23297

                  
Query: 355   tggga 359
              ||||
Sbjct: 23296 cggga 23292



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                        
Query: 295   gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtga 353
             |||||||||||  ||||| || |||| |||||| |||||||||||||||||||||||||
Sbjct: 31236 gttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtga 31178



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 209   aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
             |||| |||||||||||||   || || |||||||| |||| ||| || || |||||||||
Sbjct: 62804 aggatgtactggtggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaag 62745

                  
Query: 269   atcca 273
             |||||
Sbjct: 62744 atcca 62740



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 245   ccgatgaatggccccacccagaagatcca 273
             |||||||| ||||| ||||||||||||||
Sbjct: 31418 ccgatgaacggcccaacccagaagatcca 31390



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 245   ccgatgaatggccccacccagaagatcca 273
             |||||||| ||||| ||||||||||||||
Sbjct: 23505 ccgatgaacggcccgacccagaagatcca 23477



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 245   ccgatgaatggccccacccagaagatcca 273
             |||||||| ||||| ||||||||||||||
Sbjct: 13469 ccgatgaacggcccaacccagaagatcca 13441

---

>ref|NM_115202.1| Arabidopsis thaliana PIP2A; water channel AT3G53420 (PIP2A)
            transcript variant AT3G53420.1 mRNA, complete cds
          Length = 1347

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                        
Query: 242  gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
            ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 1035 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 977

                                                               
Query: 301  gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
            |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 976  gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 926

---

>ref|NM_001035774.1| Arabidopsis thaliana PIP2A AT3G53420 (PIP2A) transcript variant
           AT3G53420.2 mRNA, complete cds
          Length = 1278

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 985 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 927

                                                              
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 926 gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 876

---

>emb|X75883.1|ATPIP2A A.thaliana mRNA for plasma membrane intrinsic protein 2a
          Length = 1112

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 815 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 757

                                                              
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 756 gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 706

---

>gb|AY072374.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a
           (At3g53420) mRNA, complete cds
          Length = 1122

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 827 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 769

                                                              
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 768 gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 718

---

>gb|AF428426.1|AF428426 Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 1112

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 835 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 777

                                                              
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 776 gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 726

---

>gb|AY056085.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 864

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 776 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 718

                                                              
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 717 gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 667

---

>dbj|AK220982.1| Arabidopsis thaliana mRNA for plasma membrane intrinsic protein 2a,
           partial cds, clone: RAFL22-59-G07
          Length = 420

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 117 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 59

                                                              
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 58  gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 8

---

>gb|AY044327.1| Arabidopsis thaliana plasma membrane intrinsic protein 2a
           (F4P12.12) mRNA, complete cds
          Length = 956

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 776 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 718

                                                              
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 717 gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 667

---

>gb|AY039579.1| Arabidopsis thaliana AT3g53420/F4P12_120 mRNA, complete cds
          Length = 1129

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 835 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 777

                                                              
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 776 gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 726

---

>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1128

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 251 aatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacg 310
           ||||| || |||||||||||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 825 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 766

                                                          
Query: 311 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
           |||||||| || ||||| |||||||| || |||||||| ||||||||
Sbjct: 765 gcagctccaaaactcctagccgggtttattccggtgccagtgattgg 719

---

>emb|BX824659.1|CNS0A6W2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1056

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 818 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 760

                                                              
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 759 gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 709

---

>emb|BX824010.1|CNS0A6YX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH14ZC12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1035

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 815 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 757

                                                              
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 756 gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 706

---

>emb|BX823952.1|CNS0A4TL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZA03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1071

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 823 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 765

                                                              
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 764 gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 714

---

>emb|BX842136.1|CNS09YDO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS52ZB11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1117

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 819 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 761

                                                              
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 760 gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 710

---

>gb|AY087854.1| Arabidopsis thaliana clone 38965 mRNA, complete sequence
          Length = 1352

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 97/111 (87%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                        
Query: 242  gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
            ||||| |||||||| || ||||| || ||||||||||||||||| | ||| ||| |||||
Sbjct: 1037 gctccaatgaatggtccaacccaaaatatccagtggtcatcccatggcttgctc-ttgtt 979

                                                               
Query: 301  gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
            |||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 978  gtagattacggcagctccgaaactccttgccgggttaattccggttccggt 928

---

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||||||| || ||||||||||||||||||||||| ||||| |||| ||  |||||||||
Sbjct: 889 ccgatgaacggtcccacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 830

                                                                  
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || | ||| || |||| |  ||| |||||||||||||||||||| ||||| ||||
Sbjct: 829 atgatggcggcgccgagggacctcgccgggttgatgccggtgcccgtgatgggga 775

---

>dbj|AB030698.1| Raphanus sativus PAQ2c mRNA for Plasma membrane aquaporin 2c,
           complete cds
          Length = 1065

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 101/119 (84%)
 Strand = Plus / Minus

                                                                       
Query: 236 atggcggctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcg 295
           ||||||||||| |||||||| ||||||||||| ||||||||||||||||| | |||    
Sbjct: 812 atggcggctccaatgaatggtcccacccagaatatccagtggtcatcccacggcttggac 753

                                                                      
Query: 296 ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
           | ||||||||| || || |||||||| ||||| |||||||| || ||||| ||||||||
Sbjct: 752 tcgttgtagataaccgcggctccgaaactcctggccgggttaataccggttccggtgat 694

---

>ref|NM_129274.2| Arabidopsis thaliana RD28; water channel AT2G37180 (RD28) mRNA,
           complete cds
          Length = 1143

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 99/114 (86%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatccca-ggccttctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| ||| | ||| |||||
Sbjct: 837 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 779

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
             |||| ||||| |||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 778 aaagattacggcggctccgaaactcctagccgggttgataccggttccggtgat 725

---

>gb|AY096701.1| Arabidopsis thaliana putative aquaporin protein (At2g37180) mRNA,
           complete cds
          Length = 889

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 99/114 (86%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatccca-ggccttctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| ||| | ||| |||||
Sbjct: 770 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 712

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
             |||| ||||| |||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 711 aaagattacggcggctccgaaactcctagccgggttgataccggttccggtgat 658

---

>gb|AY064029.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 2C (At2g37180) mRNA, complete cds
          Length = 1151

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 99/114 (86%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatccca-ggccttctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| ||| | ||| |||||
Sbjct: 837 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 779

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
             |||| ||||| |||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 778 aaagattacggcggctccgaaactcctagccgggttgataccggttccggtgat 725

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                            
Query: 188      agcttggtggcactcgccctcaggacgtactggtggtaggcggcggcaatggcggctccg 247
                ||||||| ||| || |||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 25184690 agcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccg 25184631

                                          
Query: 248      atgaatggccccacccagaagatcca 273
                || |  || |||||||||||||||||
Sbjct: 25184630 atcagggggcccacccagaagatcca 25184605



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                            
Query: 275      tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccggg 334
                ||||||||||||||||| || ||||||||||| || || | ||| |||||||| ||||||
Sbjct: 25184041 tggtcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccggg 25183982

                                         
Query: 335      ttgatgccggtgccggtgattggga 359
                || ||||||||||||||||| ||||
Sbjct: 25183981 ttaatgccggtgccggtgatgggga 25183957



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                            
Query: 275      tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccggg 334
                ||||||| |||||| |  || ||||||||||| | |||||| || | |||||| || |||
Sbjct: 27065067 tggtcattccaggcatggtccttgttgtagatgatggcagcgccaaggctcctggctggg 27065008

                                         
Query: 335      ttgatgccggtgccggtgattggga 359
                |||||||| || |||||||| ||||
Sbjct: 27065007 ttgatgccagtaccggtgatgggga 27064983



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 332      gggttgatgccggtgccggtgattggga 359
                ||||||||||||||||||||||| ||||
Sbjct: 35369027 gggttgatgccggtgccggtgatgggga 35369000

---

>gb|AY084875.1| Arabidopsis thaliana clone 11998 mRNA, complete sequence
          Length = 1060

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 99/114 (86%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatccca-ggccttctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| ||| | ||| |||||
Sbjct: 837 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 779

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
             |||| ||||| |||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 778 aaagattacggcggctccgaaactcctagccgggttgataccggttccggtgat 725

---

>dbj|D13254.1|ATHRD28 Arabidopsis thaliana mRNA for putative transmenbrane channel
           protein
          Length = 1121

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 99/114 (86%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatccca-ggccttctcgttgtt 300
           ||||| |||||||| ||||||||||| ||||||||||||||||| ||| | ||| |||||
Sbjct: 820 gctccaatgaatggtcccacccagaatatccagtggtcatcccatggcttgctc-ttgtt 762

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
             |||| ||||| |||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 761 aaagattacggcggctccgaaactcctagccgggttgataccggttccggtgat 708

---

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                         
Query: 188   agcttggtggcactcgccctcaggacgtactggtggtaggcggcggcaatggcggctccg 247
             ||||||| ||| || |||||||| ||||||||||||||||||||||| |||||||| |||
Sbjct: 85083 agcttggcggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccg 85024

                                       
Query: 248   atgaatggccccacccagaagatcca 273
             || |  || |||||||||||||||||
Sbjct: 85023 atcagggggcccacccagaagatcca 84998



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                         
Query: 275   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccggg 334
             ||||||||||||||||| || ||||||||||| || || | ||| |||||||| ||||||
Sbjct: 84434 tggtcatcccaggccttgtccttgttgtagataaccgcggttcccaagctcctcgccggg 84375

                                      
Query: 335   ttgatgccggtgccggtgattggga 359
             || ||||||||||||||||| ||||
Sbjct: 84374 ttaatgccggtgccggtgatgggga 84350

---

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 115/138 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtg 276
           |||||||||| |||| || | |||||| || | ||| || ||||||||||||||||| ||
Sbjct: 913 ctggtggtagacggctgccagggcggcgccaacgaaggggcccacccagaagatccaatg 854

                                                                       
Query: 277 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggtt 336
           ||||| |||||| |  ||  |||||||||| | |||||| || | |||||| || |||||
Sbjct: 853 gtcattccaggcatggtccctgttgtagatgatggcagccccaaggctcctagctgggtt 794

                             
Query: 337 gatgccggtgccggtgat 354
           ||||||||||||||||||
Sbjct: 793 gatgccggtgccggtgat 776

