ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart59e06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase m... 218 1e-53
2gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferas... 172 5e-40
3gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full ... 157 3e-35
4gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-... 153 5e-34
5gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O... 149 7e-33
6gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltrans... 133 4e-28
7gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O... 129 7e-27
8gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O... 125 1e-25
9gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltrans... 125 1e-25
10gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-... 117 3e-23
11emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic ... 115 1e-22
12gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyl... 115 1e-22
13gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (co... 92 2e-15
14gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (... 92 2e-15
15gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (co... 92 2e-15
16gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt... 92 2e-15
17gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (c... 92 2e-15
18gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (... 92 2e-15
19ref|XM_480185.1| Oryza sativa (japonica cultivar-group), mRNA 84 4e-13
20dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 4e-13
21dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 84 4e-13
22gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltr... 84 4e-13
23dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA... 84 4e-13
24dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic D... 84 4e-13
25dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 4e-13
26gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (com... 84 4e-13
27gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransfera... 84 4e-13
28gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferas... 84 4e-13
29gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (c... 84 4e-13
30gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, com... 84 4e-13
31gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (co... 78 2e-11
32gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (co... 78 2e-11
33gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase... 76 9e-11
34gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (com... 76 9e-11
35gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (co... 74 4e-10
36gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (co... 74 4e-10
37gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (com... 70 6e-09
38gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (co... 70 6e-09
39gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (c... 70 6e-09
40gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (co... 70 6e-09
41gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (com... 70 6e-09
42gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (co... 70 6e-09
43gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase ... 68 2e-08
44gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA,... 68 2e-08
45gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt... 66 9e-08
46gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (c... 66 9e-08
47gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gen... 66 9e-08
48gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt... 64 3e-07
49gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (com... 62 1e-06
50gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt... 62 1e-06
51gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt... 62 1e-06
52emb|AJ586106.1| Festuca arundinacea partial mRNA for putative ca... 58 2e-05
53gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt)... 58 2e-05
54gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) ge... 58 2e-05
55emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caf... 56 8e-05
56gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (com... 54 3e-04
57gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (c... 54 3e-04
58gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) g... 54 3e-04
59gb|AY098514.1| Ananas comosus caffeic acid O-methyltransferase m... 48 0.020
60emb|AL138831.12| Human DNA sequence from clone RP3-406P24 on chr... 44 0.32
61gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 42 1.3
62emb|AL806522.4| Mouse DNA sequence from clone RP23-167H2 on chro... 42 1.3
63gb|AY794816.1| Galearia filiformis tRNA-Leu (trnL) gene and trnL... 40 5.0
64gb|AY794673.1| Omphalea palmata tRNA-Leu (trnL) gene and trnL-tr... 40 5.0
65gb|AY794672.1| Omphalea diandra tRNA-Leu (trnL) gene and trnL-tr... 40 5.0
66gb|DQ001169.1| Acacia mangium x Acacia auriculiformis caffeic ac... 40 5.0
67gb|AC138448.9| Medicago truncatula clone mth2-11n13, complete se... 40 5.0
68emb|Z83001.1|HSG0453 Human DNA sequence from clone XX-G0453 on c... 40 5.0
69emb|AL136373.21| Human DNA sequence from clone RP11-49P4 on chro... 40 5.0
70emb|AL049745.9|HSJ654H19 Human DNA sequence from clone RP4-654H1... 40 5.0
71gb|AC010282.6| Homo sapiens chromosome 5 clone CTC-555I19, compl... 40 5.0
72emb|AL663035.8| Mouse DNA sequence from clone RP23-432G17 on chr... 40 5.0
73gb|AC011478.3| Homo sapiens chromosome 19 clone CTC-565M22, comp... 40 5.0
74gb|AY094283.1| Zea mays cultivar F_7 caffeic acid 3-O-methyltran... 40 5.0
75gb|AY094282.1| Zea mays cultivar D_9 caffeic acid 3-O-methyltran... 40 5.0
76gb|AY094281.1| Zea mays cultivar D_6 caffeic acid 3-O-methyltran... 40 5.0
77gb|AY094280.1| Zea mays cultivar F_1 caffeic acid 3-O-methyltran... 40 5.0
78gb|AY094279.1| Zea mays cultivar Mo17 caffeic acid 3-O-methyltra... 40 5.0
79gb|AY094276.1| Zea mays cultivar 684 caffeic acid 3-O-methyltran... 40 5.0
80gb|AY094275.1| Zea mays cultivar I_1 caffeic acid 3-O-methyltran... 40 5.0
81gb|AY094274.1| Zea mays cultivar F_2 caffeic acid 3-O-methyltran... 40 5.0
82gb|AY094273.1| Zea mays cultivar G_1 caffeic acid 3-O-methyltran... 40 5.0
83gb|AY094271.1| Zea mays cultivar F_3 caffeic acid 3-O-methyltran... 40 5.0
84gb|AY094270.1| Zea mays cultivar F_5 caffeic acid 3-O-methyltran... 40 5.0
85gb|AY094269.1| Zea mays cultivar H_5 caffeic acid 3-O-methyltran... 40 5.0
86gb|AY094268.1| Zea mays cultivar H_3 caffeic acid 3-O-methyltran... 40 5.0
87gb|AY094267.1| Zea mays cultivar J40 caffeic acid 3-O-methyltran... 40 5.0
88gb|AY094266.1| Zea mays cultivar 647 caffeic acid 3-O-methyltran... 40 5.0
89gb|AY094265.1| Zea mays cultivar B_1 caffeic acid 3-O-methyltran... 40 5.0
90gb|AY094264.1| Zea mays cultivar F_6 caffeic acid 3-O-methyltran... 40 5.0
91gb|AY094263.1| Zea mays cultivar C_5 caffeic acid 3-O-methyltran... 40 5.0
92gb|AY094262.1| Zea mays cultivar H_1 caffeic acid 3-O-methyltran... 40 5.0
93gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 5.0
94ref|XM_395084.2| PREDICTED: Apis mellifera similar to CG5811-PA ... 40 5.0
95gb|AE004912.1| Pseudomonas aeruginosa PAO1, section 473 of 529 o... 40 5.0
96gb|AF130358.2|AF130358 Homo sapiens chromosome 21q11.2 PAC 90B5,... 40 5.0
97emb|AL929026.10| Mouse DNA sequence from clone RP23-332K7 on chr... 40 5.0
98emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 5.0
99gb|AF154918.1|AF154918 Ocimum basilicum caffeic acid O-methyltra... 40 5.0
100gb|AC006556.3|AC006556 Homo sapiens, clone hRPK.37_A_1, complete... 40 5.0
101dbj|AP001660.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 5.0
102emb|AL078615.2|HS98L15 Homo sapiens chromosome 21 PAC RPCIP704L1... 40 5.0

