ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart59f03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009394.1| Triticum aestivum clone wlm96.pk037.m21:fis, full... 182 5e-43
2ref|XM_483167.1| Oryza sativa (japonica cultivar-group), mRNA 145 1e-31
3ref|XM_507591.1| PREDICTED Oryza sativa (japonica cultivar-group... 145 1e-31
4ref|XM_507281.2| PREDICTED Oryza sativa (japonica cultivar-group... 145 1e-31
5gb|AY644637.1| Oryza sativa (japonica cultivar-group) caffeoyl-C... 145 1e-31
6dbj|AB110168.1| Oryza sativa (japonica cultivar-group) mRNA for ... 145 1e-31
7dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 145 1e-31
8dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic D... 145 1e-31
9dbj|AK104801.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
10dbj|AK104326.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
11dbj|AK071482.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
12gb|AY108449.1| Zea mays PCO131734 mRNA sequence 113 4e-22
13gb|BT009389.1| Triticum aestivum clone wlm96.pk036.e8:fis, full ... 76 8e-11
14emb|AJ242980.1|ZMA242980 Zea mays mRNA for Caffeoyl CoA O-methyl... 74 3e-10
15gb|BT009186.1| Triticum aestivum clone wl1n.pk0141.a9:fis, full ... 74 3e-10
16gb|AY104406.1| Zea mays PCO108855 mRNA sequence 74 3e-10
17gb|AY098515.1| Ananas comosus caffeoyl CoA O-methyltransferase m... 74 3e-10
18gb|AY323271.1| Zea mays genotype Quebec28 caffeoyl-CoA 3-O-methy... 74 3e-10
19gb|AY323270.1| Zea mays genotype Sibiriacka caffeoyl-CoA 3-O-met... 74 3e-10
20gb|AY323269.1| Zea mays genotype PolarDent caffeoyl-CoA 3-O-meth... 74 3e-10
21gb|AY323268.1| Zea mays genotype RainbowFlint caffeoyl-CoA 3-O-m... 74 3e-10
22gb|AY323267.1| Zea mays genotype NoordlanderVC145 caffeoyl-CoA 3... 74 3e-10
23gb|AY323266.1| Zea mays genotype RottalerSilomais caffeoyl-CoA 3... 74 3e-10
24gb|AY323265.1| Zea mays genotype Du101 caffeoyl-CoA 3-O-methyltr... 74 3e-10
25gb|AY323264.1| Zea mays genotype W64A caffeoyl-CoA 3-O-methyltra... 74 3e-10
26gb|AY323263.1| Zea mays genotype line16 (private BIOGEMMA line) ... 74 3e-10
27gb|AY323262.1| Zea mays genotype line212 (private BIOGEMMA line)... 74 3e-10
28gb|AY323261.1| Zea mays genotype F66 caffeoyl-CoA 3-O-methyltran... 74 3e-10
29gb|AY323260.1| Zea mays genotype F113 caffeoyl-CoA 3-O-methyltra... 74 3e-10
30gb|AY323259.1| Zea mays genotype EP1 caffeoyl-CoA 3-O-methyltran... 74 3e-10
31gb|AY323258.1| Zea mays genotype B14 caffeoyl-CoA 3-O-methyltran... 74 3e-10
32gb|AY323257.1| Zea mays genotype wis93-3520 caffeoyl-CoA 3-O-met... 74 3e-10
33gb|AY323256.1| Zea mays genotype F7 caffeoyl-CoA 3-O-methyltrans... 74 3e-10
34gb|AY323255.1| Zea mays genotype Wis94-443 caffeoyl-CoA 3-O-meth... 74 3e-10
35gb|AY323254.1| Zea mays genotype F1 caffeoyl-CoA 3-O-methyltrans... 74 3e-10
36gb|AY323253.1| Zea mays genotype Mo17 caffeoyl-CoA 3-O-methyltra... 74 3e-10
37gb|AY323252.1| Zea mays genotype DE811 caffeoyl-CoA 3-O-methyltr... 74 3e-10
38gb|AY323251.1| Zea mays genotype B73 caffeoyl-CoA 3-O-methyltran... 74 3e-10
39gb|AY323250.1| Zea mays genotype F324 caffeoyl-CoA 3-O-methyltra... 74 3e-10
40gb|AY323249.1| Zea mays genotype Lan496 caffeoyl-CoA 3-O-methylt... 74 3e-10
41gb|AY323248.1| Zea mays genotype MBS847 caffeoyl-CoA 3-O-methylt... 74 3e-10
42gb|AY323247.1| Zea mays genotype F4 caffeoyl-CoA 3-O-methyltrans... 74 3e-10
43gb|AY323246.1| Zea mays genotype F2 caffeoyl-CoA 3-O-methyltrans... 74 3e-10
44gb|AY323245.1| Zea mays genotype W117 caffeoyl-CoA 3-O-methyltra... 74 3e-10
45gb|AY323244.1| Zea mays genotype F7012 caffeoyl-CoA 3-O-methyltr... 74 3e-10
46gb|AY323243.1| Zea mays genotype F7025 caffeoyl-CoA 3-O-methyltr... 74 3e-10
47gb|AY323242.1| Zea mays genotype F288 caffeoyl-CoA 3-O-methyltra... 74 3e-10
48gb|AY323241.1| Zea mays genotype F271 caffeoyl-CoA 3-O-methyltra... 74 3e-10
49gb|AY323240.1| Zea mays genotype F64 caffeoyl-CoA 3-O-methyltran... 74 3e-10
50gb|AY323239.1| Zea mays genotype F286 caffeoyl-CoA 3-O-methyltra... 74 3e-10
51gb|AY323238.1| Zea mays genotype F564 caffeoyl-CoA 3-O-methyltra... 74 3e-10
52gb|AY644636.1| Oryza sativa (japonica cultivar-group) caffeoyl-C... 72 1e-09
53dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 72 1e-09
54dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic D... 72 1e-09
55dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic D... 72 1e-09
56dbj|AK065744.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 1e-09
57emb|AJ242981.1|ZMA242981 Zea mays mRNA for Caffeoyl CoA O-methyl... 66 8e-08
58gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase ... 66 8e-08
59gb|AY279034.1| Zea mays Mo17 caffeoyl CoA 3-O-methyltransferase ... 66 8e-08
60gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (... 66 8e-08
61gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferas... 66 8e-08
62gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (c... 66 8e-08
63gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransfera... 66 8e-08
64gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransf... 66 8e-08
65gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransfe... 66 8e-08
66gb|AY279027.1| Zea mays F113 caffeoyl CoA 3-O-methyltransferase ... 66 8e-08
67gb|AY279026.1| Zea mays De811 caffeoyl CoA 3-O-methyltransferase... 66 8e-08
68gb|AY279025.1| Zea mays Du101 caffeoyl CoA 3-O-methyltransferase... 66 8e-08