---

>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds
          Length = 1262

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 100/118 (84%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||||||||||||||| |||||||| ||||| ||||||| ||| || |      |||||
Sbjct: 885 gctccgatgaatggcccaacccagaatatccaatggtcattccatgcgtgggatctgttg 826

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| | ||||||||| | ||||||||| ||||||||||||||||||||||| ||||
Sbjct: 825 tagatgatggcagctcccaggctccttgcagggttgatgccggtgccggtgatcggga 768

---

>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein
           2-2, complete cds
          Length = 1051

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 118/142 (83%)
 Strand = Plus / Minus

                                                                       
Query: 218 tggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtgg 277
           |||||||||  ||| ||||| || ||||| ||||| || || |||||||| ||||| |||
Sbjct: 874 tggtggtagaaggctgcaattgctgctccaatgaagggtcctacccagaaaatccattgg 815

                                                                       
Query: 278 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttg 337
           |||||||| ||||| || ||||||||||| || |||||||| |  || || || ||||||
Sbjct: 814 tcatcccaagccttgtctttgttgtagataacagcagctccaagacttctagcggggttg 755

                                 
Query: 338 atgccggtgccggtgattggga 359
           ||||| ||||| ||||||||||
Sbjct: 754 atgccagtgccagtgattggga 733

---

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 93/109 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||||||| ||||| |||||||||||||| || |||  ||| |||||   ||||||||||
Sbjct: 770 ccgatgaacggcccaacccagaagatccactgatcactccatgccttgctgttgttgtag 711

                                                            
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtga 353
           |  ||||| || |||| |||||| |||||||||||||||||||||||||
Sbjct: 710 acgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtga 662

---

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 93/109 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||||||| ||||| |||||||||||||| || |||  ||| |||||   ||||||||||
Sbjct: 328 ccgatgaacggcccaacccagaagatccactgatcactccatgccttgctgttgttgtag 269

                                                            
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtga 353
           |  ||||| || |||| |||||| |||||||||||||||||||||||||
Sbjct: 268 acgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtga 220

---

>gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic protein (mip3) mRNA,
           partial cds
          Length = 495

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                       
Query: 271 ccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgc 330
           ||||||||| ||||||||||| || |||||||||||||| |||||||| | ||| |||||
Sbjct: 495 ccagtggtcgtcccaggccttgtcattgttgtagatcactgcagctccaaggcttcttgc 436

                                        
Query: 331 cgggttgatgccggtgccggtgattggga 359
            ||||| ||||| ||||| ||||||||||
Sbjct: 435 tgggtttatgccagtgccagtgattggga 407

---

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                       
Query: 275 tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccggg 334
           ||||||| ||||||| | || ||||||||||| || |||||||| ||||| || ||||||
Sbjct: 410 tggtcattccaggccctgtctttgttgtagatgacagcagctcccaagcttctcgccggg 351

                                    
Query: 335 ttgatgccggtgccggtgattggga 359
           |||||||||||||||||||| ||||
Sbjct: 350 ttgatgccggtgccggtgatgggga 326

---

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 93/109 (85%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||||||| ||||| |||||||||||||| || |||  ||| |||||   ||||||||||
Sbjct: 327 ccgatgaacggcccaacccagaagatccactgatcactccatgccttgctgttgttgtag 268

                                                            
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtga 353
           |  ||||| || |||| |||||| |||||||||||||||||||||||||
Sbjct: 267 acgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtga 219

---

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 119/144 (82%)
 Strand = Plus / Minus

                                                                       
Query: 216 actggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagt 275
           |||||||||||   |||||||| ||||||||   ||| || || ||||| || ||||| |
Sbjct: 857 actggtggtagaacgcggcaatcgcggctccagcgaacggtccgacccaaaatatccatt 798

                                                                       
Query: 276 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 335
           | ||||||||||||||    ||||||||||| || |||||||||||||| || || ||||
Sbjct: 797 gatcatcccaggccttagaattgttgtagataaccgcagctccgaagcttctagcggggt 738

                                   
Query: 336 tgatgccggtgccggtgattggga 359
           |||| |||||||| ||||||||||
Sbjct: 737 tgattccggtgcctgtgattggga 714

---

>dbj|AB030697.1| Raphanus sativus PAQ2b mRNA for Plasma membrane aquaporin 2b,
           complete cds
          Length = 1087

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 98/116 (84%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           |||||||||||||| ||||||||||| ||||||||||||||||| | |||    | ||||
Sbjct: 807 gctccgatgaatggtcccacccagaaaatccagtggtcatcccacggcttggactcgttg 748

                                                                   
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
           ||||| || || ||||| || ||||| |||||||| || ||||| |||||||||||
Sbjct: 747 tagataaccgcggctccaaaactcctggccgggttaatcccggttccggtgattgg 692

---

>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010
           (PIP2;6/PIP2E) mRNA, complete cds
          Length = 1245

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 251 aatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacg 310
           ||||| || |||||||||||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 851 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 792

                                                          
Query: 311 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
           |||||||| || ||||| |||||||| || |||||||| || |||||
Sbjct: 791 gcagctccaaaactcctagccgggtttattccggtgccagtaattgg 745

---

>ref|NM_125459.2| Arabidopsis thaliana PIP2;4/PIP2F; water channel AT5G60660
           (PIP2;4/PIP2F) mRNA, complete cds
          Length = 1139

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 82/95 (86%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| || ||||| ||||| ||||||||||| ||||||||||| || ||||||||||| 
Sbjct: 808 acccaaaaaatccattggtcgtcccaggccttttcgttgttgtaaataacggcagctcca 749

                                              
Query: 320 aagctccttgccgggttgatgccggtgccggtgat 354
           ||||| |  ||||||||||| ||||| ||||||||
Sbjct: 748 aagctacgagccgggttgataccggttccggtgat 714

---

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtg 276
           ||||||||||  ||| |||| ||| || || ||||| || || |||||||||||||| ||
Sbjct: 810 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 751

                                                                       
Query: 277 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggtt 336
           |||||||||||| |   |  |||||||||| | |||||| || | |||||| || |||||
Sbjct: 750 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 691

                                  
Query: 337 gatgccggtgccggtgattggga 359
           |||||||||||||||||| ||||
Sbjct: 690 gatgccggtgccggtgatgggga 668

---

>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds
          Length = 1278

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 106/127 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 gcaatggcggctccgatgaatggccccacccagaagatccagtggtcatcccaggccttc 292
           |||||||| ||||| || ||||| || | |||||||||||| ||||||||||| || || 
Sbjct: 797 gcaatggcagctccaataaatggtccaagccagaagatccattggtcatcccaagctttg 738

                                                                       
Query: 293 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 352
           || |||||||||||||| |||||||| || || || || |||||||| || || || |||
Sbjct: 737 tccttgttgtagatcacagcagctccaaaacttctagcagggttgataccagttccagtg 678

                  
Query: 353 attggga 359
           |||||||
Sbjct: 677 attggga 671

---

>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1201

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 251 aatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacg 310
           ||||| || |||||||||||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 846 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 787

                                                          
Query: 311 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
           |||||||| || ||||| |||||||| || |||||||| || |||||
Sbjct: 786 gcagctccaaaactcctagccgggtttattccggtgccagtaattgg 740

---

>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 870

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 251 aatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacg 310
           ||||| || |||||||||||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 764 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 705

                                                          
Query: 311 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
           |||||||| || ||||| |||||||| || |||||||| || |||||
Sbjct: 704 gcagctccaaaactcctagccgggtttattccggtgccagtaattgg 658

---

>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1169

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 251 aatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacg 310
           ||||| || |||||||||||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 848 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 789

                                                          
Query: 311 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
           |||||||| || ||||| |||||||| || |||||||| || |||||
Sbjct: 788 gcagctccaaaactcctagccgggtttattccggtgccagtaattgg 742

---

>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1160

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 251 aatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacg 310
           ||||| || |||||||||||||| || |||||||| ||||| |  ||||||||||| |||
Sbjct: 835 aatggaccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 776

                                                          
Query: 311 gcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
           |||||||| || ||||| |||||||| || |||||||| || |||||
Sbjct: 775 gcagctccaaaactcctagccgggtttattccggtgccagtaattgg 729

---

>gb|AY087245.1| Arabidopsis thaliana clone 33231 mRNA, complete sequence
          Length = 1120

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 82/95 (86%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| || ||||| ||||| ||||||||||| ||||||||||| || ||||||||||| 
Sbjct: 808 acccaaaaaatccattggtcgtcccaggccttttcgttgttgtaaataacggcagctcca 749

                                              
Query: 320 aagctccttgccgggttgatgccggtgccggtgat 354
           ||||| |  ||||||||||| ||||| ||||||||
Sbjct: 748 aagctacgagccgggttgataccggttccggtgat 714

---

>emb|AJ605565.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-2 gene),
           clone pR450-3
          Length = 452

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 70/79 (88%)
 Strand = Plus / Minus

                                                                       
Query: 275 tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccggg 334
           ||||||||||| |||||||| ||||||||||| || ||||||||||| |||||||| |||
Sbjct: 431 tggtcatcccatgccttctccttgttgtagattacagcagctccgaaactccttgctggg 372

                              
Query: 335 ttgatgccggtgccggtga 353
           ||||| || ||||| ||||
Sbjct: 371 ttgattccagtgccagtga 353

---

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtg 276
           ||||||||||  ||| |||| ||| || || ||||| || || |||||||||||||| ||
Sbjct: 887 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 828

                                                                       
Query: 277 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggtt 336
           |||||||||||| |   |  |||||||||| | |||||| || | |||||| || |||||
Sbjct: 827 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 768

                                  
Query: 337 gatgccggtgccggtgattggga 359
           |||||||||||||||||| ||||
Sbjct: 767 gatgccggtgccggtgatgggga 745

---

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtg 276
           ||||||||||  ||| |||| ||| || || ||||| || || |||||||||||||| ||
Sbjct: 888 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 829

                                                                       
Query: 277 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggtt 336
           |||||||||||| |   |  |||||||||| | |||||| || | |||||| || |||||
Sbjct: 828 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 769

                                  
Query: 337 gatgccggtgccggtgattggga 359
           |||||||||||||||||| ||||
Sbjct: 768 gatgccggtgccggtgatgggga 746

---

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtg 276
           ||||||||||  ||| |||| ||| || || ||||| || || |||||||||||||| ||
Sbjct: 890 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 831

                                                                       
Query: 277 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggtt 336
           |||||||||||| |   |  |||||||||| | |||||| || | |||||| || |||||
Sbjct: 830 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 771