>gb|DQ223971.1| Triticum aestivum flavonoid O-methyltransferase mRNA, complete cds
          Length = 1233

 Score =  218 bits (110), Expect = 1e-53
 Identities = 158/174 (90%)
 Strand = Plus / Minus

                                                                        
Query: 200  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 259
            |||||||||||| |||||||| ||||||||||| |||||||||||||| | ||| |||| 
Sbjct: 1148 catctacttagtgaactcgatggcccatgcgttggcgtagatgtaagtagtcttcatggc 1089

                                                                        
Query: 260  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 319
            |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||
Sbjct: 1088 ggcgaacccggcgcccttggccagggcctcgaactccctctcgtacctctccctgccacc 1029

                                                                  
Query: 320  tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgccttagg 373
             |||||||||||||||||||||||||| |  | |||||| ||||| ||||||||
Sbjct: 1028 cgggttgtgcgcgagcatgatcatgtcgacatggaacaccccctgcgccttagg 975



to top

>gb|AY226581.1| Triticum aestivum caffeic acid O-methyltransferase (COMT1) mRNA,
            complete cds
          Length = 1371

 Score =  172 bits (87), Expect = 5e-40
 Identities = 153/175 (87%)
 Strand = Plus / Minus

                                                                        
Query: 196  catgcatctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttga 255
            |||| |||||||| || |||||||| ||  ||||||| |||||||||||||||| |||||
Sbjct: 1163 catggatctacttggtgaactcgatggcaaatgcgttggcgtagatgtaagtggtcttga 1104

                                                                        
Query: 256  tggaggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctac 315
            |||    ||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
Sbjct: 1103 tggctttgaagccggcgcccttggccagggcctcgaactccctctcgtacctctccctgc 1044

                                                                   
Query: 316  cacctgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            | || |||||||||||||||||||||||||| | || |||||| ||||| |||||
Sbjct: 1043 cgccggggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctgcgcctt 989



to top

>gb|BT009383.1| Triticum aestivum clone wlm96.pk033.c5:fis, full insert mRNA sequence
          Length = 1314

 Score =  157 bits (79), Expect = 3e-35
 Identities = 133/151 (88%)
 Strand = Plus / Minus

                                                                        
Query: 196  catgcatctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttga 255
            |||| |||||||| || |||||||| ||  ||||||| ||||||||||| |||| |||||
Sbjct: 1083 catggatctacttggtgaactcgatggcaaatgcgttggcgtagatgtaggtggtcttga 1024

                                                                        
Query: 256  tggaggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctac 315
            |||    ||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
Sbjct: 1023 tggctttgaagccggcgcccttggccagggcctcgaactccctctcgtacctctccctgc 964

                                           
Query: 316  cacctgggttgtgcgcgagcatgatcatgtc 346
            | || ||||||||||||||||||||||||||
Sbjct: 963  cgccggggttgtgcgcgagcatgatcatgtc 933



to top

>gb|AF153826.1|AF153826 Festuca arundinacea comt3 caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1430

 Score =  153 bits (77), Expect = 5e-34
 Identities = 143/165 (86%)
 Strand = Plus / Minus

                                                                        
Query: 200  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 259
            ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| |  
Sbjct: 1163 catctacttggtgaactcgatggcccaggcgttggcgtagatgtatgtggacttgaagcc 1104

                                                                        
Query: 260  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 319
            |||||| || || |||||||| || ||||||||||||||||| ||||||||||| |||||
Sbjct: 1103 ggcgaagccagctcccttggcgagcgcctcgaactccctctcgtacctctccctgccacc 1044

                                                         
Query: 320  tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 364
             |||||||||||||||||||||||||| | || |||||| |||||
Sbjct: 1043 ggggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctg 999



to top

>gb|AF153824.1|AF153824 Festuca arundinacea comt1b caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1440

 Score =  149 bits (75), Expect = 7e-33
 Identities = 129/147 (87%)
 Strand = Plus / Minus

                                                                        
Query: 200  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 259
            ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| |  
Sbjct: 1156 catctacttggtgaactcgatggcccacgcgtttgcgtagatgtacgtggacttgacgcc 1097

                                                                        
Query: 260  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 319
            || |||||| || ||| ||||||||||||||||||||||||| ||||||||||| || ||
Sbjct: 1096 ggtgaacccagctcccctggccagggcctcgaactccctctcgtacctctccctgccgcc 1037

                                       
Query: 320  tgggttgtgcgcgagcatgatcatgtc 346
             ||||||||||||||||||||||||||
Sbjct: 1036 ggggttgtgcgcgagcatgatcatgtc 1010



to top

>gb|AF033540.1|AF033540 Lolium perenne caffeic acid O-methyltransferase (OMT3) mRNA, complete
            cds
          Length = 1436

 Score =  133 bits (67), Expect = 4e-28
 Identities = 139/163 (85%)
 Strand = Plus / Minus

                                                                        
Query: 202  tctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggagg 261
            ||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| |  ||
Sbjct: 1172 tctacttggtgaactcgatggcccaggcgttggcgtagatgtatgtggacttgaagccgg 1113

