>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome
          Length = 3304561

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 210     acgaaagccggttccgcagcg 230
               |||||||||||||||||||||
Sbjct: 2752173 acgaaagccggttccgcagcg 2752153

>gb|AC161285.2| Pan troglodytes BAC clone CH251-310B11 from chromosome 7, complete
             sequence
          Length = 171038

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 113   aaattaaaggtaaaagagtt 132
             ||||||||||||||||||||
Sbjct: 13475 aaattaaaggtaaaagagtt 13456

>gb|AC161473.5| Pan troglodytes BAC clone CH251-460F23 from chromosome 7, complete
             sequence
          Length = 170605

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 113   aaattaaaggtaaaagagtt 132
             ||||||||||||||||||||
Sbjct: 98334 aaattaaaggtaaaagagtt 98315

>gb|AC130713.4| Mus musculus BAC clone RP23-316K10 from chromosome 15, complete
             sequence
          Length = 192020

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 140   tagctctctgtgttttcaca 159
             ||||||||||||||||||||
Sbjct: 64340 tagctctctgtgttttcaca 64359

>emb|CR656067.2|CNS0F56X Tetraodon nigroviridis full-length cDNA
          Length = 378

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   gagcagcaaaacacatattt 20
           ||||||||||||||||||||
Sbjct: 335 gagcagcaaaacacatattt 354

>gb|AC142302.1| Pan troglodytes BAC clone RP43-128I16 from 7, complete sequence
          Length = 161986

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 113    aaattaaaggtaaaagagtt 132
              ||||||||||||||||||||
Sbjct: 135089 aaattaaaggtaaaagagtt 135108

>emb|CR812472.9| Zebrafish DNA sequence from clone DKEY-110G7 in linkage group 3,
             complete sequence
          Length = 194804

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 165   aaatgtgcttaaaaatccct 184
             ||||||||||||||||||||
Sbjct: 46206 aaatgtgcttaaaaatccct 46187

>emb|AL133461.10| Human DNA sequence from clone RP11-359E7 on chromosome 10 Contains the
             3' end of the SAC2 gene for Sac domain-containing inositol
             phosphatase 2, a novel gene (FLJ13081), the 5' end of the
             SEC23IP gene for SEC23 interacting protein, a novel gene
             and three CpG islands, complete sequence
          Length = 124328

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 145   ctctgtgttttcacaaagta 164
             ||||||||||||||||||||
Sbjct: 35480 ctctgtgttttcacaaagta 35461

>emb|AL645764.15| Mouse DNA sequence from clone RP23-290B5 on chromosome 11 Contains the 5'
              end of the gene for a novel protein (9330163N21Rik), a
              ribosomal protein S2 (Rps2) pseudogene, the gene for a
              novel protein (E130018012Rik), the gene for a novel protein
              (6820428D13Rik), the Mrpl27 gene for mitochondrial
              ribosomal protein L27, the Xylt2 gene for
              xylosyltransferase II, a novel gene (5330426M11Rik), the
              gene for a novel protein (C230057C09Rik), the gene for a
              novel protein similar to Cdc34 and two pseudogenes similar
              to hypothetical protein Tr:Q8C517, complete sequence
          Length = 203262

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 155    tcacaaagtaaaatgtgctt 174
              ||||||||||||||||||||
Sbjct: 113351 tcacaaagtaaaatgtgctt 113370

>gb|AC027672.12| Homo sapiens chromosome 10 clone RP11-198M6, complete sequence
          Length = 187229

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 145    ctctgtgttttcacaaagta 164
              ||||||||||||||||||||
Sbjct: 183859 ctctgtgttttcacaaagta 183878

>emb|BX936464.7| Zebrafish DNA sequence from clone DKEY-246O4 in linkage group 18,
             complete sequence
          Length = 167114

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 174   taaaaatccctcctatttta 193
             ||||||||||||||||||||
Sbjct: 33412 taaaaatccctcctatttta 33393

>gb|AC151582.3| Pan troglodytes BAC clone RP43-3F18 from chromosome 7, complete sequence
          Length = 197992

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 113    aaattaaaggtaaaagagtt 132
              ||||||||||||||||||||
Sbjct: 156847 aaattaaaggtaaaagagtt 156828

>dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete genome
          Length = 3544776

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 223     ccgcagcggttcggacgctc 242
               ||||||||||||||||||||
Sbjct: 2644804 ccgcagcggttcggacgctc 2644823

>gb|AE017198.1| Lactobacillus johnsonii NCC 533, complete genome
          Length = 1992676

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 112    aaaattaaaggtaaaagagt 131
              ||||||||||||||||||||
Sbjct: 540893 aaaattaaaggtaaaagagt 540912

>emb|CT573076.1| Medicago truncatula chromosome 5 clone mth2-181d5, COMPLETE SEQUENCE
          Length = 89591

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 150  tgttttcacaaagtaaaatg 169
            ||||||||||||||||||||
Sbjct: 2420 tgttttcacaaagtaaaatg 2439


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,050,025
Number of Sequences: 3902068
Number of extensions: 3050025
Number of successful extensions: 62530
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62481
Number of HSP's gapped (non-prelim): 49
length of query: 329
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 307
effective length of database: 17,147,199,772
effective search space: 5264190330004
effective search space used: 5264190330004
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)