                                  
Query: 337 gatgccggtgccggtgattggga 359
           |||||||||||||||||| ||||
Sbjct: 770 gatgccggtgccggtgatgggga 748

---

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                        
Query: 217  ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtg 276
            ||||||||||  ||| |||| ||| || || ||||| || || |||||||||||||| ||
Sbjct: 1186 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 1127

                                                                        
Query: 277  gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggtt 336
            |||||||||||| |   |  |||||||||| | |||||| || | |||||| || |||||
Sbjct: 1126 gtcatcccaggcatggcccctgttgtagatgatggcagcgccaaggctcctcgctgggtt 1067

                                   
Query: 337  gatgccggtgccggtgattggga 359
            |||||||||||||||||| ||||
Sbjct: 1066 gatgccggtgccggtgatgggga 1044

---

>gb|U27347.1|GMU27347 Glycine max putative water channel protein (Pip1) mRNA, complete
           cds
          Length = 1255

 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 109/131 (83%)
 Strand = Plus / Minus

                                                                       
Query: 218 tggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtgg 277
           |||||||||  ||| |||||||| ||||| || ||||| || ||||| |||||||| |||
Sbjct: 890 tggtggtagaaggctgcaatggctgctccaataaatggtccaacccaaaagatccaatgg 831

                                                                       
Query: 278 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttg 337
           ||||||||||||||||  | |||||| || || |||||||| | |||||| || ||||| 
Sbjct: 830 tcatcccaggccttctgttggttgtacatgacagcagctcctaggctcctagcagggtta 771

                      
Query: 338 atgccggtgcc 348
           ||||| |||||
Sbjct: 770 atgccagtgcc 760

---

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| |||||||| || |||||||| ||||||||||||||||| ||||  || ||||||
Sbjct: 833 gctccaatgaatggtccaacccagaaaatccagtggtcatcccatgcctcgtctttgttg 774

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| |  |||||||| |  ||||| || |||||||| || || |||||||||||||
Sbjct: 773 tagatgatagcagctccaagactcctggcagggttgataccagttccggtgattggga 716

---

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 93/110 (84%)
 Strand = Plus / Minus

                                                                       
Query: 250 gaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcac 309
           |||||| || ||||| || ||||| ||||||||||||| ||| || | ||||||||| ||
Sbjct: 853 gaatggtccaacccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgac 794

                                                             
Query: 310 ggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
            |||||||| |||||||| || ||||||||||| || |||||||| ||||
Sbjct: 793 agcagctccaaagctcctagcagggttgatgccagttccggtgatgggga 744

---

>gb|DQ450066.1| Arachis hypogaea clone 10A4R1GZ putative aquaporin mRNA, partial
           cds
          Length = 607

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 117/142 (82%)
 Strand = Plus / Minus

                                                                       
Query: 218 tggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtgg 277
           |||||||||  ||| |||||||| || || |||||||| || ||||| |||||||| |||
Sbjct: 196 tggtggtagaaggctgcaatggctgccccaatgaatggtcctacccaaaagatccaatgg 137

                                                                       
Query: 278 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttg 337
           |||||||||| ||| || | |||| |||| || |||||||| || |||||||| ||||| 
Sbjct: 136 tcatcccagggcttgtcttggttgaagataacagcagctccaaaactccttgcagggtta 77

                                 
Query: 338 atgccggtgccggtgattggga 359
           ||||| || || |||| |||||
Sbjct: 76  atgccagttccagtgactggga 55

---

>gb|AF118383.1|AF118383 Brassica napus plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1026

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 gcaatggcggctccgatgaatggccccacccagaagatccagtggtcatcccaggccttc 292
           ||||| || ||||| |||||||| || |||||||| ||||||||||||||||| | ||| 
Sbjct: 804 gcaatcgcagctccaatgaatggtccaacccagaatatccagtggtcatcccacggcttg 745

                                                                       
Query: 293 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 352
              | ||||||||| || ||||||||||| |||||||||||||| || || || ||||||
Sbjct: 744 gactcgttgtagataaccgcagctccgaaactccttgccgggttaattcctgttccggtg 685

             
Query: 353 at 354
           ||
Sbjct: 684 at 683

---

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 99/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| |||||||| || |||||||||||||||||||||| ||| ||||  || ||||||
Sbjct: 843 gctccaatgaatggtccaacccagaagatccagtggtcattccatgcctcgtctttgttg 784

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| |  |||||||| |  ||||| || |||||||| || || |||||||||||||
Sbjct: 783 tagatgatagcagctccaagactcctggcagggttgataccagttccggtgattggga 726

---

>gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence
          Length = 514

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 163 acccaaaagatccaatggtcatcccaagccttctcgttgttgtagataacagcagcacca 104

                            
Query: 320 aagctccttgccgggtt 336
           ||||| ||||| |||||
Sbjct: 103 aagcttcttgctgggtt 87

---

>gb|BT013307.1| Lycopersicon esculentum clone 134975R, mRNA sequence
          Length = 1260

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 116/141 (82%)
 Strand = Plus / Minus

                                                                       
Query: 214 gtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatcca 273
           ||||||||||||| | ||||| |||   |||||||| |||||||| |||||||| |||||
Sbjct: 900 gtactggtggtagacagcggcgatgaaagctccgataaatggcccgacccagaaaatcca 841

                                                                       
Query: 274 gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgg 333
           ||| || ||||| ||||| ||   |||| | ||||| || || ||||| ||||| |||||
Sbjct: 840 gtgttcgtcccacgccttatcaccgttgaaaatcacagctgccccgaaactcctcgccgg 781

                                
Query: 334 gttgatgccggtgccggtgat 354
           |||||| ||||| ||||||||
Sbjct: 780 gttgattccggtaccggtgat 760

---

>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds
          Length = 909

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 740 acccagaagatccaatggtcatcccacgccttctcgttgttgtagataacagcagcacca 681

                
Query: 320 aagct 324
           |||||
Sbjct: 680 aagct 676

---

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0475E07
          Length = 139961

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                         
Query: 283   ccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgcc 342
             ||||||||| | ||||||||||| ||||||  | |||| |||||| ||||||||||||||
Sbjct: 92331 ccaggccttgttgttgttgtagaccacggcgacgccgaggctcctggccgggttgatgcc 92272

                              
Query: 343   ggtgccggtgattggga 359
             |||||||||||| ||||
Sbjct: 92271 ggtgccggtgatcggga 92255



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                          
Query: 295    gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
              ||||||||| || ||||| || |||| |||||| ||||||||||||||||||||||||||
Sbjct: 102370 gttgttgtacatgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtgat 102311

                   
Query: 355    tggga 359
               ||||
Sbjct: 102310 cggga 102306



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                         
Query: 295    gttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtga 353
              |||||||||||  ||||| || |||| |||||| |||||||||||||||||||||||||
Sbjct: 110250 gttgttgtagacgacggcggcgccgaggctcctcgccgggttgatgccggtgccggtga 110192



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 245    ccgatgaatggccccacccagaagatcca 273
              |||||||| ||||| ||||||||||||||
Sbjct: 110432 ccgatgaacggcccaacccagaagatcca 110404



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 245    ccgatgaatggccccacccagaagatcca 273
              |||||||| ||||| ||||||||||||||
Sbjct: 102519 ccgatgaacggcccgacccagaagatcca 102491



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 245   ccgatgaatggccccacccagaagatcca 273
             |||||||| ||||| ||||||||||||||
Sbjct: 92483 ccgatgaacggcccaacccagaagatcca 92455

---

>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein
           2-1, complete cds
          Length = 1311

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 104/125 (83%)
 Strand = Plus / Minus

                                                                       
Query: 218 tggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtgg 277
           |||||||||  ||| |||||||| ||||| ||||| || || | |||||||||||| |||
Sbjct: 856 tggtggtagaaggcagcaatggcagctccaatgaaaggtccaagccagaagatccattgg 797

                                                                       
Query: 278 tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttg 337
           |||||||| || || || ||||| ||||| || |||||||| || ||||| || ||||||
Sbjct: 796 tcatcccaagctttgtccttgttatagatgacagcagctcctaaactcctagcagggttg 737

                
Query: 338 atgcc 342
           |||||
Sbjct: 736 atgcc 732

---

>ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3);
           water channel AT4G35100 (PIP3) mRNA, complete cds
          Length = 1182

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 727

                               
Query: 320 aagctccttgccgggttgat 339
           ||||| || || ||||||||
Sbjct: 726 aagcttctagctgggttgat 707

---

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| || |||||||||||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 843 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 784

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||||||||  ||||| |||||||| ||||| || || || |||||||
Sbjct: 783 atggcagctccgagactcctggccgggttaatgccagttccagtaattggga 732

---

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| || |||||||||||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 794 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 735

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||||||||  ||||| |||||||| ||||| || || || |||||||
Sbjct: 734 atggcagctccgagactcctggccgggttaatgccagttccagtaattggga 683

---

>gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100) mRNA, complete cds
          Length = 946

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 737 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 678

                               
Query: 320 aagctccttgccgggttgat 339
           ||||| || || ||||||||
Sbjct: 677 aagcttctagctgggttgat 658

---

>gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100; M4E13.150) mRNA, complete cds
          Length = 1036

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 725

                               
Query: 320 aagctccttgccgggttgat 339
           ||||| || || ||||||||
Sbjct: 724 aagcttctagctgggttgat 705

---

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| || |||||||||||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 843 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 784

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||||||||  ||||| |||||||| ||||| || || || |||||||
Sbjct: 783 atggcagctccgagactcctggccgggttaatgccagttccagtaattggga 732

---

>gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 mRNA, complete cds
          Length = 1026

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 727

                               
Query: 320 aagctccttgccgggttgat 339
           ||||| || || ||||||||
Sbjct: 726 aagcttctagctgggttgat 707

---

>gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           mRNA, complete cds
          Length = 1030

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 765 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 706

                               
Query: 320 aagctccttgccgggttgat 339
           ||||| || || ||||||||
Sbjct: 705 aagcttctagctgggttgat 686

---

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| || |||||||||||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 167 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 108

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||||||||  ||||| |||||||| ||||| || || || |||||||
Sbjct: 107 atggcagctccgagactcctggccgggttaatgccagttccagtaattggga 56

---

>emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 777 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 718