                                                                        
Query: 262  cgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctg 321
            |||| || || ||| |||| || |||||| |||||||||| ||||||||||| || ||||
Sbjct: 1112 cgaagccagctcccctggcgagcgcctcgtactccctctcgtacctctccctgccgcctg 1053

                                                       
Query: 322  ggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 364
            ||||||||||||||||||||||||| | || |||||| |||||
Sbjct: 1052 ggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctg 1010



to top

>gb|AF153825.1|AF153825 Festuca arundinacea comt1c caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1438

 Score =  129 bits (65), Expect = 7e-27
 Identities = 140/165 (84%)
 Strand = Plus / Minus

                                                                        
Query: 200  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 259
            ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| |  
Sbjct: 1147 catctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgcc 1088

                                                                        
Query: 260  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 319
            || ||| ||||| ||| |||| || |||||||||||||| || ||||||||||| || ||
Sbjct: 1087 ggtgaagccggctcccctggcgagcgcctcgaactccctttcgtacctctccctgccgcc 1028

                                                         
Query: 320  tgggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 364
             |||||||||||||||||||||||||| | || |||||| |||||
Sbjct: 1027 ggggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctg 983



to top

>gb|AF153823.1|AF153823 Festuca arundinacea comt1a caffeic acid O-methyltransferase mRNA,
            complete cds
          Length = 1446

 Score =  125 bits (63), Expect = 1e-25
 Identities = 126/147 (85%)
 Strand = Plus / Minus

                                                                        
Query: 200  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 259
            ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| |  
Sbjct: 1130 catctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgcc 1071

                                                                        
Query: 260  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 319
            || ||| ||||| ||| |||| || |||| |||||||||||| ||||||||||| || ||
Sbjct: 1070 ggtgaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccgcc 1011

                                       
Query: 320  tgggttgtgcgcgagcatgatcatgtc 346
             ||||||||||||||||||||||||||
Sbjct: 1010 ggggttgtgcgcgagcatgatcatgtc 984



to top

>gb|AF033538.1|AF033538 Lolium perenne caffeic acid O-methyltransferase (OMT1) mRNA, complete
            cds
          Length = 1455

 Score =  125 bits (63), Expect = 1e-25
 Identities = 126/147 (85%)
 Strand = Plus / Minus

                                                                        
Query: 200  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 259
            ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| ||||| |  
Sbjct: 1137 catctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacgcc 1078

                                                                        
Query: 260  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 319
            || ||| ||||| ||| |||| || |||| |||||||||||| ||||||||||| || ||
Sbjct: 1077 ggtgaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccgcc 1018

                                       
Query: 320  tgggttgtgcgcgagcatgatcatgtc 346
             ||||||||||||||||||||||||||
Sbjct: 1017 ggggttgtgcgcgagcatgatcatgtc 991



to top

>gb|AF010291.1|AF010291 Lolium perenne bispecific caffeic acid/5-hydroxyferulic acid
            O-methyltransferase mRNA, complete cds
          Length = 1475

 Score =  117 bits (59), Expect = 3e-23
 Identities = 125/147 (85%)
 Strand = Plus / Minus

                                                                        
Query: 200  catctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatgga 259
            ||||||||| || |||||||| ||||| ||||| ||||||||||| |||| |||||    
Sbjct: 1156 catctacttggtgaactcgatggcccacgcgttggcgtagatgtacgtggacttgacacc 1097

                                                                        
Query: 260  ggcgaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacc 319
            || ||| ||||| ||| |||| || |||| |||||||||||| ||||||||||| || ||
Sbjct: 1096 ggtgaatccggctcccctggcgagagcctggaactccctctcgtacctctccctgccccc 1037

                                       
Query: 320  tgggttgtgcgcgagcatgatcatgtc 346
             ||||||||||||||||||||||||||
Sbjct: 1036 ggggttgtgcgcgagcatgatcatgtc 1010



to top

>emb|AJ231133.1|SOF231133 Saccharum officinarum mRNA for caffeic acid 3-O-methyltransferase
          Length = 1486

 Score =  115 bits (58), Expect = 1e-22
 Identities = 133/158 (84%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||||||||||
Sbjct: 1183 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaacccggcg 1124

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||| | | |||||||| ||| |||| |||||| || || ||||| ||||||
Sbjct: 1123 cccttggcgaggtcgtggaactcccgctcgtaccgctccctgccgccggggttatgcgcg 1064

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 1063 agcatgatcatgtcgacgtggaacacgccctgcgcctt 1026



to top

>gb|AY365419.1| Saccharum hybrid cultivar caffeic acid 3-O-methyltransferase (COMT)
            gene, complete cds
          Length = 2012

 Score =  115 bits (58), Expect = 1e-22
 Identities = 133/158 (84%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||||||||||
Sbjct: 2002 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaacccggcg 1943

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||| | | |||||||| ||| |||| |||||| || || ||||| ||||||
Sbjct: 1942 cccttggcgaggtcgtggaactcccgctcgtaccgctccctgccgccggggttatgcgcg 1883

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 1882 agcatgatcatgtcgacgtggaacacgccctgcgcctt 1845



to top

>gb|AY323304.1| Zea mays inbred line Mo17 O-methyltransferase (comt) gene, complete
            cds
          Length = 2955

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 130/158 (82%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2609 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2550

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||||||||||
Sbjct: 2549 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 2490

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 2489 agcatgatcatgtcgacgtggaacacgccctgcgcctt 2452



to top

>gb|AY323302.1| Zea mays inbred line Lan496 O-methyltransferase (comt) gene, complete
            cds
          Length = 3282

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 130/158 (82%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2936 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2877

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||||||||||
Sbjct: 2876 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 2817

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 2816 agcatgatcatgtcgacgtggaacacgccctgcgcctt 2779



to top

>gb|AY323287.1| Zea mays inbred line F564 O-methyltransferase (comt) gene, complete
            cds
          Length = 2982