69gb|AY279024.1| Zea mays B14 caffeoyl CoA 3-O-methyltransferase (... 66 8e-08
70gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (... 66 8e-08
71gb|AY279022.1| Zea mays B73 caffeoyl CoA 3-O-methyltransferase (... 66 8e-08
72gb|AY279021.1| Zea mays Lan496 caffeoyl CoA 3-O-methyltransferas... 66 8e-08
73gb|AY279020.1| Zea mays F288 caffeoyl CoA 3-O-methyltransferase ... 66 8e-08
74gb|AY279019.1| Zea mays W117 caffeoyl CoA 3-O-methyltransferase ... 66 8e-08
75gb|AY279018.1| Zea mays MBS847 caffeoyl CoA 3-O-methyltransferas... 66 8e-08
76gb|AY279017.1| Zea mays F7012 caffeoyl CoA 3-O-methyltransferase... 66 8e-08
77gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase... 66 8e-08
78gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase ... 66 8e-08
79gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (c... 66 8e-08
80gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase ... 66 8e-08
81gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase ... 66 8e-08
82gb|AY279011.1| Zea mays F64 caffeoyl CoA 3-O-methyltransferase (... 66 8e-08
83gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransfer... 66 8e-08
84gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransf... 66 8e-08
85gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransfe... 66 8e-08
86gb|AY279007.1| Zea mays RainbowFlint caffeoyl CoA 3-O-methyltran... 66 8e-08
87gb|AY279006.1| Zea mays NoordlanderVC145 caffeoyl CoA 3-O-methyl... 66 8e-08
88gb|AY279005.1| Zea mays isolate 1 caffeoyl CoA 3-O-methyltransfe... 66 8e-08
89gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransfe... 66 8e-08
90dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 64 3e-07
91dbj|AP005633.3| Oryza sativa (japonica cultivar-group) genomic D... 64 3e-07
92dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic D... 64 3e-07
93dbj|AK108479.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 3e-07
94dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-CoA 3-O... 52 0.001
95ref|XM_507282.1| PREDICTED Oryza sativa (japonica cultivar-group... 50 0.005
96ref|XM_483170.1| Oryza sativa (japonica cultivar-group), mRNA 50 0.005
97ref|XM_483169.1| Oryza sativa (japonica cultivar-group), mRNA 50 0.005
98dbj|AK065515.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.005
99dbj|AK061757.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.005
100gb|AY104670.1| Zea mays PCO117754 mRNA sequence 50 0.005
101gb|AY644638.1| Oryza sativa (japonica cultivar-group) caffeoyl-C... 48 0.019
102dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 48 0.019
103dbj|AK106735.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.019
104gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.29
105gb|AC093952.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.29
106gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 44 0.29
107dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.29
108dbj|AK062452.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.29
109gb|AY697852.1| Perognathus flavescens apache voucher UIMNH 60543... 42 1.2
110gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 42 1.2
111gb|BT009093.1| Triticum aestivum clone wkm2c.pk005.b15:fis, full... 42 1.2
112emb|CR377201.10| Zebrafish DNA sequence from clone CH211-210H21 ... 42 1.2
113dbj|AB158406.1| Triticum aestivum CCoAMT mRNA for putative caffe... 42 1.2
114gb|AC147479.17| Mus musculus chromosome 17, clone RP24-178C19, c... 40 4.6
115gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 4.6
116gb|AC151292.2| Mus musculus BAC clone RP23-138P14 from chromosom... 40 4.6
117gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 40 4.6
118gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, co... 40 4.6
119gb|AF534906.1| Human adenovirus type 1 subgroup C, complete genome 40 4.6
120gb|AY657045.1| Synthetic construct Peudomonas aeruginosa clone F... 40 4.6
121gb|AC005550.1| Homo sapiens PAC clone RP4-620P6 from 7, complete... 40 4.6
122emb|AL591792.1|SME591792 Sinorhizobium meliloti 1021 complete ch... 40 4.6
123emb|AL606500.8| Human DNA sequence from clone RP11-274N19 on chr... 40 4.6
124emb|AL603964.2| Human DNA sequence from clone RP13-13L9 on chrom... 40 4.6
125emb|AL513342.7| Human DNA sequence from clone RP11-96F14 on chro... 40 4.6
126emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on ch... 40 4.6
127gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 40 4.6
128emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete ... 40 4.6
129emb|AJ417789.1|PSP417789 Polytomella sp. 'Pringsheim 198.80' mRN... 40 4.6
130gb|AC116105.12| Mus musculus chromosome 1, clone RP23-23A4, comp... 40 4.6
131gb|AC092118.3| Homo sapiens chromosome 16 clone CTD-2600O9, comp... 40 4.6
132gb|AC108068.3| Homo sapiens BAC clone RP11-574H22 from 2, comple... 40 4.6
133dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 4.6
134gb|AE004939.1| Pseudomonas aeruginosa PAO1, section 500 of 529 o... 40 4.6
135gb|AY007523.1| Pseudomonas fluorescens AlgH (algH), hypothetical... 40 4.6
136dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 4.6
137gb|J01917.1|ADRCG Adenovirus type 2, complete genome 40 4.6
138gb|U47294.2|CVU47294 Cloning vector pAdVantage, complete seq... 40 4.6
139dbj|AB070936.1| Streptomyces avermitilis siderophore biosyntheti... 40 4.6