                               
Query: 320 aagctccttgccgggttgat 339
           ||||| || || ||||||||
Sbjct: 717 aagcttctagctgggttgat 698

---

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| || |||||||||||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 426 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 367

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||||||||  ||||| |||||||| ||||| || || || |||||||
Sbjct: 366 atggcagctccgagactcctggccgggttaatgccagttccagtaattggga 315

---

>emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB11ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 999

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 775 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 716

                               
Query: 320 aagctccttgccgggttgat 339
           ||||| || || ||||||||
Sbjct: 715 aagcttctagctgggttgat 696

---

>emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH35ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1019

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 774 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 715

                               
Query: 320 aagctccttgccgggttgat 339
           ||||| || || ||||||||
Sbjct: 714 aagcttctagctgggttgat 695

---

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| || |||||||||||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 832 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 773

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||||||||  ||||| |||||||| ||||| || || || |||||||
Sbjct: 772 atggcagctccgagactcctggccgggttaatgccagttccagtaattggga 721

---

>emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS11ZH09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 985

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 769 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 710

                               
Query: 320 aagctccttgccgggttgat 339
           ||||| || || ||||||||
Sbjct: 709 aagcttctagctgggttgat 690

---

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| || |||||||||||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 807 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 748

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||||||||  ||||| |||||||| ||||| || || || |||||||
Sbjct: 747 atggcagctccgagactcctggccgggttaatgccagttccagtaattggga 696

---

>gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete sequence
          Length = 1033

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 727

                               
Query: 320 aagctccttgccgggttgat 339
           ||||| || || ||||||||
Sbjct: 726 aagcttctagctgggttgat 707

---

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 94/112 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| || |||||||||||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 841 atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 782

                                                               
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||||||||  ||||| |||||||| ||||| || || || |||||||
Sbjct: 781 atggcagctccgagactcctggccgggttaatgccagttccagtaattggga 730

---

>dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds
          Length = 748

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 476 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 417

                               
Query: 320 aagctccttgccgggttgat 339
           ||||| || || ||||||||
Sbjct: 416 aagcttctagctgggttgat 397

---

>dbj|AB005246.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24
          Length = 77999

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                         
Query: 275   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccggg 334
             ||||| ||||||||||| ||||||||||| || ||||||||||| ||||| |  ||||||
Sbjct: 19103 tggtcgtcccaggccttttcgttgttgtaaataacggcagctccaaagctacgagccggg 19162

                                 
Query: 335   ttgatgccggtgccggtgat 354
             ||||| ||||| ||||||||
Sbjct: 19163 ttgataccggttccggtgat 19182

---

>gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrinsic protein PIP3 mRNA,
           complete cds
          Length = 1046

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||||||||| |||||||||||||||||||| || ||||| || 
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagataacagcagcacca 725

                               
Query: 320 aagctccttgccgggttgat 339
           ||||| || || ||||||||
Sbjct: 724 aagcttctagctgggttgat 705

---

>gb|U73467.1|MCU73467 Mesembryanthemum crystallinum water channel protein MipE mRNA,
           complete cds
          Length = 1179

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||| ||||| ||||||||||||  ||||| | ||||| |||| || ||||| |||
Sbjct: 871 acccagaaaatccaatggtcatcccagttcttcttgctgttgaagataacagcagcaccg 812

                                                   
Query: 320 aagctccttgccgggttgatgccggtgccggtgattggga 359
           || ||||| || ||||||||||||||||| ||||| ||||
Sbjct: 811 aaactcctagcagggttgatgccggtgccagtgatgggga 772

---

>gb|U26538.1|MCU26538 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipE) mRNA, partial cds
          Length = 963

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||| ||||| ||||||||||||  ||||| | ||||| |||| || ||||| |||
Sbjct: 655 acccagaaaatccaatggtcatcccagttcttcttgctgttgaagataacagcagcaccg 596

                                                   
Query: 320 aagctccttgccgggttgatgccggtgccggtgattggga 359
           || ||||| || ||||||||||||||||| ||||| ||||
Sbjct: 595 aaactcctagcagggttgatgccggtgccagtgatgggga 556

---

>gb|AC006260.4| Arabidopsis thaliana chromosome 2 clone T2N18 map ve018, complete
             sequence
          Length = 80736

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                        
Query: 296   ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
             ||||| ||||| |||||||||||||| ||||| ||||||||||||||||| ||||||||
Sbjct: 25095 ttgttatagattacggcagctccgaaactcctagccgggttgatgccggttccggtgat 25037



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                 
Query: 303   agatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
             |||| ||||| |||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 20260 agattacggcggctccgaaactcctagccgggttgataccggttccggtgat 20311



 Score = 40.1 bits (20), Expect = 4.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 242   gctccgatgaatggccccacccagaagatcca 273
             ||||| |||||||| ||||||||||| |||||
Sbjct: 25247 gctccaatgaatggtcccacccagaatatcca 25216



 Score = 40.1 bits (20), Expect = 4.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 242   gctccgatgaatggccccacccagaagatcca 273
             ||||| |||||||| ||||||||||| |||||
Sbjct: 20110 gctccaatgaatggtcccacccagaatatcca 20141

---

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| || |||||||||||||| ||||||||||| || |  || ||||||||||| 
Sbjct: 99  atgaatggaccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatg 40

                                              
Query: 308 acggcagctccgaagctccttgccgggttgatgcc 342
           | |||||||||||  ||||| |||||||| |||||
Sbjct: 39  atggcagctccgagactcctggccgggttaatgcc 5

---

>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds
          Length = 1070

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||| ||||| || |||||||| || || || ||||||||||| ||||| ||||||
Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagattacggcggctccg 687

                                              
Query: 320 aagctccttgccgggttgatgccggtgccggtgat 354
           ||||| || || ||||| || ||||||||||||||
Sbjct: 686 aagcttctggcggggttaattccggtgccggtgat 652

---

>emb|AJ605568.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-3 gene),
           clone pR450-4
          Length = 452

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 275 tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccggg 334
           ||||||||||||||||| || | |||||| || || |||||||| || |||||||| |||
Sbjct: 431 tggtcatcccaggccttgtcctggttgtaaataacagcagctcctaaactccttgctggg 372

                                  
Query: 335 ttgatgccggtgccggtgattgg 357
           |||||||| ||||| ||||||||
Sbjct: 371 ttgatgccagtgccagtgattgg 349

---

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||||||| || || |||||||||||||||||||| ||||| |||| ||  |||||||||
Sbjct: 874 ccgatgaacggaccaacccagaagatccagtggtcgtcccacgcctgcttcttgttgtag 815

                                                                  
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || | ||| || |||| |  ||| ||||||||||||||||| || ||||| ||||
Sbjct: 814 atgatggcggcgccgagggacctcgccgggttgatgccggtccccgtgatgggga 760

---

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 104/126 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtg 276
           |||||||||| | |||||||  || ||||| ||||| || || |||||||||||||||||
Sbjct: 903 ctggtggtagacagcggcaagagcagctccaatgaaagggccaacccagaagatccagtg 844

                                                                       
Query: 277 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggtt 336
           ||||||||| || |  || |||||| |||| | ||| ||||| |  ||||||||||||||
Sbjct: 843 gtcatcccatgcatggtctttgttgaagatgatggcggctccaagactccttgccgggtt 784

                 
Query: 337 gatgcc 342
            |||||
Sbjct: 783 aatgcc 778

---

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||||||||| || ||||||||||||||||| |||||   |||||| ||   |||||||
Sbjct: 875 gctccgatgaacgggcccacccagaagatccactggtcgctccaggctttgctgttgttg 816

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || |  ||||| || |||| |||||| ||||||||||| |||||||| ||||| ||||
Sbjct: 815 tacacgacggcggcgccgaggctcctcgccgggttgataccggtgccagtgatcggga 758

---

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 218 tggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtgg 277
           |||||||||  |||||| ||||| || || ||||| || || |||||||| ||||| || 
Sbjct: 884 tggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatccactga 825

                                                 
Query: 278 tcatcccaggccttctcgttgttgtagatcacggcagc 315
           |||||||||||||| | ||||||||||||||| |||||
Sbjct: 824 tcatcccaggccttgttgttgttgtagatcacagcagc 787

---

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| |||||||| || ||||||||||||||||| |||||||| ||||  |||| ||||
Sbjct: 833 gctccaatgaatggtccaacccagaagatccagtgatcatcccatgcctggtcgtggttg 774

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
            |||| |  |||||||| | |||||  || |||||||||||||| || ||||| ||||
Sbjct: 773 aagatgatagcagctccaaggctccgggcggggttgatgccggttccagtgataggga 716

---

>dbj|AB012045.1| Raphanus sativus mRNA for Plasma membrane aquaporin (PAQ2),
           complete cds
          Length = 1126

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 97/114 (85%), Gaps = 2/114 (1%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgtt 300
           ||||| || ||||| |||||||| || ||||||||||||||||||| ||| ||| | |||
Sbjct: 822 gctccaataaatggtcccacccaaaatatccagtggtcatcccagggcttgctc-tcgtt 764

                                                                 
Query: 301 gtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
           | |||| ||||| |||||||| |||||||||||||| || || || ||||||||
Sbjct: 763 gaagatgacggctgctccgaaactccttgccgggttaataccagttccggtgat 710

---

>gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, complete cds
          Length = 1278

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 233 gcaatggcggctccgatgaatggccccacccagaagatccagtggtcatcccaggccttc 292
           ||||| || ||||| |||||||| || |||||||| ||||| ||||||| ||| ||||| 
Sbjct: 865 gcaatagcagctccaatgaatggtccaacccagaaaatccattggtcattccatgccttg 806

                                                                       
Query: 293 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 352
           || |||  |||||| || |||||||||||||| |  ||||| ||||| || || ||||||
Sbjct: 805 tccttgccgtagatgacagcagctccgaagcttcgagccggattgataccagttccggtg 746

                
Query: 353 attgg 357
           |||||
Sbjct: 745 attgg 741

---

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                       
Query: 239 gcggctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttg 298
           ||||| || |||||||| ||||||||||||||||||||||| ||||| || |  || |||
Sbjct: 831 gcggccccaatgaatggtcccacccagaagatccagtggtcgtcccatgcgtggtccttg 772

                                                                
Query: 299 ttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
           |||||||| | ||| || || | |||||  || |||||||||||||| |||||
Sbjct: 771 ttgtagatgatggccgcacccaggctccgagctgggttgatgccggttccggt 719