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 130/158 (82%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2960 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2901

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||||||||||
Sbjct: 2900 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 2841

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 2840 agcatgatcatgtcgacgtggaacacgccctgcgcctt 2803



to top

>gb|AY323284.1| Zea mays inbred line 16 O-methyltransferase (comt) gene, complete cds
          Length = 3190

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 130/158 (82%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 3168 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 3109

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||||||||||
Sbjct: 3108 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 3049

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 3048 agcatgatcatgtcgacgtggaacacgccctgcgcctt 3011



to top

>gb|AY323274.1| Zea mays inbred line F7025 O-methyltransferase (comt) gene, complete
            cds
          Length = 2326

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 130/158 (82%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 1980 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 1921

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||||||||||
Sbjct: 1920 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 1861

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 1860 agcatgatcatgtcgacgtggaacacgccctgcgcctt 1823



to top

>gb|AY323272.1| Zea mays inbred line MBS847 O-methyltransferase (comt) gene, complete
            cds
          Length = 2326

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 130/158 (82%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 1980 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 1921

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||||||||||
Sbjct: 1920 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcg 1861

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 1860 agcatgatcatgtcgacgtggaacacgccctgcgcctt 1823



to top

>ref|XM_480185.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1425

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 132/162 (81%)
 Strand = Plus / Minus

                                                                        
Query: 203  ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 262
            |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 1189 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1130

                                                                        
Query: 263  gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 322
            ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 1129 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1070

                                                      
Query: 323  gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 364
            |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 1069 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 1028



to top

>dbj|AK061859.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G09, full
           insert sequence
          Length = 1227

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 132/162 (81%)
 Strand = Plus / Minus

                                                                       
Query: 203 ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 262
           |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 987 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 928

                                                                       
Query: 263 gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 322
           ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 927 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 868

                                                     
Query: 323 gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 364
           |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 867 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 826



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 132/162 (81%)
 Strand = Plus / Plus

                                                                           
Query: 203     ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 262
               |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 3331696 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 3331755

                                                                           
Query: 263     gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 322
               ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 3331756 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 3331815

                                                         
Query: 323     gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 364
               |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 3331816 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 3331857



to top

>gb|DQ288259.1| Oryza sativa (japonica cultivar-group) O-methyltransferase (ROMT-9)
            mRNA, complete cds
          Length = 1190

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 132/162 (81%)
 Strand = Plus / Minus

                                                                        
Query: 203  ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 262
            |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 1121 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1062

                                                                        
Query: 263  gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 322
            ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 1061 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1002

                                                      
Query: 323  gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 364
            |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 1001 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 960



to top

>dbj|AB122056.1| Oryza sativa (japonica cultivar-group) COMT mRNA for caffeic acid
           o-methyl transferase, partial cds
          Length = 1067

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 132/162 (81%)
 Strand = Plus / Minus

                                                                       
Query: 203 ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 262
           |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 807 ctactttgtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 748

                                                                       
Query: 263 gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 322
           ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 747 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 688

                                                     
Query: 323 gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 364
           |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 687 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 646



to top

>dbj|AP004460.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0438H08
          Length = 148626

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 132/162 (81%)
 Strand = Plus / Plus

                                                                          
Query: 203    ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 262
              |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 109263 ctacttggtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 109322

                                                                          
Query: 263    gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 322
              ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 109323 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 109382

                                                        
Query: 323    gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 364
              |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 109383 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 109424



to top

>dbj|AK064768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A05, full
            insert sequence
          Length = 1425

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 132/162 (81%)
 Strand = Plus / Minus

                                                                        
Query: 203  ctacttagttaactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggc 262
            |||||| || |||||||| ||||| ||||| ||||||||||| |||||||||| |  || 
Sbjct: 1189 ctactttgtgaactcgatggcccaggcgttggcgtagatgtaggtggccttgaagccggt 1130

                                                                        
Query: 263  gaacccggcgcccttggccagggcctcgaactccctctcatacctctccctaccacctgg 322
            ||| |||||| |   ||| ||  ||  |||||||||||| ||||||||| | || || ||
Sbjct: 1129 gaatccggcggcgcgggcgagctccctgaactccctctcgtacctctccttgccgccggg 1070

                                                      
Query: 323  gttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 364
            |||||| ||||||||||||||||| | || |||||| |||||
Sbjct: 1069 gttgtgggcgagcatgatcatgtcgacgtggaacaccccctg 1028



to top

>gb|AY323295.1| Zea mays inbred line B73 O-methyltransferase (comt) gene, complete
            cds
          Length = 2676

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 129/158 (81%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2654 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2595

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||| ||||||
Sbjct: 2594 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttatgcgcg 2535

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 2534 agcatgatcatgtcgacgtggaacacgccctgcgcctt 2497



to top

>gb|AY323282.1| Zea mays inbred line Wis93-3520 O-methyltransferase (comt) gene,
            complete cds
          Length = 3088

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 129/158 (81%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 3066 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 3007

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||| ||||||
Sbjct: 3006 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttatgcgcg 2947

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 2946 agcatgatcatgtcgacgtggaacacgccctgcgcctt 2909



to top

>gb|AY323281.1| Zea mays inbred line Wis94-443 O-methyltransferase (comt) gene,
            complete cds
          Length = 3095

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 129/158 (81%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 3073 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 3014

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || || ||||||||||||
Sbjct: 3013 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcg 2954

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 2953 agcatgatcatgtcgacgtggaacacgccctgcgcctt 2916



to top

>gb|AY323273.1| Zea mays inbred line Du101 O-methyltransferase (comt) gene, complete
            cds
          Length = 2074

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 129/158 (81%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2052 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 1993

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || |||||||| ||||||
Sbjct: 1992 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgcctgggttatgcgcg 1933

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 1932 agcatgatcatgtcgacgtggaacacgccctgcgcctt 1895



to top

>gb|M73235.1|MZEOMTH Zea mays O-methyltransferase (OMT) gene, complete cds
          Length = 2512