>gb|BT009394.1| Triticum aestivum clone wlm96.pk037.m21:fis, full insert mRNA
           sequence
          Length = 953

 Score =  182 bits (92), Expect = 5e-43
 Identities = 101/104 (97%)
 Strand = Plus / Minus

                                                                       
Query: 241 cgcccgtctagacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaga 300
           |||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 816 cgcccgcctagacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcaga 757

                                                       
Query: 301 cctcgatgcgcgggtcggcggcgagcttggcgttgaggtccctg 344
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 756 cctcgatgcgcgggtcggcggcgagcttggcgttgaggtccctg 713



 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 148 aataatacaattgattaagggaagcggctggtaaggaa 185
           |||||||||||||||||||  |||||||||||||||||
Sbjct: 927 aataatacaattgattaagataagcggctggtaaggaa 890



to top

>ref|XM_483167.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 996

 Score =  145 bits (73), Expect = 1e-31
 Identities = 88/93 (94%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 825 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 766

                                            
Query: 312 gggtcggcggcgagcttggcgttgaggtccctg 344
           ||||||||||||||| ||| |||||||||||||
Sbjct: 765 gggtcggcggcgagcctggagttgaggtccctg 733



to top

>ref|XM_507591.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA
          Length = 1096

 Score =  145 bits (73), Expect = 1e-31
 Identities = 88/93 (94%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 832 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 773

                                            
Query: 312 gggtcggcggcgagcttggcgttgaggtccctg 344
           ||||||||||||||| ||| |||||||||||||
Sbjct: 772 gggtcggcggcgagcctggagttgaggtccctg 740



to top

>ref|XM_507281.2| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA
          Length = 1098

 Score =  145 bits (73), Expect = 1e-31
 Identities = 88/93 (94%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 834 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 775

                                            
Query: 312 gggtcggcggcgagcttggcgttgaggtccctg 344
           ||||||||||||||| ||| |||||||||||||
Sbjct: 774 gggtcggcggcgagcctggagttgaggtccctg 742



to top

>gb|AY644637.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA
            O-methyltransferase (COA20) gene, complete cds
          Length = 1158

 Score =  145 bits (73), Expect = 1e-31
 Identities = 88/93 (94%)
 Strand = Plus / Minus

                                                                        
Query: 252  acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
            |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 1054 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 995

                                             
Query: 312  gggtcggcggcgagcttggcgttgaggtccctg 344
            ||||||||||||||| ||| |||||||||||||
Sbjct: 994  gggtcggcggcgagcctggagttgaggtccctg 962



to top

>dbj|AB110168.1| Oryza sativa (japonica cultivar-group) mRNA for caffeoyl-CoA
           3-O-methyltransferase, complete cds, clone: 12FPR057
          Length = 976

 Score =  145 bits (73), Expect = 1e-31
 Identities = 88/93 (94%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 802 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 743

                                            
Query: 312 gggtcggcggcgagcttggcgttgaggtccctg 344
           ||||||||||||||| ||| |||||||||||||
Sbjct: 742 gggtcggcggcgagcctggagttgaggtccctg 710



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  145 bits (73), Expect = 1e-31
 Identities = 88/93 (94%)
 Strand = Plus / Plus

                                                                            
Query: 252      acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
                |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 24579635 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 24579694

                                                 
Query: 312      gggtcggcggcgagcttggcgttgaggtccctg 344
                ||||||||||||||| ||| |||||||||||||
Sbjct: 24579695 gggtcggcggcgagcctggagttgaggtccctg 24579727



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 70/85 (82%)
 Strand = Plus / Plus

                                                                            
Query: 252      acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
                |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 24586269 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 24586328

                                         
Query: 312      gggtcggcggcgagcttggcgttga 336
                |||||| |||||| |||||||||||
Sbjct: 24586329 gggtcgccggcgatcttggcgttga 24586353



 Score = 48.1 bits (24), Expect = 0.019
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                            
Query: 257      gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 316
                ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 24590673 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 24590732

                                    
Query: 317      ggcggcgagcttggcgttga 336
                |||||||| | |||||||||
Sbjct: 24590733 ggcggcgaccatggcgttga 24590752



to top

>dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0026F07
          Length = 137354

 Score =  145 bits (73), Expect = 1e-31
 Identities = 88/93 (94%)
 Strand = Plus / Plus