---

>gb|BT014251.1| Lycopersicon esculentum clone 133453R, mRNA sequence
          Length = 1084

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 96/116 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| |||||||| || |||||||| ||||||||||||||||| ||||  || ||||| 
Sbjct: 837 gctccaatgaatggtccaacccagaaaatccagtggtcatcccatgcctcgtctttgtta 778

                                                                   
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
            |||| |  |||||||| |  |||||||| |||||||| || || |||||||||||
Sbjct: 777 aagatgatagcagctccaagactccttgcggggttgataccagttccggtgattgg 722

---

>gb|BT012927.1| Lycopersicon esculentum clone 114090R, mRNA sequence
          Length = 1159

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||||||||||||||||| ||| || | ||||| ||||||||| |  |||||||| 
Sbjct: 854 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 795

                                                   
Query: 320 aagctccttgccgggttgatgccggtgccggtgattggga 359
           |  ||||| || ||||||||||| || |||||||| ||||
Sbjct: 794 agactcctggcggggttgatgccagttccggtgatgggga 755

---

>emb|X73848.1|LETRAMP2 L.esculentum mRNA for tomato ripening membrane protein, clone
           pNY507
          Length = 1107

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||||||||||||||||| ||| || | ||||| ||||||||| |  |||||||| 
Sbjct: 794 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 735

                                                   
Query: 320 aagctccttgccgggttgatgccggtgccggtgattggga 359
           |  ||||| || ||||||||||| || |||||||| ||||
Sbjct: 734 agactcctggcggggttgatgccagttccggtgatgggga 695

---

>emb|X73847.1|LETRAMP1 L.esculentum mRNA for tomato ripening membrane protein, clone
           pTOM75
          Length = 859

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||||||||||||||||| ||| || | ||||| ||||||||| |  |||||||| 
Sbjct: 605 acccagaagatccagtggtcattccatgcatgctcgtcgttgtagatgatagcagctcca 546

                                                   
Query: 320 aagctccttgccgggttgatgccggtgccggtgattggga 359
           |  ||||| || ||||||||||| || |||||||| ||||
Sbjct: 545 agactcctggcggggttgatgccagttccggtgatgggga 506

---

>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.2 gene)
          Length = 978

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 aatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacg 310
           |||||||| |||||||| ||||| || ||||||||||| || || |||||| |||| || 
Sbjct: 835 aatggcccaacccagaaaatccaatgatcatcccaggctttttcattgttgaagatgaca 776

                                           
Query: 311 gcagctccgaagctccttgccgggttgatgcc 342
           ||||| || |||||||| || |||||||||||
Sbjct: 775 gcagcgccaaagctcctggcagggttgatgcc 744

---

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||||||||| ||||||| |||||| |  || ||||||||||| | |||||| || 
Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 753

                                                   
Query: 320 aagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||| || ||||||||||| || |||||||| ||||
Sbjct: 752 aggctcctggctgggttgatgccagtaccggtgatgggga 713

---

>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds
          Length = 740

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 117/144 (81%)
 Strand = Plus / Minus

                                                                       
Query: 216 actggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagt 275
           |||||||||||  ||| |||||||  ||||| ||||| || ||| ||||||| ||||| |
Sbjct: 526 actggtggtagaaggccgcaatgggtgctccaatgaacggtcccccccagaaaatccact 467

                                                                       
Query: 276 ggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggt 335
           | |||||||| | ||| |  |||||||||||||| || ||||| ||||| |  |||||||
Sbjct: 466 gatcatcccatgtcttttttttgttgtagatcacagcggctcccaagctacgggccgggt 407

                                   
Query: 336 tgatgccggtgccggtgattggga 359
           | ||||| || |||||||| ||||
Sbjct: 406 taatgccagttccggtgatcggga 383

---

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 108/132 (81%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtg 276
           ||||||||||  |||||| | ||| || || ||||| || || |||||||||||||| ||
Sbjct: 384 ctggtggtagatggcggctagggcagcgccaatgaaggggccgacccagaagatccaatg 325

                                                                       
Query: 277 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggtt 336
           ||||| |||||| | |||  |||||||||| | |||||| || | |||||| || |||||
Sbjct: 324 gtcattccaggcgtgctccctgttgtagatgatggcagcgccaaggctcctagctgggtt 265

                       
Query: 337 gatgccggtgcc 348
           |||||| |||||
Sbjct: 264 gatgccagtgcc 253

---

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||||||||| ||||||| |||||| |  || ||||||||||| | |||||| || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                                   
Query: 320 aagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||| || ||||||||||| || |||||||| ||||
Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatgggga 746

---

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||||||||| ||||||| |||||| |  || ||||||||||| | |||||| || 
Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 841

                                                   
Query: 320 aagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||| || ||||||||||| || |||||||| ||||
Sbjct: 840 aggctcctggctgggttgatgccagtaccggtgatgggga 801

---

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||||||||| ||||||| |||||| |  || ||||||||||| | |||||| || 
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 786

                                                   
Query: 320 aagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||| || ||||||||||| || |||||||| ||||
Sbjct: 785 aggctcctggctgggttgatgccagtaccggtgatgggga 746

---

>emb|AL132966.1|ATF4P12 Arabidopsis thaliana DNA chromosome 3, BAC clone F4P12
          Length = 144628

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 51/56 (91%)
 Strand = Plus / Plus

                                                                     
Query: 296   ttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggt 351
             ||||||||||| |||||||||||||| |||||||||||||| || ||||| |||||
Sbjct: 44808 ttgttgtagattacggcagctccgaaactccttgccgggttaattccggttccggt 44863

---

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||||||||| ||||||| |||||| |  || ||||||||||| | |||||| || 
Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 781

                                                   
Query: 320 aagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||| || ||||||||||| || |||||||| ||||
Sbjct: 780 aggctcctggctgggttgatgccagtaccggtgatgggga 741

---

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 84/100 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||||||||| ||||||| |||||| |  || ||||||||||| | |||||| || 
Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatgatggcagcgcca 784

                                                   
Query: 320 aagctccttgccgggttgatgccggtgccggtgattggga 359
           | |||||| || ||||||||||| || |||||||| ||||
Sbjct: 783 aggctcctggctgggttgatgccagtaccggtgatgggga 744

---

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 95/115 (82%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||||||| || || ||||||||||||||||||||| ||||||| |  |  | |||||| 
Sbjct: 369 ccgatgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaa 310

                                                                  
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || ||||| || || | |||||  || ||||||||||||||||||||||| ||||
Sbjct: 309 attacggcggcgccaaggctccgcgcggggttgatgccggtgccggtgataggga 255

---

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 95/115 (82%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||||||| || || ||||||||||||||||||||| ||||||| |  |  | |||||| 
Sbjct: 800 ccgatgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaa 741

                                                                  
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || ||||| || || | |||||  || ||||||||||||||||||||||| ||||
Sbjct: 740 attacggcggcgccaaggctccgcgcggggttgatgccggtgccggtgataggga 686

---

>gb|DQ445128.1| Striga asiatica isolate St489 major intrinsic protein 1-like
           protein mRNA, partial cds
          Length = 474

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 104/127 (81%)
 Strand = Plus / Minus

                                                                       
Query: 228 cggcggcaatggcggctccgatgaatggccccacccagaagatccagtggtcatcccagg 287
           |||||||||  || ||||| ||||| || |||||||| ||||||||||||||||||||||
Sbjct: 472 cggcggcaagagcagctccaatgaaaggtcccacccaaaagatccagtggtcatcccagg 413

                                                                       
Query: 288 ccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgc 347
           | |  ||    ||||| || | ||| ||||| | |||||| || ||||||||||| ||||
Sbjct: 412 catggtctcgattgtaaataatggctgctccaaggctcctggcagggttgatgccagtgc 353

                  
Query: 348 cggtgat 354
           |||||||
Sbjct: 352 cggtgat 346

---

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 297 tgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattg 356
           |||||||||| | ||| || |||| |||||| |||||||||||||||||||||||||| |
Sbjct: 657 tgttgtagatgatggccgcgccgaggctcctcgccgggttgatgccggtgccggtgatgg 598

              
Query: 357 gga 359
           |||
Sbjct: 597 gga 595



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                     
Query: 217  ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatcca 273
            ||||||||||  |||||| |  ||||| |||||||| || || ||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 1235

---

>dbj|AB206102.1| Mimosa pudica pip2;4 mRNA for plasma membrane intrinsic protein
           2;4, complete cds
          Length = 1263

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           ||||| || |||||||| |||||||||||||||||||| ||||     |||||||| || 
Sbjct: 807 atgaaaggtcccacccaaaagatccagtggtcatcccatgcctcaaaattgttgtacatg 748

                                                          
Query: 308 acggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
           || ||||| || |||||||| ||||||||||| || ||||| |||||
Sbjct: 747 actgcagccccaaagctcctggccgggttgataccagtgccagtgat 701

---

>gb|AF118382.1|AF118382 Brassica napus plasma membrane intrinsic protein 1 (PIP1) mRNA,
           complete cds
          Length = 1093

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 79/91 (86%), Gaps = 2/91 (2%)
 Strand = Plus / Minus

                                                                       
Query: 250 gaatggccccacccagaagatccagtggtcatcccaggcctt-ctcgttgttgtagatca 308
           |||||| |||||||| || ||||||||||||||||| | ||| ||| | |||| |||| |
Sbjct: 778 gaatggtcccacccaaaatatccagtggtcatcccatggcttgctc-tcgttgaagataa 720

                                          
Query: 309 cggcagctccgaagctccttgccgggttgat 339
           |||| |||||||| |||||||||||||||||
Sbjct: 719 cggctgctccgaaactccttgccgggttgat 689

---

>ref|NM_001009194.1| Ovis aries aquaporin 1 (AQP1), mRNA
          Length = 823

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 242 gctccgatgaatggccccacccagaagatccagtggtc 279
           ||||||||||| ||||||||||||||||||||||||||
Sbjct: 672 gctccgatgaacggccccacccagaagatccagtggtc 635

---

>gb|BT025412.1| Bos taurus aquaporin 1 (Colton blood group) (AQP1), mRNA, complete
           cds
          Length = 2695

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 242 gctccgatgaatggccccacccagaagatccagtggtc 279
           ||||||||||| ||||||||||||||||||||||||||
Sbjct: 707 gctccgatgaacggccccacccagaagatccagtggtc 670