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 129/158 (81%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2131 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2072

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || || ||||||||||||
Sbjct: 2071 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcg 2012

                                                  
Query: 333  agcatgatcatgtcaaggttgaacacaccctgtgcctt 370
            |||||||||||||| | || |||||| ||||| |||||
Sbjct: 2011 agcatgatcatgtcgacgtggaacacgccctgcgcctt 1974



to top

>gb|AY323290.1| Zea mays inbred line F113 O-methyltransferase (comt) gene, partial
            cds
          Length = 3154

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 3150 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 3091

                                                                        
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 347
              |||||| | ||| |||| |||| | || ||||||||||||||||||||||||||||| 
Sbjct: 3090 cggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcgagcatgatcatgtcg 3031

                                   
Query: 348  aggttgaacacaccctgtgcctt 370
            | || |||||| ||||| |||||
Sbjct: 3030 acgtggaacacgccctgcgcctt 3008



to top

>gb|AY323289.1| Zea mays inbred line F271 O-methyltransferase (comt) gene, partial
            cds
          Length = 2892

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 117/143 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2888 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2829

                                                                        
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 347
              |||||| | ||| |||| |||| | || ||||||||||||||||||||||||||||| 
Sbjct: 2828 cggaactcgcgctcgtaccgctccttgccgcctgggttgtgcgcgagcatgatcatgtcg 2769

                                   
Query: 348  aggttgaacacaccctgtgcctt 370
            | || |||||| ||||| |||||
Sbjct: 2768 acgtggaacacgccctgcgcctt 2746



to top

>gb|AY323276.1| Zea mays inbred line Quebec28 O-methyltransferase (comt) gene,
            complete cds
          Length = 3061

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 3051 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 2992

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || || ||||||||||||
Sbjct: 2991 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcg 2932

                          
Query: 333  agcatgatcatgtc 346
            ||||||||||||||
Sbjct: 2931 agcatgatcatgtc 2918



to top

>gb|AY323275.1| Zea mays inbred line F66 O-methyltransferase (comt) gene, complete
            cds
          Length = 2041

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||
Sbjct: 2031 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcg 1972

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            |||||||| ||  |   |||||| | ||| |||| |||| | || || ||||||||||||
Sbjct: 1971 cccttggcgagctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcg 1912

                          
Query: 333  agcatgatcatgtc 346
            ||||||||||||||
Sbjct: 1911 agcatgatcatgtc 1898



to top

>gb|AY323297.1| Zea mays inbred line F288 O-methyltransferase (comt) gene, partial
            cds
          Length = 2927

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                        
Query: 222  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 281
            ||||| ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| 
Sbjct: 2927 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 2868

                                                                        
Query: 282  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 341
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 2867 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2808

                                         
Query: 342  atgtcaaggttgaacacaccctgtgcctt 370
            ||||| | || |||||| ||||| |||||
Sbjct: 2807 atgtcgacgtggaacacgccctgcgcctt 2779



to top

>gb|AY323288.1| Zea mays inbred line F286 O-methyltransferase (comt) gene, partial
            cds
          Length = 2951

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                        
Query: 222  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 281
            ||||| ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| 
Sbjct: 2951 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 2892

                                                                        
Query: 282  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 341
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 2891 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2832

                                         
Query: 342  atgtcaaggttgaacacaccctgtgcctt 370
            ||||| | || |||||| ||||| |||||
Sbjct: 2831 atgtcgacgtggaacacgccctgcgcctt 2803



to top

>gb|AY323305.1| Zea mays inbred line EP1 O-methyltransferase (comt) gene, partial cds
          Length = 2782

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2778 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2719

                                                                        
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 347
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2718 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2659

                                   
Query: 348  aggttgaacacaccctgtgcctt 370
            | || |||||| ||||| |||||
Sbjct: 2658 acgtggaacacgccctgcgcctt 2636



to top

>gb|AY323303.1| Zea mays inbred line W117 O-methyltransferase (comt) gene, partial
            cds
          Length = 2925

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2921 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2862

                                                                        
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 347
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2861 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2802

                                   
Query: 348  aggttgaacacaccctgtgcctt 370
            | || |||||| ||||| |||||
Sbjct: 2801 acgtggaacacgccctgcgcctt 2779



to top

>gb|AY323300.1| Zea mays inbred line F7012 O-methyltransferase (comt) gene, partial
            cds
          Length = 2850

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2846 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2787

                                                                        
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 347
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2786 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2727

                                   
Query: 348  aggttgaacacaccctgtgcctt 370
            | || |||||| ||||| |||||
Sbjct: 2726 acgtggaacacgccctgcgcctt 2704



to top

>gb|AY323298.1| Zea mays inbred line F324 O-methyltransferase (comt) gene, partial
            cds
          Length = 2782

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2778 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2719

                                                                        
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 347
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2718 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2659

                                   
Query: 348  aggttgaacacaccctgtgcctt 370
            | || |||||| ||||| |||||
Sbjct: 2658 acgtggaacacgccctgcgcctt 2636



to top

>gb|AY323286.1| Zea mays inbred line F64 O-methyltransferase (comt) gene, partial cds
          Length = 2948

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2944 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2885

                                                                        
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 347
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2884 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2825

                                   
Query: 348  aggttgaacacaccctgtgcctt 370
            | || |||||| ||||| |||||
Sbjct: 2824 acgtggaacacgccctgcgcctt 2802



to top

>gb|AY323283.1| Zea mays inbred line W64A O-methyltransferase (comt) gene, partial
            cds
          Length = 2748

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 116/143 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2744 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2685

                                                                        
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtca 347
              |||||| | ||| |||| |||| | || || |||||||||||||||||||||||||| 
Sbjct: 2684 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtcg 2625

                                   
Query: 348  aggttgaacacaccctgtgcctt 370
            | || |||||| ||||| |||||
Sbjct: 2624 acgtggaacacgccctgcgcctt 2602



to top

>gb|AY217766.1| Sorghum bicolor caffeic acid O-methyltransferase gene, complete cds
          Length = 3312