                                                                         
Query: 252   acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
             |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 87895 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 87954

                                              
Query: 312   gggtcggcggcgagcttggcgttgaggtccctg 344
             ||||||||||||||| ||| |||||||||||||
Sbjct: 87955 gggtcggcggcgagcctggagttgaggtccctg 87987



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 70/85 (82%)
 Strand = Plus / Plus

                                                                         
Query: 252   acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
             |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 94529 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 94588

                                      
Query: 312   gggtcggcggcgagcttggcgttga 336
             |||||| |||||| |||||||||||
Sbjct: 94589 gggtcgccggcgatcttggcgttga 94613



 Score = 48.1 bits (24), Expect = 0.019
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                         
Query: 257   gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 316
             ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 98933 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 98992

                                 
Query: 317   ggcggcgagcttggcgttga 336
             |||||||| | |||||||||
Sbjct: 98993 ggcggcgaccatggcgttga 99012



to top

>dbj|AK104801.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C03, full
           insert sequence
          Length = 1096

 Score =  145 bits (73), Expect = 1e-31
 Identities = 88/93 (94%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 832 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 773

                                            
Query: 312 gggtcggcggcgagcttggcgttgaggtccctg 344
           ||||||||||||||| ||| |||||||||||||
Sbjct: 772 gggtcggcggcgagcctggagttgaggtccctg 740



to top

>dbj|AK104326.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-028-F10, full
           insert sequence
          Length = 996

 Score =  145 bits (73), Expect = 1e-31
 Identities = 88/93 (94%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 825 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 766

                                            
Query: 312 gggtcggcggcgagcttggcgttgaggtccctg 344
           ||||||||||||||| ||| |||||||||||||
Sbjct: 765 gggtcggcggcgagcctggagttgaggtccctg 733



to top

>dbj|AK071482.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093N24, full
           insert sequence
          Length = 1098

 Score =  145 bits (73), Expect = 1e-31
 Identities = 88/93 (94%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||
Sbjct: 834 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 775

                                            
Query: 312 gggtcggcggcgagcttggcgttgaggtccctg 344
           ||||||||||||||| ||| |||||||||||||
Sbjct: 774 gggtcggcggcgagcctggagttgaggtccctg 742



to top

>gb|AY108449.1| Zea mays PCO131734 mRNA sequence
          Length = 1072

 Score =  113 bits (57), Expect = 4e-22
 Identities = 57/57 (100%)
 Strand = Plus / Minus

                                                                    
Query: 250 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 306
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 822 agacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 766



to top

>gb|BT009389.1| Triticum aestivum clone wlm96.pk036.e8:fis, full insert mRNA
           sequence
          Length = 1078

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 256 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggt 315
           |||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||| |||
Sbjct: 874 cgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcgctggt 815

                     
Query: 316 cggcggcgag 325
           ||||||||||
Sbjct: 814 cggcggcgag 805



to top

>emb|AJ242980.1|ZMA242980 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene),
           1136 BP
          Length = 1136

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                       
Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
           |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 859 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 800

                        
Query: 314 gtcggcggcgagc 326
           |||||||||||||
Sbjct: 799 gtcggcggcgagc 787



to top

>gb|BT009186.1| Triticum aestivum clone wl1n.pk0141.a9:fis, full insert mRNA
           sequence
          Length = 1118

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                       
Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
           |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 860 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 801

                        
Query: 314 gtcggcggcgagc 326
           |||||||||||||
Sbjct: 800 gtcggcggcgagc 788



to top

>gb|AY104406.1| Zea mays PCO108855 mRNA sequence
          Length = 1146

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                       
Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
           |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 865 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 806

                        
Query: 314 gtcggcggcgagc 326
           |||||||||||||
Sbjct: 805 gtcggcggcgagc 793



to top

>gb|AY098515.1| Ananas comosus caffeoyl CoA O-methyltransferase mRNA, partial cds
          Length = 607

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 61/69 (88%)
 Strand = Plus / Minus

                                                                       
Query: 258 cggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtcg 317
           |||||||||| ||||||||||||| ||| || ||||||||||| ||||| ||| ||||||
Sbjct: 361 cggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcgggggtcg 302

                    
Query: 318 gcggcgagc 326
            ||||||||
Sbjct: 301 acggcgagc 293



to top

>gb|AY323271.1| Zea mays genotype Quebec28 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1320

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1294 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1235

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1234 gtcggcggcgagc 1222



to top

>gb|AY323270.1| Zea mays genotype Sibiriacka caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1306

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1220 gtcggcggcgagc 1208



to top

>gb|AY323269.1| Zea mays genotype PolarDent caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1308

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1282 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1223

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1222 gtcggcggcgagc 1210



to top

>gb|AY323268.1| Zea mays genotype RainbowFlint caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1314

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1288 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1229

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1228 gtcggcggcgagc 1216



to top

>gb|AY323267.1| Zea mays genotype NoordlanderVC145 caffeoyl-CoA 3-O-methyltransferase
            1 (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1225 gtcggcggcgagc 1213



to top

>gb|AY323266.1| Zea mays genotype RottalerSilomais caffeoyl-CoA 3-O-methyltransferase
            1 (ccoaomt1) gene, complete cds
          Length = 1309