---

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||||||| || || ||||||||||||||||||||| ||||||| |  |  | |||||| 
Sbjct: 857 ccgatgaaggggccgacccagaagatccagtggtcagcccaggcatggtgctggttgtaa 798

                                                             
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
           || ||||| || || | |||||  || |||||||||||||||||||||||
Sbjct: 797 attacggcggcgccaaggctccgcgcggggttgatgccggtgccggtgat 748

---

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 97/118 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| |||||||| || |||||||| ||||||||||| ||||| || |  || ||||||
Sbjct: 829 gctccaatgaatggtccgacccagaatatccagtggtcgtcccaagcgtggtccttgttg 770

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| |  |||||||| |  ||||| || |||||||| || || |||||||||||||
Sbjct: 769 tagatgattgcagctccaagactcctagctgggttgattcctgttccggtgattggga 712

---

>ref|NM_174702.3| Bos taurus aquaporin 1 (Aqp1), mRNA
          Length = 2703

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 242 gctccgatgaatggccccacccagaagatccagtggtc 279
           ||||||||||| ||||||||||||||||||||||||||
Sbjct: 681 gctccgatgaacggccccacccagaagatccagtggtc 644

---

>gb|AF290620.1|AF290620 Nicotiana glauca putative PIP2 (MIP4) mRNA, complete cds
          Length = 1108

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 100/122 (81%)
 Strand = Plus / Minus

                                                                       
Query: 233 gcaatggcggctccgatgaatggccccacccagaagatccagtggtcatcccaggccttc 292
           |||||||| ||||| ||||| || || ||||| || ||||||||||| | |||||| || 
Sbjct: 807 gcaatggctgctccaatgaaaggtcctacccaaaatatccagtggtctttccaggctttg 748

                                                                       
Query: 293 tcgttgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtg 352
           |  | |||| |||| |||||||| || |  ||||| ||||||||||| ||||||||||||
Sbjct: 747 tgttggttgaagataacggcagcgccaagactcctagccgggttgattccggtgccggtg 688

             
Query: 353 at 354
           ||
Sbjct: 687 at 686

---

>gb|AF009037.1|AF009037 Ovis aries aquaporin 1 (aqp1) mRNA, complete cds
          Length = 823

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 242 gctccgatgaatggccccacccagaagatccagtggtc 279
           ||||||||||| ||||||||||||||||||||||||||
Sbjct: 672 gctccgatgaacggccccacccagaagatccagtggtc 635

---

>gb|BC105525.1| Bos taurus aquaporin 1, mRNA (cDNA clone MGC:129064 IMAGE:8121557),
           complete cds
          Length = 2703

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 242 gctccgatgaatggccccacccagaagatccagtggtc 279
           ||||||||||| ||||||||||||||||||||||||||
Sbjct: 681 gctccgatgaacggccccacccagaagatccagtggtc 644

---

>gb|S74759.1|S74759S1 water channel protein CHIP29 [cattle, ocular ciliary epithelium,
           mRNA, 1211 nt, segment 1 of 2]
          Length = 1211

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 242 gctccgatgaatggccccacccagaagatccagtggtc 279
           ||||||||||| ||||||||||||||||||||||||||
Sbjct: 697 gctccgatgaacggccccacccagaagatccagtggtc 660

---

>dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane intrinsic protein
           2;5, complete cds
          Length = 1126

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 251 aatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacg 310
           ||||||||||||||||||||||| ||||||||||| |||||  | |||||||| || || 
Sbjct: 795 aatggccccacccagaagatccaatggtcatcccaagccttgccattgttgtaaataaca 736

                                     
Query: 311 gcagctccgaagctccttgccgggtt 336
           || || || || ||||| ||||||||
Sbjct: 735 gccgcaccaaaactcctagccgggtt 710

---

>dbj|AB100870.1| Malus x domestica MdPIP1b mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1223

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||| |||||||||||||||||||| | |   ||||||||||| | |||||| |||
Sbjct: 874 acccagaatatccagtggtcatcccaggcatgccgcttgttgtagatgatggcagcgccg 815

                                             
Query: 320 aagctccttgccgggttgatgccggtgccggtga 353
           |  ||||| || ||||||||||| || |||||||
Sbjct: 814 agactcctggctgggttgatgccagttccggtga 781

---

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||| |||||||||||||||||||| | ||  ||||||||||| | |||||| || 
Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatgatggcagcgcca 819

                                             
Query: 320 aagctccttgccgggttgatgccggtgccggtga 353
           |  || ||||| ||||||||||| || |||||||
Sbjct: 818 agacttcttgctgggttgatgccagttccggtga 785

---

>gb|AF028005.1|AF028005 Bos taurus water channel protein CHIP29 mRNA, complete cds
          Length = 826

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 37/38 (97%)
 Strand = Plus / Minus

                                                 
Query: 242 gctccgatgaatggccccacccagaagatccagtggtc 279
           ||||||||||| ||||||||||||||||||||||||||
Sbjct: 675 gctccgatgaacggccccacccagaagatccagtggtc 638

---

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 98/118 (83%), Gaps = 1/118 (0%)
 Strand = Plus / Minus

                                                                       
Query: 243 ctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgt 302
           |||| |||||||| || |||||||||||||||||||||| ||| ||||  || |||||||
Sbjct: 832 ctccaatgaatggtccaacccagaagatccagtggtcattccatgcctcgtctttgttgt 773

                                                                     
Query: 303 agatcacggcagctccgaagctccttgc-cgggttgatgccggtgccggtgattggga 359
           |||| |  |||||||| |  ||||| ||  |||||||| || || |||||||||||||
Sbjct: 772 agatgatagcagctccaagactcctggcaggggttgataccagttccggtgattggga 715

---

>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds
          Length = 1217

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 97/118 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||||||||| || || |||||||| |||||||| |||||||| || |   | ||||||
Sbjct: 823 gctccgatgaagggtccaacccagaaaatccagtgatcatcccaagcgtggcccttgttg 764

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
            |||| |  ||||| ||||  |||||||| |||||||||||||| || ||||||||||
Sbjct: 763 aagatgatagcagcaccgagactccttgctgggttgatgccggttccagtgattggga 706

---

>emb|AJ001416.1|NTAQUAPOR Nicotiana tabacum mRNA for aquaporin 1
          Length = 1204

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| |||||||| || ||||| |||||||||||||| ||||| ||||  ||  |||||
Sbjct: 872 gctccaatgaatggtccaacccaaaagatccagtggtcgtcccatgcctggtctgtgttg 813

                                                                
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
           ||||| |  |||||||| |  ||||| || ||||||||||| || ||||||||
Sbjct: 812 tagatgatcgcagctccaagactcctagcggggttgatgccagttccggtgat 760

---

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                          
Query: 275    tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccggg 334
              ||||||||||| |||||||||||||||||||| || ||||| || ||||| || || |||
Sbjct: 164524 tggtcatcccacgccttctcgttgttgtagataacagcagcaccaaagcttctagctggg 164465

                   
Query: 335    ttgat 339
              |||||
Sbjct: 164464 ttgat 164460

---

>emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BAC clone  T12J5 (ESSAII
             project)
          Length = 84499

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                         
Query: 275   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccggg 334
             ||||||||||| |||||||||||||||||||| || ||||| || ||||| || || |||
Sbjct: 34602 tggtcatcccacgccttctcgttgttgtagataacagcagcaccaaagcttctagctggg 34543

                  
Query: 335   ttgat 339
             |||||
Sbjct: 34542 ttgat 34538

---

>emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BAC clone M4E13 (ESSAII project)
          Length = 80346

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                         
Query: 275   tggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccggg 334
             ||||||||||| |||||||||||||||||||| || ||||| || ||||| || || |||
Sbjct: 65557 tggtcatcccacgccttctcgttgttgtagataacagcagcaccaaagcttctagctggg 65498

                  
Query: 335   ttgat 339
             |||||
Sbjct: 65497 ttgat 65493

---

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                    
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggc 288
           |||||||| || |||||||||||||||||||||||||||||
Sbjct: 782 atgaatggtccaacccagaagatccagtggtcatcccaggc 742

---

>gb|AF367457.1| Prunus persica clone Mip1 membrane intrinsic protein (mip1) mRNA,
           partial cds
          Length = 495

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 271 ccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgc 330
           |||||||||||||||||| || ||||||||| | ||||| ||||  || |||||||||||
Sbjct: 495 ccagtggtcatcccaggctttttcgttgttgaaaatcacagcaggaccaaagctccttgc 436

                    
Query: 331 cgggttgat 339
            ||||||||
Sbjct: 435 tgggttgat 427

---

>dbj|AK109439.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H08, full
           insert sequence
          Length = 1247

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 254 ggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggca 313
           |||||||||||||||||||||||||| | ||| ||    |  | |||||| | |||||| 
Sbjct: 804 ggccccacccagaagatccagtggtctttccaagctgcgtgctggttgtacagcacggcg 745

                                                    
Query: 314 gctccgaagctccttgccgggttgatgccggtgccggtgat 354
           || |||| |||||| |||||||||||||| |||||||||||
Sbjct: 744 gcgccgaggctcctcgccgggttgatgcccgtgccggtgat 704

---

>dbj|AK104786.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D11, full
           insert sequence
          Length = 1249

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 254 ggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggca 313
           |||||||||||||||||||||||||| | ||| ||    |  | |||||| | |||||| 
Sbjct: 802 ggccccacccagaagatccagtggtctttccaagctgcgtgctggttgtacagcacggcg 743

                                                    
Query: 314 gctccgaagctccttgccgggttgatgccggtgccggtgat 354
           || |||| |||||| |||||||||||||| |||||||||||
Sbjct: 742 gcgccgaggctcctcgccgggttgatgcccgtgccggtgat 702

---

>dbj|AK067792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013118N06, full
           insert sequence
          Length = 1302

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 254 ggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggca 313
           |||||||||||||||||||||||||| | ||| ||    |  | |||||| | |||||| 
Sbjct: 797 ggccccacccagaagatccagtggtctttccaagctgcgtgctggttgtacagcacggcg 738

                                                    
Query: 314 gctccgaagctccttgccgggttgatgccggtgccggtgat 354
           || |||| |||||| |||||||||||||| |||||||||||
Sbjct: 737 gcgccgaggctcctcgccgggttgatgcccgtgccggtgat 697

---

>gb|AF024511.1|AF024511 Nicotiana tabacum aquaporin 1 mRNA, complete cds
          Length = 1158