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 109/134 (81%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||     | ||| || |||
Sbjct: 2769 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccagagaagccagcg 2710

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
             ||||||| ||| |   |||||||| ||| |||| |||||| || || ||||| ||||||
Sbjct: 2709 gccttggcgaggtcacggaactcccgctcgtaccgctccctgccgccggggttatgcgcg 2650

                          
Query: 333  agcatgatcatgtc 346
            ||||||||||||||
Sbjct: 2649 agcatgatcatgtc 2636



to top

>gb|AF387790.1|AF387790 Sorghum bicolor O-methyltransferase mRNA, complete cds
          Length = 1458

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 109/134 (81%)
 Strand = Plus / Minus

                                                                        
Query: 213  aactcgattgcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcg 272
            |||||||| ||||| ||||| ||||||||||| ||||||||||     | ||| || |||
Sbjct: 1188 aactcgatggcccaggcgttggcgtagatgtaggtggccttgaacccagagaagccagcg 1129

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
             ||||||| ||| |   |||||||| ||| |||| |||||| || || ||||| ||||||
Sbjct: 1128 gccttggcgaggtcacggaactcccgctcgtaccgctccctgccgccggggttatgcgcg 1069

                          
Query: 333  agcatgatcatgtc 346
            ||||||||||||||
Sbjct: 1068 agcatgatcatgtc 1055



to top

>gb|AY323299.1| Zea mays inbred line F4 O-methyltransferase (comt) gene, partial cds
          Length = 2675

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                        
Query: 222  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 281
            ||||| ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| 
Sbjct: 2675 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 2616

                                                                        
Query: 282  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 341
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 2615 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2556

                 
Query: 342  atgtc 346
            |||||
Sbjct: 2555 atgtc 2551



to top

>gb|AY323293.1| Zea mays Rottaler Silomais O-methyltransferase (comt) gene, partial
            cds
          Length = 3151

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                        
Query: 222  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 281
            ||||| ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| 
Sbjct: 3151 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 3092

                                                                        
Query: 282  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 341
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 3091 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 3032

                 
Query: 342  atgtc 346
            |||||
Sbjct: 3031 atgtc 3027



to top

>gb|AY323278.1| Zea mays Sibiriaka O-methyltransferase (comt) gene, partial cds
          Length = 3146

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Minus

                                                                        
Query: 222  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 281
            ||||| ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| 
Sbjct: 3146 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcg 3087

                                                                        
Query: 282  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 341
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 3086 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 3027

                 
Query: 342  atgtc 346
            |||||
Sbjct: 3026 atgtc 3022



to top

>gb|AY323296.1| Zea mays inbred line F2 O-methyltransferase (comt) gene, partial cds
          Length = 3206

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 101/124 (81%)
 Strand = Plus / Minus

                                                                        
Query: 223  cccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcca 282
            |||| ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| |
Sbjct: 3204 cccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcga 3145

                                                                        
Query: 283  gggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatca 342
            |  |   |||||| | ||| |||| |||| | || || ||||||||||||||||||||||
Sbjct: 3144 gctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatca 3085

                
Query: 343  tgtc 346
            ||||
Sbjct: 3084 tgtc 3081



to top

>gb|AY323301.1| Zea mays inbred line 212 O-methyltransferase (comt) gene, partial cds
          Length = 2757

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 97/119 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 2753 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 2694

                                                                       
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtc 346
              |||||| | ||| |||| |||| | || || ||||||||||||||||||||||||||
Sbjct: 2693 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtc 2635



to top

>gb|AY323291.1| Zea mays inbred line F1 O-methyltransferase (comt) gene, partial cds
          Length = 3102

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 97/119 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 3098 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 3039

                                                                       
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtc 346
              |||||| | ||| |||| |||| | || || ||||||||||||||||||||||||||
Sbjct: 3038 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtc 2980



to top

>gb|AY323285.1| Zea mays inbred line F7 O-methyltransferase (comt) gene, partial cds
          Length = 3131

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 97/119 (81%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| |||||||||||||| ||  | 
Sbjct: 3127 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgcccttggcgagctcg 3068

                                                                       
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtc 346
              |||||| | ||| |||| |||| | || || ||||||||||||||||||||||||||
Sbjct: 3067 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtc 3009



to top

>emb|AJ586106.1| Festuca arundinacea partial mRNA for putative caffeate
           o-methyltransferase (comt gene)
          Length = 878

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 318 cctgggttgtgcgcgagcatgatcatgtc 346
           |||||||||||||||||||||||||||||
Sbjct: 862 cctgggttgtgcgcgagcatgatcatgtc 834



to top

>gb|AY323279.1| Zea mays Rainbow Flint O-methyltransferase (comt) gene, partial cds
          Length = 3111

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 101/125 (80%)
 Strand = Plus / Minus

                                                                        
Query: 222  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 281
            ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||||||| || 
Sbjct: 3111 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcg 3052

                                                                        
Query: 282  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 341
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 3051 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2992

                 
Query: 342  atgtc 346
            |||||
Sbjct: 2991 atgtc 2987



to top

>gb|AY323277.1| Zea mays Polar Dent O-methyltransferase (comt) gene, partial cds
          Length = 3073

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 101/125 (80%)
 Strand = Plus / Minus

                                                                        
Query: 222  gcccatgcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggcc 281
            ||||| ||||| ||||||||||| ||||||||||    || ||| ||||||||||| || 
Sbjct: 3073 gcccaggcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcg 3014

                                                                        
Query: 282  agggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatc 341
            ||  |   |||||| | ||| |||| |||| | || || |||||||||||||||||||||
Sbjct: 3013 agctcgcggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatc 2954

                 
Query: 342  atgtc 346
            |||||
Sbjct: 2953 atgtc 2949



to top

>emb|AJ586105.1| Lolium multiflorum partial mRNA for putative caffeate
           o-methyltransferase (comt gene)
          Length = 878