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1224

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1223 gtcggcggcgagc 1211



to top

>gb|AY323265.1| Zea mays genotype Du101 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323264.1| Zea mays genotype W64A caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1225 gtcggcggcgagc 1213



to top

>gb|AY323263.1| Zea mays genotype line16 (private BIOGEMMA line) caffeoyl-CoA
            3-O-methyltransferase 1 (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323262.1| Zea mays genotype line212 (private BIOGEMMA line) caffeoyl-CoA
            3-O-methyltransferase 1 (ccoaomt1) gene, complete cds
          Length = 1306

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1220 gtcggcggcgagc 1208



to top

>gb|AY323261.1| Zea mays genotype F66 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323260.1| Zea mays genotype F113 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323259.1| Zea mays genotype EP1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323258.1| Zea mays genotype B14 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323257.1| Zea mays genotype wis93-3520 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1225 gtcggcggcgagc 1213



to top

>gb|AY323256.1| Zea mays genotype F7 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1309

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1224

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1223 gtcggcggcgagc 1211



to top

>gb|AY323255.1| Zea mays genotype Wis94-443 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323254.1| Zea mays genotype F1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1298

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323253.1| Zea mays genotype Mo17 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1314

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1288 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1229

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1228 gtcggcggcgagc 1216



to top

>gb|AY323252.1| Zea mays genotype DE811 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1311

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1225 gtcggcggcgagc 1213



to top

>gb|AY323251.1| Zea mays genotype B73 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1537

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323250.1| Zea mays genotype F324 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323249.1| Zea mays genotype Lan496 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1549

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1225 gtcggcggcgagc 1213



to top

>gb|AY323248.1| Zea mays genotype MBS847 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323247.1| Zea mays genotype F4 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1536

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323246.1| Zea mays genotype F2 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1544

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1220 gtcggcggcgagc 1208



to top

>gb|AY323245.1| Zea mays genotype W117 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323244.1| Zea mays genotype F7012 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1546

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1282 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1223

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1222 gtcggcggcgagc 1210



to top

>gb|AY323243.1| Zea mays genotype F7025 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323242.1| Zea mays genotype F288 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1537

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1273 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1214

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1213 gtcggcggcgagc 1201



to top

>gb|AY323241.1| Zea mays genotype F271 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1536

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1212 gtcggcggcgagc 1200



to top

>gb|AY323240.1| Zea mays genotype F64 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1)
            gene, complete cds
          Length = 1306

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1220 gtcggcggcgagc 1208



to top

>gb|AY323239.1| Zea mays genotype F286 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1309

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1224

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1223 gtcggcggcgagc 1211



to top

>gb|AY323238.1| Zea mays genotype F564 caffeoyl-CoA 3-O-methyltransferase 1
            (ccoaomt1) gene, complete cds
          Length = 1306

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1220 gtcggcggcgagc 1208



to top

>gb|AY644636.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA
            O-methyltransferase (COA1) gene, complete cds
          Length = 1272

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 1166 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 1107

                        
Query: 314  gtcggcggcgag 325
            ||||||||||||
Sbjct: 1106 gtcggcggcgag 1095



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                           
Query: 254     gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
               |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 3314239 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 3314180

                           
Query: 314     gtcggcggcgag 325
               ||||||||||||
Sbjct: 3314179 gtcggcggcgag 3314168



to top

>dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0015I14
          Length = 150650

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                          
Query: 254    gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
              |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 101602 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 101543

                          
Query: 314    gtcggcggcgag 325
              ||||||||||||
Sbjct: 101542 gtcggcggcgag 101531



to top

>dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone P0680A03
          Length = 156054

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 5793 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 5734

                        
Query: 314  gtcggcggcgag 325
            ||||||||||||
Sbjct: 5733 gtcggcggcgag 5722



to top

>dbj|AK065744.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013039L12, full
           insert sequence
          Length = 1052

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                       
Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
           |||||||||||||| ||||| ||||||| ||| || ||||||||||| ||||| |||  |
Sbjct: 847 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 788

                       
Query: 314 gtcggcggcgag 325
           ||||||||||||
Sbjct: 787 gtcggcggcgag 776



to top

>emb|AJ242981.1|ZMA242981 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene),
           1167 BP
          Length = 1167

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
           ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 859 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 800

                        
Query: 314 gtcggcggcgagc 326
           |||||||||||||
Sbjct: 799 gtcggcggcgagc 787



to top

>gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1084 gtcggcggcgagc 1072



to top

>gb|AY279034.1| Zea mays Mo17 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1136

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1070 gtcggcggcgagc 1058



to top

>gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1084 gtcggcggcgagc 1072



to top

>gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1152

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1146 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1087

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1086 gtcggcggcgagc 1074



to top

>gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1145

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1139 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1080

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1079 gtcggcggcgagc 1067



to top

>gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1084 gtcggcggcgagc 1072



to top

>gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1222

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1097

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1096 gtcggcggcgagc 1084



to top

>gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1209

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1097

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1096 gtcggcggcgagc 1084



to top

>gb|AY279027.1| Zea mays F113 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1172

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



to top

>gb|AY279026.1| Zea mays De811 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1181

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1070 gtcggcggcgagc 1058



to top

>gb|AY279025.1| Zea mays Du101 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1172

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



to top

>gb|AY279024.1| Zea mays B14 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1181

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1070 gtcggcggcgagc 1058



to top

>gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1152

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1146 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1087

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1086 gtcggcggcgagc 1074



to top

>gb|AY279022.1| Zea mays B73 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1445

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



to top

>gb|AY279021.1| Zea mays Lan496 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1438

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1162 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1103

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1102 gtcggcggcgagc 1090



to top

>gb|AY279020.1| Zea mays F288 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1451

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1169 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1110