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| |||||||| || ||||| |||||||||||||| ||||| ||||  ||  |||||
Sbjct: 872 gctccaatgaatggtccaacccaaaagatccagtggtcgtcccatgcctggtctgtgttg 813

                                                                
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
           ||||| |  |||||||| |  ||||| || ||||||||||| || ||||||||
Sbjct: 812 tagatgatcgcagctccaagactcctagcggggttgatgccagttccggtgat 760

---

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 117/145 (80%)
 Strand = Plus / Minus

                                                                       
Query: 209 aggacgtactggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaag 268
           |||| ||||||||||||  | | ||| | |||||| |||||||| || || |||||||||
Sbjct: 822 aggatgtactggtggtaaaccgtggccacggcggcgccgatgaacgggccaacccagaag 763

                                                                       
Query: 269 atccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctcctt 328
           ||||| ||||| ||||| |||||  ||   ||||| | |||||| || || |||||||||
Sbjct: 762 atccactggtcgtcccaagccttgccgccattgtacaccacggcggcgccaaagctcctt 703

                                    
Query: 329 gccgggttgatgccggtgccggtga 353
           || || ||||| ||||| |||||||
Sbjct: 702 gctggattgatcccggttccggtga 678

---

>dbj|AB002148.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1116

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| |||||||| || ||||| |||||||||||||| ||||| || |  |||| ||||
Sbjct: 865 gctccaatgaatggtccaacccaaaagatccagtggtcgtcccatgcatgttcgtcgttg 806

                                                                
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgat 354
           ||||| |  |||||||| |  ||||| || ||||||||||| || ||||||||
Sbjct: 805 tagatgatcgcagctccaagactcctagcggggttgatgccagttccggtgat 753

---

>gb|AY611006.1| Xerophyta humilis isolate HC398 PIP1 aquaporin mRNA, partial cds
          Length = 502

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||||||||||||||| |||||||| ||||| ||||||||||| || |      |||||
Sbjct: 125 gctccgatgaatggcccaacccagaaaatccaatggtcatcccatgcatgacttctgttg 66

                                                       
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggt 345
           ||||| |  |||||||||| |||||  || ||||||||||||||
Sbjct: 65  tagatgatagcagctccgaggctccgagcagggttgatgccggt 22

---

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           |||||||||||||||||||  ||||||||||| || | ||||||||| || || ||||| 
Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagataacagcggctccc 712

                                                   
Query: 320 aagctccttgccgggttgatgccggtgccggtgattggga 359
           |  ||||| || ||||||||||| || || ||||| ||||
Sbjct: 711 agactcctagcagggttgatgccagttccagtgatgggga 672

---

>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete
             sequence
          Length = 96827

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                         
Query: 278   tcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggttg 337
             |||||||| ||||| |  ||||||||||| ||||||||||| || ||||| |||||||| 
Sbjct: 65642 tcatcccaagccttttgattgttgtagatgacggcagctccaaaactcctagccgggttt 65583

                                 
Query: 338   atgccggtgccggtgattgg 357
             || |||||||| || |||||
Sbjct: 65582 attccggtgccagtaattgg 65563

---

>gb|AF452014.1|AF452014 Petunia x hybrida aquaporin-like protein (PIP2;3) mRNA, complete
           cds
          Length = 1279

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                       
Query: 260 acccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagctccg 319
           ||||| |||||||| ||||| | ||| || || || | |||| |||| ||||||||||| 
Sbjct: 797 acccaaaagatccaatggtctttccaagctttgtcttggttgaagataacggcagctcca 738

                                           
Query: 320 aagctccttgccgggttgatgccggtgccggt 351
           |  |||||||| ||||||||||||||||||||
Sbjct: 737 agactccttgctgggttgatgccggtgccggt 706

---

>gb|AY496102.1| Capsicum annuum Vip2 protein mRNA, complete cds
          Length = 358

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatc 307
           |||||||| || |||||||||||||||||||||||||| ||    ||| |||||||||| 
Sbjct: 103 atgaatggtccaacccagaagatccagtggtcatcccatgctgcatcggtgttgtagatg 44

                                              
Query: 308 acggcagctccgaagctccttgccgggttgatgcc 342
           |  |||||||| |  ||||| || |||||||||||
Sbjct: 43  atagcagctcctagactcctggcggggttgatgcc 9

---

>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds
          Length = 1278

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 97/119 (81%)
 Strand = Plus / Minus

                                                                       
Query: 239 gcggctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttg 298
           ||||| || ||||| || || |||||||| ||||| ||||||||||| ||||| || |||
Sbjct: 910 gcggcaccaatgaagggtccgacccagaaaatccattggtcatcccatgccttatccttg 851

                                                                      
Query: 299 ttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
              |||||||| |||||||||||||| |  ||||| || || || || |||||||||||
Sbjct: 850 ccatagatcacagcagctccgaagcttcgagccggattaataccagttccggtgattgg 792

---

>emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic protein 1
          Length = 1108

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                      
Query: 248 atgaatggccccacccagaagatccagtggtcatcccaggcct 290
           |||||||| || |||||||||||||||||||||||||| ||||
Sbjct: 875 atgaatggtccaacccagaagatccagtggtcatcccatgcct 833

---

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           ||||||||||| || ||||| |||| ||| ||||||||||| || || || |||||| ||
Sbjct: 812 ccgatgaatggtccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaag 753

                                              
Query: 305 atcacggcagctccgaagctccttgccgggttgat 339
           || | ||||||||| |  |||||||| ||||||||
Sbjct: 752 atgatggcagctccaagactccttgctgggttgat 718

---

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                         
Query: 297   tgttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattg 356
             |||||||||| | |||||| || | |||||| || ||||||||||||||||||||||| |
Sbjct: 28000 tgttgtagatgatggcagcgccaaggctcctcgctgggttgatgccggtgccggtgatgg 27941

                
Query: 357   gga 359
             |||
Sbjct: 27940 gga 27938

---

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||||||| || ||||||||||| ||||| || ||||||||||| |  || |||||||||
Sbjct: 473 ccgatgaagggtcccacccagaatatccaatgttcatcccaggcttgatccttgttgtag 414

                                                                  
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || |  || || || | |||||| || |||||||| ||||| || ||||||||||
Sbjct: 413 atgattgcggcaccaaggctcctggcggggttgataccggtacctgtgattggga 359

---

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           |||||||| || ||||||||||| ||||| || ||||||||||| |  || |||||||||
Sbjct: 803 ccgatgaagggtcccacccagaatatccaatgttcatcccaggcttgatccttgttgtag 744

                                                                  
Query: 305 atcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           || |  || || || | |||||| || |||||||| ||||| || ||||||||||
Sbjct: 743 atgattgcggcaccaaggctcctggcggggttgataccggtacctgtgattggga 689

---

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                       
Query: 245 ccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtag 304
           ||||||||||| || ||||| |||| ||| ||||||||||| || || || |||||| ||
Sbjct: 813 ccgatgaatggtccaacccaaaagacccaatggtcatcccaagcgttgtccttgttgaag 754

                                              
Query: 305 atcacggcagctccgaagctccttgccgggttgat 339
           || | ||||||||| |  |||||||| ||||||||
Sbjct: 753 atgatggcagctccaagactccttgctgggttgat 719

---

>gb|AF326490.1|AF326490 Zea mays plasma membrane integral protein ZmPIP1-6 mRNA, complete cds
          Length = 1325

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                        
Query: 257  cccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacggcagct 316
            ||||||||||||||||||||| | | |||  | | |  ||||| |||||| | ||| || 
Sbjct: 1007 cccacccagaagatccagtggccgtgccacccgtgcgggttgtcgtagatgatggcggcg 948

                                                       
Query: 317  ccgaagctccttgccgggttgatgccggtgccggtgattggga 359
            |||| |||||| || ||||||||||||||||||||||| ||||
Sbjct: 947  ccgaggctcctggcggggttgatgccggtgccggtgatgggga 905

---

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtg 276
           ||||||||||  ||| || | |||||| |||||||| || || |||||||||||||| ||
Sbjct: 940 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 881

                                                                       
Query: 277 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggtt 336
           |||   ||| || |  ||   ||||||||| | ||| || || | |||||| ||||||||
Sbjct: 880 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 821

                                  
Query: 337 gatgccggtgccggtgattggga 359
           |||||||||||||||||| ||||
Sbjct: 820 gatgccggtgccggtgatgggga 798

---

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtg 276
           ||||||||||  ||| || | |||||| |||||||| || || |||||||||||||| ||
Sbjct: 935 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 876

                                                                       
Query: 277 gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggtt 336
           |||   ||| || |  ||   ||||||||| | ||| || || | |||||| ||||||||
Sbjct: 875 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 816

                                  
Query: 337 gatgccggtgccggtgattggga 359
           |||||||||||||||||| ||||
Sbjct: 815 gatgccggtgccggtgatgggga 793

---

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                        
Query: 217  ctggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagtg 276
            ||||||||||  ||| || | |||||| |||||||| || || |||||||||||||| ||
Sbjct: 1264 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccaatg 1205

                                                                        
Query: 277  gtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgggtt 336
            |||   ||| || |  ||   ||||||||| | ||| || || | |||||| ||||||||
Sbjct: 1204 gtcgctccacgcatgatcccggttgtagatgatggcggcgccaaggctcctagccgggtt 1145

                                   
Query: 337  gatgccggtgccggtgattggga 359
            |||||||||||||||||| ||||
Sbjct: 1144 gatgccggtgccggtgatgggga 1122

---

>ref|NM_116008.2| Arabidopsis thaliana PIP1A; water channel AT3G61430 (PIP1A) mRNA,
           complete cds
          Length = 1254

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| ||||| || || ||||| || | |||||||||||||||||  |  || ||||||
Sbjct: 980 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 921

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| |  |||||||| | ||| || || ||||||||||| ||||| ||||||||||
Sbjct: 920 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattggga 863

---

>ref|XM_519026.1| PREDICTED: Pan troglodytes aquaporin 1 (LOC463330), mRNA
          Length = 1185

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                              
Query: 245  ccgatgaatggccccacccagaagatccagtggt 278
            ||||||||||||||||||||||| ||||||||||
Sbjct: 1031 ccgatgaatggccccacccagaaaatccagtggt 998

---

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 298 gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
           ||||||||  ||||| || ||||||||||| ||||| |||||||| ||||||||||| ||
Sbjct: 588 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 529

