ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart59e07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_959236.1| Neurospora crassa OR74A VALYL-TRNA SYNTHETASE, ... 42 1.2
2ref|XM_329154.1| Neurospora crassa OR74A VALYL-TRNA SYNTHETASE, ... 42 1.2
3emb|BX842630.1| Neurospora crassa DNA linkage group I BAC contig... 42 1.2
4dbj|AK140146.1| Mus musculus adult male corpora quadrigemina cDN... 42 1.2
5gb|AC151831.3| Mus musculus BAC clone RP24-81D24 from chromosome... 42 1.2
6gb|AC113611.3| Homo sapiens BAC clone RP11-421M20 from 4, comple... 42 1.2
7emb|AL135747.4|CNS01DVE Human chromosome 14 DNA sequence BAC R-1... 42 1.2
8gb|M64703.1|NEUXXX N.crassa valyl-tRNA synthetase (cyt-20/un-3) ... 42 1.2
9ref|XM_761429.1| Theileria parva strain Muguga chromosome 1 hypo... 40 4.8
10gb|AF145593.1|NTCCAMK2 Nicotiana tabacum calcium/calmodulin-depe... 40 4.8
11tpe|BN000728.1| TPA: TPA_exp: Canis familiaris col6a3 gene for c... 40 4.8
12emb|AL844544.9| Mouse DNA sequence from clone RP23-230B1 on chro... 40 4.8
13emb|AL844531.6| Mouse DNA sequence from clone RP23-211J18 on chr... 40 4.8

>ref|XM_959236.1| Neurospora crassa OR74A VALYL-TRNA SYNTHETASE, MITOCHONDRIAL
           PRECURSOR (VALINE--TRNA LIGASE) (VALRS) (NCU01965.1)
           partial mRNA
          Length = 3282

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 154 cttcggggcaggggcaccagg 174
           |||||||||||||||||||||
Sbjct: 210 cttcggggcaggggcaccagg 190



to top

>ref|XM_329154.1| Neurospora crassa OR74A VALYL-TRNA SYNTHETASE, MITOCHONDRIAL
           PRECURSOR (VALINE--TRNA LIGASE) (VALRS) (NCU01965.1)
           partial mRNA
          Length = 3282

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 154 cttcggggcaggggcaccagg 174
           |||||||||||||||||||||
Sbjct: 210 cttcggggcaggggcaccagg 190



to top

>emb|BX842630.1| Neurospora crassa DNA linkage group I BAC contig B13D15
          Length = 127789

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 154    cttcggggcaggggcaccagg 174
              |||||||||||||||||||||
Sbjct: 116975 cttcggggcaggggcaccagg 116995



to top

>dbj|AK140146.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length
            enriched library, clone:B230314J23
            product:unclassifiable, full insert sequence
          Length = 4834

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 80   gattcataactaaaagcaaaa 100
            |||||||||||||||||||||
Sbjct: 2476 gattcataactaaaagcaaaa 2456



to top

>gb|AC151831.3| Mus musculus BAC clone RP24-81D24 from chromosome 14, complete sequence
          Length = 212749

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 80     gattcataactaaaagcaaaa 100
              |||||||||||||||||||||
Sbjct: 156552 gattcataactaaaagcaaaa 156532



to top

>gb|AC113611.3| Homo sapiens BAC clone RP11-421M20 from 4, complete sequence
          Length = 60597

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 40    cacacagactagggacaaaac 60
             |||||||||||||||||||||
Sbjct: 57646 cacacagactagggacaaaac 57626



to top

>emb|AL135747.4|CNS01DVE Human chromosome 14 DNA sequence BAC R-1023I22 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 173275

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 87     aactaaaagcaaaactgagca 107
              |||||||||||||||||||||
Sbjct: 119689 aactaaaagcaaaactgagca 119669



to top

>gb|M64703.1|NEUXXX N.crassa valyl-tRNA synthetase (cyt-20/un-3) gene
          Length = 4135

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 154 cttcggggcaggggcaccagg 174
           |||||||||||||||||||||
Sbjct: 783 cttcggggcaggggcaccagg 763



to top

>ref|XM_761429.1| Theileria parva strain Muguga chromosome 1 hypothetical protein
            (TP01_1001) partial mRNA
          Length = 2184

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 296  tgaataatcatgctggacgt 315
            ||||||||||||||||||||
Sbjct: 1797 tgaataatcatgctggacgt 1778



to top

>gb|AF145593.1|NTCCAMK2 Nicotiana tabacum calcium/calmodulin-dependent protein kinase
           (CCaMK) gene, exons and complete cds
          Length = 1378

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 296 tgaataatcatgctggacgtgtgt 319
           |||||||||||| |||||||||||
Sbjct: 590 tgaataatcatgttggacgtgtgt 567



to top

>tpe|BN000728.1| TPA: TPA_exp: Canis familiaris col6a3 gene for collagen, type VI, alpha 3
              and mlph gene for melanophilin
          Length = 212696

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 173    gggcaggccggcaggggcgg 192
              ||||||||||||||||||||
Sbjct: 203008 gggcaggccggcaggggcgg 202989



to top

>emb|AL844544.9| Mouse DNA sequence from clone RP23-230B1 on chromosome 2, complete
              sequence
          Length = 156426

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     taaaagcaaaactgagcaaa 109
              ||||||||||||||||||||
Sbjct: 108589 taaaagcaaaactgagcaaa 108608



to top

>emb|AL844531.6| Mouse DNA sequence from clone RP23-211J18 on chromosome 2, complete
              sequence
          Length = 181194

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 53     gacaaaactgagcacaaaac 72
              ||||||||||||||||||||
Sbjct: 175328 gacaaaactgagcacaaaac 175347


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,985,836
Number of Sequences: 3902068
Number of extensions: 2985836
Number of successful extensions: 55860
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55843
Number of HSP's gapped (non-prelim): 17
length of query: 364
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 342
effective length of database: 17,147,199,772
effective search space: 5864342322024
effective search space used: 5864342322024
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top