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1109 gtcggcggcgagc 1097



to top

>gb|AY279019.1| Zea mays W117 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1442

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



to top

>gb|AY279018.1| Zea mays MBS847 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1445

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



to top

>gb|AY279017.1| Zea mays F7012 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1444

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



to top

>gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1463

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1182 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1123

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1122 gtcggcggcgagc 1110



to top

>gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1464

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1182 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1123

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1122 gtcggcggcgagc 1110



to top

>gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1434

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1152 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1093

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1092 gtcggcggcgagc 1080



to top

>gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1084 gtcggcggcgagc 1072



to top

>gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1150

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1084 gtcggcggcgagc 1072



to top

>gb|AY279011.1| Zea mays F64 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1136

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1070 gtcggcggcgagc 1058



to top

>gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene,
            complete cds
          Length = 1153

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1147 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1088

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1087 gtcggcggcgagc 1075



to top

>gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1182

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1176 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1117

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1116 gtcggcggcgagc 1104



to top

>gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1206

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1097

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1096 gtcggcggcgagc 1084



to top

>gb|AY279007.1| Zea mays RainbowFlint caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1172

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



to top

>gb|AY279006.1| Zea mays NoordlanderVC145 caffeoyl CoA 3-O-methyltransferase
            (ccoaomt2) gene, complete cds
          Length = 1172

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1106 gtcggcggcgagc 1094



to top

>gb|AY279005.1| Zea mays isolate 1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1181

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1070 gtcggcggcgagc 1058



to top

>gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransferase (ccoaomt2)
            gene, complete cds
          Length = 1451

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254  gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgg 313
            ||||||||||||||  |||||||||||| ||| || ||||||||||| ||||| |||   
Sbjct: 1173 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1114

                         
Query: 314  gtcggcggcgagc 326
            |||||||||||||
Sbjct: 1113 gtcggcggcgagc 1101



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 255      acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 298
                |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 18420524 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 18420567



to top

>dbj|AP005633.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0463G11
          Length = 154188

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                          
Query: 255    acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 298
              |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 135260 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 135303



to top

>dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0463D04
          Length = 145828

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 255   acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 298
             |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 82398 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 82441



to top

>dbj|AK108479.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-143-F02, full
           insert sequence
          Length = 959

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 255 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 298
           |||||||||||||   ||||||||||||||||||||||||||||
Sbjct: 817 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 774



to top

>dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-CoA 3-O-methyltransferase,
           partial cds
          Length = 622

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 256 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggt 315
           ||||||||||||  |||| ||||||| ||| || ||||||||||| ||||| |||   ||
Sbjct: 387 cgcggcggcagagtgtgatgccgtcgccgacggggagctggcagatctcgacgcggtcgt 328

                     
Query: 316 cggcggcgag 325
           ||||||||||
Sbjct: 327 cggcggcgag 318



to top

>ref|XM_507282.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.26-2
           mRNA
          Length = 1149

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 943 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 884

                                    
Query: 312 gggtcggcggcgagcttggcgttga 336
           |||||| |||||| |||||||||||
Sbjct: 883 gggtcgccggcgatcttggcgttga 859



to top

>ref|XM_483170.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 612

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 608 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 549

                                    
Query: 312 gggtcggcggcgagcttggcgttga 336
           |||||| |||||| |||||||||||
Sbjct: 548 gggtcgccggcgatcttggcgttga 524



to top

>ref|XM_483169.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 879

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 875 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 816

                                    
Query: 312 gggtcggcggcgagcttggcgttga 336
           |||||| |||||| |||||||||||
Sbjct: 815 gggtcgccggcgatcttggcgttga 791



to top

>dbj|AK065515.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013030H15, full
            insert sequence
          Length = 1466

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                        
Query: 252  acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
            |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 1096 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 1037

                                     
Query: 312  gggtcggcggcgagcttggcgttga 336
            |||||| |||||| |||||||||||
Sbjct: 1036 gggtcgccggcgatcttggcgttga 1012



to top

>dbj|AK061757.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-A06, full
           insert sequence
          Length = 1149

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           |||| ||||||||||| ||||| |||||||| ||  | ||||||   | |||| | ||||
Sbjct: 943 acgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgcgc 884

                                    
Query: 312 gggtcggcggcgagcttggcgttga 336
           |||||| |||||| |||||||||||
Sbjct: 883 gggtcgccggcgatcttggcgttga 859



to top

>gb|AY104670.1| Zea mays PCO117754 mRNA sequence
          Length = 976

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 253 cgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagac 301
           ||||||||||||| |  ||||  |||||||||||||||| |||||||||
Sbjct: 778 cgacgcggcggcacagcgtgagcccgtcggcgatggcgacctggcagac 730



to top

>gb|AY644638.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA
            O-methyltransferase (COA26) gene, complete cds
          Length = 1116

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 257  gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 316
            ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 1007 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 948

                                
Query: 317  ggcggcgagcttggcgttga 336
            |||||||| | |||||||||
Sbjct: 947  ggcggcgaccatggcgttga 928



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                       
Query: 299     gacctcgatgcgcgggtcggcggc 322
               ||||||||||||||||||||||||
Sbjct: 4035540 gacctcgatgcgcgggtcggcggc 4035517



to top

>dbj|AK106735.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-A04, full
            insert sequence
          Length = 1895

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 257  gcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgcgggtc 316
            ||||||||| |  |||||||||||||||| || |||| ||||  |||||| |||   |||
Sbjct: 1671 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 1612