             
Query: 358 ga 359
           ||
Sbjct: 528 ga 527

---

>ref|NM_198098.1| Homo sapiens aquaporin 1 (Colton blood group) (AQP1), mRNA
          Length = 2764

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 245 ccgatgaatggccccacccagaagatccagtggt 278
           ||||||||||||||||||||||| ||||||||||
Sbjct: 713 ccgatgaatggccccacccagaaaatccagtggt 680

---

>gb|AY312581.1| Homo sapiens aquaporin 1 splice variant 3 (AQP1) mRNA, partial cds,
           alternatively spliced
          Length = 334

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 245 ccgatgaatggccccacccagaagatccagtggt 278
           ||||||||||||||||||||||| ||||||||||
Sbjct: 93  ccgatgaatggccccacccagaaaatccagtggt 60

---

>gb|AY312580.1| Homo sapiens aquaporin 1 splice variant 2 (AQP1) mRNA, partial cds,
           alternatively spliced
          Length = 472

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 245 ccgatgaatggccccacccagaagatccagtggt 278
           ||||||||||||||||||||||| ||||||||||
Sbjct: 93  ccgatgaatggccccacccagaaaatccagtggt 60

---

>gb|AY372191.1| Spinacia oleracea PIP1;2 (Pip1;2) mRNA, complete cds
          Length = 1248

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 242 gctccgatgaatggccccacccagaagatccagtggtc 279
           ||||| |||||||| |||||||||||||||||||||||
Sbjct: 842 gctccaatgaatggtcccacccagaagatccagtggtc 805

---

>gb|BC022486.1| Homo sapiens aquaporin 1 (Colton blood group), mRNA (cDNA clone
           MGC:26324 IMAGE:4799283), complete cds
          Length = 2764

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 245 ccgatgaatggccccacccagaagatccagtggt 278
           ||||||||||||||||||||||| ||||||||||
Sbjct: 713 ccgatgaatggccccacccagaaaatccagtggt 680

---

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                         
Query: 274   gtggtcatcccaggccttctcgttgttgtagatcacggcagctccgaagctccttgccgg 333
             |||||| ||||| |||||||  | ||||||||| ||||| || |||| |||||  || ||
Sbjct: 91203 gtggtcgtcccatgccttcttctggttgtagatgacggcggcgccgatgctccgggcagg 91262

                                       
Query: 334   gttgatgccggtgccggtgattggga 359
             ||||||||| ||||||||||| ||||
Sbjct: 91263 gttgatgcccgtgccggtgatgggga 91288



 Score = 48.1 bits (24), Expect = 0.020
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 242   gctccgatgaatggccccacccagaagatcca 273
             ||||||||||| |||||| |||||||||||||
Sbjct: 91088 gctccgatgaacggccccgcccagaagatcca 91119

---

>emb|AJ289701.1|VFA289701 Vicia faba mRNA for aquaporin (aq1 gene)
          Length = 995

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| ||||| || || ||||| || | |||||||||||||||||  |  || ||||||
Sbjct: 884 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 825

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| |  |||||||| | ||| || || ||||||||||| ||||| ||||||||||
Sbjct: 824 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattggga 767

---

>emb|CR859936.1| Pongo pygmaeus mRNA; cDNA DKFZp469G0320 (from clone DKFZp469G0320)
          Length = 2784

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 245 ccgatgaatggccccacccagaagatccagtggt 278
           ||||||||||||||||||||||| ||||||||||
Sbjct: 713 ccgatgaatggccccacccagaaaatccagtggt 680

---

>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete
             sequence
          Length = 178692

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                         
Query: 298   gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
             ||||||||  ||||| || ||||||||||| ||||| |||||||| ||||||||||| ||
Sbjct: 47653 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 47712

               
Query: 358   ga 359
             ||
Sbjct: 47713 ga 47714

---

>emb|CR617260.1| full-length cDNA clone CS0DI057YC23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 2469

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 245 ccgatgaatggccccacccagaagatccagtggt 278
           ||||||||||||||||||||||| ||||||||||
Sbjct: 702 ccgatgaatggccccacccagaaaatccagtggt 669

---

>gb|AY097398.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds
          Length = 861

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| ||||| || || ||||| || | |||||||||||||||||  |  || ||||||
Sbjct: 797 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 738

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| |  |||||||| | ||| || || ||||||||||| ||||| ||||||||||
Sbjct: 737 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattggga 680

---

>gb|AF480415.1| Homo sapiens aquaporin 1 (AQP1) gene, partial cds
          Length = 810

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 245 ccgatgaatggccccacccagaagatccagtggt 278
           ||||||||||||||||||||||| ||||||||||
Sbjct: 644 ccgatgaatggccccacccagaaaatccagtggt 611

---

>gb|AF452012.1|AF452012 Petunia x hybrida aquaporin-like protein (PIP2;1) mRNA, complete
           cds
          Length = 1168

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 72/86 (83%)
 Strand = Plus / Minus

                                                                       
Query: 251 aatggccccacccagaagatccagtggtcatcccaggccttctcgttgttgtagatcacg 310
           ||||| || ||||| |||||||| |||||||||||| | || || |||||||| || || 
Sbjct: 797 aatggtccaacccaaaagatccaatggtcatcccagactttgtcattgttgtaaatgaca 738

                                     
Query: 311 gcagctccgaagctccttgccgggtt 336
           |||||||| |||||||| || |||||
Sbjct: 737 gcagctccaaagctcctagcagggtt 712

---

>gb|AY058113.1| Arabidopsis thaliana AT3g61430/F2A19_30 mRNA, complete cds
          Length = 1092

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| ||||| || || ||||| || | |||||||||||||||||  |  || ||||||
Sbjct: 864 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 805

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| |  |||||||| | ||| || || ||||||||||| ||||| ||||||||||
Sbjct: 804 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattggga 747

---

>gb|U41518.1|HSU41518 Human channel-like integral membrane protein (AQP-1) mRNA, clone
           AQP-1-2344, partial cds
          Length = 2344

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 245 ccgatgaatggccccacccagaagatccagtggt 278
           ||||||||||||||||||||||| ||||||||||
Sbjct: 307 ccgatgaatggccccacccagaaaatccagtggt 274

---

>gb|S73482.1| uterine water channel=28 kda erythrocyte integral membrane protein
           homolog [human, uterus, mRNA, 1340 nt]
          Length = 1340

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 245 ccgatgaatggccccacccagaagatccagtggt 278
           ||||||||||||||||||||||| ||||||||||
Sbjct: 694 ccgatgaatggccccacccagaaaatccagtggt 661

---

>gb|AY034596.1| Macaca radiata aquaporin 1 mRNA, partial cds
          Length = 459

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 245 ccgatgaatggccccacccagaagatccagtggt 278
           ||||||||||||||||||||||| ||||||||||
Sbjct: 360 ccgatgaatggccccacccagaaaatccagtggt 327

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                            
Query: 298      gttgtagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattgg 357
                ||||||||  ||||| || ||||||||||| ||||| |||||||| ||||||||||| ||
Sbjct: 17626978 gttgtagacgacggcggcgccgaagctcctcgccggattgatgcccgtgccggtgatcgg 17626919

                  
Query: 358      ga 359
                ||
Sbjct: 17626918 ga 17626917

---

>emb|BX824874.1|CNS0A5T5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH79ZH01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| ||||| || || ||||| || | |||||||||||||||||  |  || ||||||
Sbjct: 735 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 676

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| |  |||||||| | ||| || || ||||||||||| ||||| ||||||||||
Sbjct: 675 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattggga 618

---

>emb|BX823595.1|CNS0A5AA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS55ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1059

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| ||||| || || ||||| || | |||||||||||||||||  |  || ||||||
Sbjct: 843 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 784

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| |  |||||||| | ||| || || ||||||||||| ||||| ||||||||||
Sbjct: 783 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattggga 726

---

>gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence
          Length = 1100

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 actggtggtaggcggcggcaatggcggctccgatgaatggccccacccagaagatccagt 275
           ||||||||||| |||||||   |  |||||||||||| || ||||||||||| |||||||
Sbjct: 851 actggtggtagacggcggcggcgaaggctccgatgaagggacccacccagaaaatccagt 792

                     
Query: 276 ggtcatccca 285
           | ||||||||
Sbjct: 791 gttcatccca 782

---

>gb|AY088439.1| Arabidopsis thaliana clone 6690 mRNA, complete sequence
          Length = 1234

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| ||||| || || ||||| || | |||||||||||||||||  |  || ||||||
Sbjct: 980 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 921

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| |  |||||||| | ||| || || ||||||||||| ||||| ||||||||||
Sbjct: 920 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattggga 863

---

>gb|AF188843.1|AF188843 Vitis vinifera cultivar Pinot Noir plasma membrane aquaporin
           (PIP1a) mRNA, complete cds
          Length = 1129

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| ||||| || ||||||||||| |||||   |||||||||||| | |||  |||||
Sbjct: 851 gctccaatgaagggtcccacccagaaaatccacatgtcatcccaggcatgctctctgttg 792

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| | ||| || || |  ||||| || |||||||||||||| |||||||| ||||
Sbjct: 791 tagatgatggcggcccccagactcctagcagggttgatgccggttccggtgatgggga 734

---

>gb|AF266760.1|AF266760 Vicia faba plasma membrane aquaporin mRNA, complete cds
          Length = 920

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 242 gctccgatgaatggccccacccagaagatccagtggtcatcccaggccttctcgttgttg 301
           ||||| ||||| || || ||||| || | |||||||||||||||||  |  || ||||||
Sbjct: 843 gctccaatgaaggggccaacccaaaacacccagtggtcatcccaggaatggtctttgttg 784

                                                                     
Query: 302 tagatcacggcagctccgaagctccttgccgggttgatgccggtgccggtgattggga 359
           ||||| |  |||||||| | ||| || || ||||||||||| ||||| ||||||||||
Sbjct: 783 tagatgattgcagctccaaggcttctagctgggttgatgcctgtgccagtgattggga 726


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,207,356
Number of Sequences: 3902068
Number of extensions: 3207356
Number of successful extensions: 73696
Number of sequences better than 10.0: 465
Number of HSP's better than 10.0 without gapping: 466
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 72659
Number of HSP's gapped (non-prelim): 977
length of query: 359
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 337
effective length of database: 17,147,199,772
effective search space: 5778606323164
effective search space used: 5778606323164
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---