>gb|AC115910.6| Mus musculus, clone RP24-480O17, complete sequence
          Length = 257036

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 257   cataattaagcatcaggact 276
             ||||||||||||||||||||
Sbjct: 85058 cataattaagcatcaggact 85077

>emb|AL359914.14| Human DNA sequence from clone RP11-637B23 on chromosome X Contains a H3
              histone, family 3B (H3F3B) pseudogene, the BMP15 gene for
              bone morphogenetic protein 15, and a high-mobility group
              box 1 (HMGB1) pseudogene, complete sequence
          Length = 125495

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 197    ttattctgcctgtcagctgg 216
              ||||||||||||||||||||
Sbjct: 124807 ttattctgcctgtcagctgg 124788

>emb|AL354949.10| Human DNA sequence from clone RP11-82L20 on chromosome 1 Contains part of
              the NEGR1 gene for neuronal growth regulator 1 and a novel
              gene, complete sequence
          Length = 180569

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 143    tgctttgtttaatctgcttt 162
              ||||||||||||||||||||
Sbjct: 167724 tgctttgtttaatctgcttt 167743

>emb|AL929442.9| Mouse DNA sequence from clone RP23-95M20 on chromosome 4, complete
              sequence
          Length = 176578

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     agatagataggtactaccca 66
              ||||||||||||||||||||
Sbjct: 112282 agatagataggtactaccca 112301

>gb|AC156637.2| Mus musculus BAC clone RP24-241I18 from chromosome 12, complete sequence
          Length = 156014

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 257    cataattaagcatcaggact 276
              ||||||||||||||||||||
Sbjct: 115193 cataattaagcatcaggact 115212

>dbj|AK043962.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length
           enriched library, clone:A830060H14
           product:unclassifiable, full insert sequence
          Length = 1586

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 257 cataattaagcatcaggact 276
           ||||||||||||||||||||
Sbjct: 681 cataattaagcatcaggact 662

>emb|AL928621.16| Mouse DNA sequence from clone RP23-401G6 on chromosome 2, complete
              sequence
          Length = 174248

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 144    gctttgtttaatctgctttg 163
              ||||||||||||||||||||
Sbjct: 114203 gctttgtttaatctgctttg 114184


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,823,588
Number of Sequences: 3902068
Number of extensions: 2823588
Number of successful extensions: 43540
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43531
Number of HSP's gapped (non-prelim): 9
length of query: 352
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 330
effective length of database: 17,147,199,772
effective search space: 5658575924760
effective search space used: 5658575924760
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)