                                
Query: 317  ggcggcgagcttggcgttga 336
            |||||||| | |||||||||
Sbjct: 1611 ggcggcgaccatggcgttga 1592



to top

>gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0099O15,
              complete sequence
          Length = 137357

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 55     ccctctcctctcatcaaatttc 76
              ||||||||||||||||||||||
Sbjct: 118827 ccctctcctctcatcaaatttc 118848



to top

>gb|AC093952.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1004_E02,
            complete sequence
          Length = 127642

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 55   ccctctcctctcatcaaatttc 76
            ||||||||||||||||||||||
Sbjct: 9747 ccctctcctctcatcaaatttc 9768



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 315     tcggcggcgagcttggcgttga 336
               ||||||||||||||||||||||
Sbjct: 4580941 tcggcggcgagcttggcgttga 4580920



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 55       ccctctcctctcatcaaatttc 76
                ||||||||||||||||||||||
Sbjct: 23728874 ccctctcctctcatcaaatttc 23728895



to top

>dbj|AK062452.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-103-C05, full
           insert sequence
          Length = 551

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 55  ccctctcctctcatcaaatttc 76
           ||||||||||||||||||||||
Sbjct: 216 ccctctcctctcatcaaatttc 195



to top

>gb|AY697852.1| Perognathus flavescens apache voucher UIMNH 60543 cytochrome b
           gene, partial cds; mitochondrial
          Length = 800

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 140 cagggaaaaataatacaattg 160
           |||||||||||||||||||||
Sbjct: 742 cagggaaaaataatacaattg 722



to top

>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 318    gcggcgagcttggcgttgagg 338
              |||||||||||||||||||||
Sbjct: 363316 gcggcgagcttggcgttgagg 363296



to top

>gb|BT009093.1| Triticum aestivum clone wkm2c.pk005.b15:fis, full insert mRNA
           sequence
          Length = 1018

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           ||||||||||||||||  |||| ||| |||||||| | ||||||   |   |||| ||||
Sbjct: 796 acgacgcggcggcagagcgtgatgccatcggcgatagggagctgcacggggtcgacgcgc 737

                                    
Query: 312 gggtcggcggcgagcttggcgttga 336
           | ||||||||||| | |||||||||
Sbjct: 736 gtgtcggcggcgatcatggcgttga 712



to top

>emb|CR377201.10| Zebrafish DNA sequence from clone CH211-210H21 in linkage group 1,
             complete sequence
          Length = 140461

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 72    atttcgaaagcaaaaaggtattatt 96
             |||||||||| ||||||||||||||
Sbjct: 12982 atttcgaaagaaaaaaggtattatt 12958



to top

>dbj|AB158406.1| Triticum aestivum CCoAMT mRNA for putative caffeoyl CoA
           O-methyltransferase, partial cds
          Length = 875

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 252 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcgatgcgc 311
           ||||||||||||||||  |||| ||| |||||||| | ||||||   |   |||| ||||
Sbjct: 788 acgacgcggcggcagagcgtgatgccatcggcgatagggagctgcacggggtcgacgcgc 729

                                    
Query: 312 gggtcggcggcgagcttggcgttga 336
           | ||||||||||| | |||||||||
Sbjct: 728 gtgtcggcggcgatcatggcgttga 704



to top

>gb|AC147479.17| Mus musculus chromosome 17, clone RP24-178C19, complete sequence
          Length = 178820

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ccactcctccctctcctctc 66
             ||||||||||||||||||||
Sbjct: 73124 ccactcctccctctcctctc 73105



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 305    gatgcgcgggtcggcggcga 324
              ||||||||||||||||||||
Sbjct: 369896 gatgcgcgggtcggcggcga 369877



to top

>gb|AC151292.2| Mus musculus BAC clone RP23-138P14 from chromosome 17, complete sequence
          Length = 216585

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     ccactcctccctctcctctc 66
              ||||||||||||||||||||
Sbjct: 160872 ccactcctccctctcctctc 160891



to top

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 303     tcgatgcgcgggtcggcggcgagc 326
               ||||||||||| ||||||||||||
Sbjct: 1810413 tcgatgcgcggctcggcggcgagc 1810390



to top

>gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, complete sequence
          Length = 216191

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 143    ggaaaaataatacaattgattaag 166
              ||||||||||| ||||||||||||
Sbjct: 154435 ggaaaaataatgcaattgattaag 154412



to top

>gb|AF534906.1| Human adenovirus type 1 subgroup C, complete genome
          Length = 36001

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   gacgcggcggcagatggtga 273
             ||||||||||||||||||||
Sbjct: 11182 gacgcggcggcagatggtga 11201



to top

>gb|AY657045.1| Synthetic construct Peudomonas aeruginosa clone FLH031886.01F
           PA5269 gene, partial cds
          Length = 276

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 313 ggtcggcggcgagcttggcgttga 336
           |||||||||||||| |||||||||
Sbjct: 208 ggtcggcggcgagcatggcgttga 185



to top

>gb|AC005550.1| Homo sapiens PAC clone RP4-620P6 from 7, complete sequence
          Length = 133237

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 141    agggaaaaataatacaattgatta 164
              ||||||||||||||||||| ||||
Sbjct: 111187 agggaaaaataatacaatttatta 111164



to top

>emb|AL591792.1|SME591792 Sinorhizobium meliloti 1021 complete chromosome; segment 11/12
          Length = 333800