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 321 gggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 364
           |||||||||||||||||||||||||| | || |||||| |||||
Sbjct: 859 gggttgtgcgcgagcatgatcatgtcgacgtggaacaccccctg 816



to top

>gb|AY323294.1| Zea mays inbred line B14 O-methyltransferase (comt) gene, partial cds
          Length = 2643

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 96/119 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| ||||||||||| || ||  | 
Sbjct: 2639 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcgagctcg 2580

                                                                       
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtc 346
              |||||| | ||| |||| |||| | || || ||||||||||||||||||||||||||
Sbjct: 2579 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtc 2521



to top

>gb|AY323292.1| Zea mays inbred line DE811 O-methyltransferase (comt) gene, partial
            cds
          Length = 2639

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 96/119 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| ||||||||||| || ||  | 
Sbjct: 2635 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcgagctcg 2576

                                                                       
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtc 346
              |||||| | ||| |||| |||| | || || ||||||||||||||||||||||||||
Sbjct: 2575 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtc 2517



to top

>gb|AY323280.1| Zea mays Noordlander O-methyltransferase (comt) gene, partial cds
          Length = 3105

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 96/119 (80%)
 Strand = Plus / Minus

                                                                        
Query: 228  gcgttagcgtagatgtaagtggccttgatggaggcgaacccggcgcccttggccagggcc 287
            ||||| ||||||||||| ||||||||||    || ||| ||||||||||| || ||  | 
Sbjct: 3101 gcgttggcgtagatgtaggtggccttgaacccggagaagccggcgccctttgcgagctcg 3042

                                                                       
Query: 288  tcgaactccctctcatacctctccctaccacctgggttgtgcgcgagcatgatcatgtc 346
              |||||| | ||| |||| |||| | || || ||||||||||||||||||||||||||
Sbjct: 3041 cggaactcgcgctcgtaccgctccttgccgccggggttgtgcgcgagcatgatcatgtc 2983



to top

>gb|AY098514.1| Ananas comosus caffeic acid O-methyltransferase mRNA, partial cds
          Length = 460

 Score = 48.1 bits (24), Expect = 0.020
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 321 gggttgtgcgcgagcatgatcatgtcaaggttgaacacaccctg 364
           ||||||||||| |||||||||||||| | || |||||| |||||
Sbjct: 108 gggttgtgcgccagcatgatcatgtcgacgtggaacacgccctg 65



to top

>emb|AL138831.12| Human DNA sequence from clone RP3-406P24 on chromosome 6 Contains a
             thioredoxin-like pseudogene, the gene for thioredoxin-like
             2 (TXNL2), a novel gene and the 5' end of the gene for
             serine/threonine-protein kinase PRP4 homolog (PRP4),(PR4H,
             PRP4H, KIAA0536). Contains 2 CpG islands, complete
             sequence
          Length = 49600

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 157   ggagcagcaatgagcatgcaag 178
             ||||||||||||||||||||||
Sbjct: 20280 ggagcagcaatgagcatgcaag 20301



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 271     cgcccttggccagggcctcga 291
               |||||||||||||||||||||
Sbjct: 4318826 cgcccttggccagggcctcga 4318846



to top

>emb|AL806522.4| Mouse DNA sequence from clone RP23-167H2 on chromosome 2, complete
              sequence
          Length = 189104

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 100    aaattaagggaaaacataggg 120
              |||||||||||||||||||||
Sbjct: 170272 aaattaagggaaaacataggg 170252



to top

>gb|AY794816.1| Galearia filiformis tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer, partial sequence; chloroplast
          Length = 1013

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 68  aattagaaattggaatgatt 87
           ||||||||||||||||||||
Sbjct: 781 aattagaaattggaatgatt 800



to top

>gb|AY794673.1| Omphalea palmata tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer, partial sequence; chloroplast
          Length = 1088

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 68  aattagaaattggaatgatt 87
           ||||||||||||||||||||
Sbjct: 817 aattagaaattggaatgatt 836



to top

>gb|AY794672.1| Omphalea diandra tRNA-Leu (trnL) gene and trnL-trnF intergenic
           spacer, partial sequence; chloroplast
          Length = 1077

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 68  aattagaaattggaatgatt 87
           ||||||||||||||||||||
Sbjct: 811 aattagaaattggaatgatt 830



to top

>gb|DQ001169.1| Acacia mangium x Acacia auriculiformis caffeic acid
            O-methyltransferase mRNA, complete cds
          Length = 1408

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 56/68 (82%)
 Strand = Plus / Minus

                                                                        
Query: 273  cccttggccagggcctcgaactccctctcatacctctccctaccacctgggttgtgcgcg 332
            ||||||||||| ||||| |||||  |||||  ||||||  | ||||||||||| || || 
Sbjct: 1093 cccttggccagagcctcaaactctttctcagtcctctctttgccacctgggttatgagcc 1034

                    
Query: 333  agcatgat 340
            ||||||||
Sbjct: 1033 agcatgat 1026



to top

>gb|AC138448.9| Medicago truncatula clone mth2-11n13, complete sequence
          Length = 112155

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 42    catatggaatggaccaatgg 61
             ||||||||||||||||||||
Sbjct: 46376 catatggaatggaccaatgg 46357



 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 42    catatggaatggaccaatgg 61
             ||||||||||||||||||||
Sbjct: 39072 catatggaatggaccaatgg 39053



 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 42    catatggaatggaccaatgg 61
             ||||||||||||||||||||
Sbjct: 32824 catatggaatggaccaatgg 32805



to top

>emb|Z83001.1|HSG0453 Human DNA sequence from clone XX-G0453 on chromosome 11, complete
             sequence
          Length = 32246