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 302    ctcgatgcgcgggtcggcggcgag 325
              ||||||||||| ||||||||||||
Sbjct: 116899 ctcgatgcgcgtgtcggcggcgag 116922



to top

>emb|AL606500.8| Human DNA sequence from clone RP11-274N19 on chromosome 1 Contains the 3'
              end of the KCNN3 gene for potassium intermediate/small
              conductance calcium-activated channel, subfamily N, member
              3, a novel gene and the 5' end of the ADAR gene for
              adenosine deaminase, RNA-specific, complete sequence
          Length = 173014

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 49     actcctccctctcctctcatcaaa 72
              |||||||||||||| |||||||||
Sbjct: 107848 actcctccctctcccctcatcaaa 107871



to top

>emb|AL603964.2| Human DNA sequence from clone RP13-13L9 on chromosome 6, complete
            sequence
          Length = 26986

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 47   ccactcctccctctcctctcatca 70
            |||||| |||||||||||||||||
Sbjct: 3590 ccactcttccctctcctctcatca 3613



to top

>emb|AL513342.7| Human DNA sequence from clone RP11-96F14 on chromosome 1 Contains part
             of the FMN2 gene for formin 2, complete sequence
          Length = 127208

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    actcctccctctcctctcat 68
             ||||||||||||||||||||
Sbjct: 48178 actcctccctctcctctcat 48159



to top

>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the 5'
              end of the RORB gene for RAR-related orphan receptor B
              protein (RZRB, ROR-BETA), two novel genes and two CpG
              islands, complete sequence
          Length = 174874

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 21     tttaagagtacagtacataa 40
              ||||||||||||||||||||
Sbjct: 106430 tttaagagtacagtacataa 106411



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 257    gcggcggcagatggtgacgccgtc 280
              ||||||||||||||||| ||||||
Sbjct: 427746 gcggcggcagatggtgaggccgtc 427723



to top

>emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete genome; segment 11/29
          Length = 313800

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 303  tcgatgcgcgggtcggcggcgagc 326
            |||| |||||||||||||||||||
Sbjct: 2353 tcgaagcgcgggtcggcggcgagc 2330



to top

>emb|AJ417789.1|PSP417789 Polytomella sp. 'Pringsheim 198.80' mRNA for aldehyde dehydrogenase
           (aldh gene)
          Length = 2164

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 315 tcggcggcgagcttggcgttgagg 338
           |||||||||||||||||| |||||
Sbjct: 767 tcggcggcgagcttggcgatgagg 744



to top

>gb|AC116105.12| Mus musculus chromosome 1, clone RP23-23A4, complete sequence
          Length = 214780

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    cactcctccctctcctctca 67
             ||||||||||||||||||||
Sbjct: 84202 cactcctccctctcctctca 84221



to top

>gb|AC092118.3| Homo sapiens chromosome 16 clone CTD-2600O9, complete sequence
          Length = 148794

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 20     gtttaagagtacagtacata 39
              ||||||||||||||||||||
Sbjct: 114656 gtttaagagtacagtacata 114637



to top

>gb|AC108068.3| Homo sapiens BAC clone RP11-574H22 from 2, complete sequence
          Length = 79667

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 83   aaaaaggtattattgaaaac 102
            ||||||||||||||||||||
Sbjct: 4856 aaaaaggtattattgaaaac 4875



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 303     tcgatgcgcgggtcggcggcgagc 326
               |||| |||||||||||||||||||
Sbjct: 6387054 tcgaagcgcgggtcggcggcgagc 6387077



to top

>gb|AE004939.1| Pseudomonas aeruginosa PAO1, section 500 of 529 of the complete
            genome
          Length = 10294

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 313  ggtcggcggcgagcttggcgttga 336
            |||||||||||||| |||||||||
Sbjct: 8946 ggtcggcggcgagcatggcgttga 8923



to top

>gb|AY007523.1| Pseudomonas fluorescens AlgH (algH), hypothetical protein,
           regulatory protein PyrR (pyrR), aspartate carbamoyl
           transferase PyrB (pyrB), and dihydro-orotase PyrC (pyrC)
           genes, complete cds; and unknown gene
          Length = 4080

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 272 gacgccgtcggcgatggcga 291
           ||||||||||||||||||||
Sbjct: 444 gacgccgtcggcgatggcga 425



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 313     ggtcggcggcgagcttggcg 332
               ||||||||||||||||||||
Sbjct: 1444782 ggtcggcggcgagcttggcg 1444763



to top

>gb|J01917.1|ADRCG Adenovirus type 2, complete genome
          Length = 35937

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   gacgcggcggcagatggtga 273
             ||||||||||||||||||||
Sbjct: 11163 gacgcggcggcagatggtga 11182



to top

>gb|U47294.2|CVU47294 Cloning vector pAdVantage, complete sequence
          Length = 4392

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 254  gacgcggcggcagatggtga 273
            ||||||||||||||||||||
Sbjct: 1333 gacgcggcggcagatggtga 1352



to top

>dbj|AB070936.1| Streptomyces avermitilis siderophore biosynthetic gene cluster
          Length = 10056

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 303  tcgatgcgcgggtcggcggcgagc 326
            |||| |||||||||||||||||||
Sbjct: 5465 tcgaagcgcgggtcggcggcgagc 5488


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,927,474
Number of Sequences: 3902068
Number of extensions: 2927474
Number of successful extensions: 71016
Number of sequences better than 10.0: 139
Number of HSP's better than 10.0 without gapping: 139
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70147
Number of HSP's gapped (non-prelim): 862
length of query: 344
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 322
effective length of database: 17,147,199,772
effective search space: 5521398326584
effective search space used: 5521398326584
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top