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 87    tcaaaggatgcaaaaattaa 106
             ||||||||||||||||||||
Sbjct: 26735 tcaaaggatgcaaaaattaa 26716



to top

>emb|AL136373.21| Human DNA sequence from clone RP11-49P4 on chromosome 1p32.2-33
             Contains two novel genes (FLJ40412, FLJ32011), the MKNK1
             gene for MAP kinase-interacting serine/threonine kinase 1,
             the gene for MOB3C protein (MOB3C) and the 3' end of the
             ATPAF1 gene for ATP synthase mitochondrial F1 complex
             assembly factor 1, complete sequence
          Length = 121112

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 306   ctctccctaccacctgggtt 325
             ||||||||||||||||||||
Sbjct: 90353 ctctccctaccacctgggtt 90372



to top

>emb|AL049745.9|HSJ654H19 Human DNA sequence from clone RP4-654H19 on chromosome 1p31.1-33
             Contains the 5' end of the gene for likely ortholog of
             mouse Gli-similar 1 Kruppel-like zinc finger (Glia1)
             (FLJ36155), a novel gene (FLJ10407), a ribosomal protein
             L37 (RPL37) pseudogene and a CpG island, complete sequence
          Length = 117493

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    atggcacaacaattagaaat 77
             ||||||||||||||||||||
Sbjct: 77238 atggcacaacaattagaaat 77257



to top

>gb|AC010282.6| Homo sapiens chromosome 5 clone CTC-555I19, complete sequence
          Length = 191131

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    caacaattagaaattggaat 83
             ||||||||||||||||||||
Sbjct: 85981 caacaattagaaattggaat 86000



to top

>emb|AL663035.8| Mouse DNA sequence from clone RP23-432G17 on chromosome 11 Contains a
              novel pseudogene, complete sequence
          Length = 203319

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 87     tcaaaggatgcaaaaattaa 106
              ||||||||||||||||||||
Sbjct: 147829 tcaaaggatgcaaaaattaa 147810



to top

>gb|AC011478.3| Homo sapiens chromosome 19 clone CTC-565M22, complete sequence
          Length = 100147

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 8     taatgcaacatttaagagaa 27
             ||||||||||||||||||||
Sbjct: 60624 taatgcaacatttaagagaa 60643



to top

>gb|AY094283.1| Zea mays cultivar F_7 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 320

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 273 aactcgatggcccaggcgttggcgtagatgta 304



to top

>gb|AY094282.1| Zea mays cultivar D_9 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 337

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 290 aactcgatggcccaggcgttggcgtagatgta 321



to top

>gb|AY094281.1| Zea mays cultivar D_6 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 321

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 274 aactcgatggcccaggcgttggcgtagatgta 305



to top

>gb|AY094280.1| Zea mays cultivar F_1 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 320

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 273 aactcgatggcccaggcgttggcgtagatgta 304



to top

>gb|AY094279.1| Zea mays cultivar Mo17 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 337

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 290 aactcgatggcccaggcgttggcgtagatgta 321



to top

>gb|AY094276.1| Zea mays cultivar 684 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 328

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 281 aactcgatggcccaggcgttggcgtagatgta 312



to top

>gb|AY094275.1| Zea mays cultivar I_1 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 304

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 257 aactcgatggcccaggcgttggcgtagatgta 288



to top

>gb|AY094274.1| Zea mays cultivar F_2 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 286

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 239 aactcgatggcccaggcgttggcgtagatgta 270



to top

>gb|AY094273.1| Zea mays cultivar G_1 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 308

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 261 aactcgatggcccaggcgttggcgtagatgta 292



to top

>gb|AY094271.1| Zea mays cultivar F_3 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 296

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 249 aactcgatggcccaggcgttggcgtagatgta 280



to top

>gb|AY094270.1| Zea mays cultivar F_5 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 308

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 261 aactcgatggcccaggcgttggcgtagatgta 292



to top

>gb|AY094269.1| Zea mays cultivar H_5 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 320

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 273 aactcgatggcccaggcgttggcgtagatgta 304



to top

>gb|AY094268.1| Zea mays cultivar H_3 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 320

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 273 aactcgatggcccaggcgttggcgtagatgta 304



to top

>gb|AY094267.1| Zea mays cultivar J40 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 307

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 260 aactcgatggcccaggcgttggcgtagatgta 291



to top

>gb|AY094266.1| Zea mays cultivar 647 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 345

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 298 aactcgatggcccaggcgttggcgtagatgta 329



to top

>gb|AY094265.1| Zea mays cultivar B_1 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 324

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 277 aactcgatggcccaggcgttggcgtagatgta 308



to top

>gb|AY094264.1| Zea mays cultivar F_6 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 324

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 277 aactcgatggcccaggcgttggcgtagatgta 308



to top

>gb|AY094263.1| Zea mays cultivar C_5 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 324

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 277 aactcgatggcccaggcgttggcgtagatgta 308



to top

>gb|AY094262.1| Zea mays cultivar H_1 caffeic acid 3-O-methyltransferase, 3' UTR
           and partial cds
          Length = 322

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 213 aactcgattgcccatgcgttagcgtagatgta 244
           |||||||| ||||| ||||| |||||||||||
Sbjct: 275 aactcgatggcccaggcgttggcgtagatgta 306



to top

>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome
          Length = 4352825

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 268     cggcgcccttggccagggcctcga 291
               ||||||| ||||||||||||||||
Sbjct: 1740172 cggcgccattggccagggcctcga 1740195



to top

>ref|XM_395084.2| PREDICTED: Apis mellifera similar to CG5811-PA (LOC411614), mRNA
          Length = 1281

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 53   gaccaatggcacaacaatta 72
            ||||||||||||||||||||
Sbjct: 1214 gaccaatggcacaacaatta 1233



to top

>gb|AE004912.1| Pseudomonas aeruginosa PAO1, section 473 of 529 of the complete
            genome
          Length = 12498

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 271  cgcccttggccagggcctcg 290
            ||||||||||||||||||||
Sbjct: 5666 cgcccttggccagggcctcg 5685



to top

>gb|AF130358.2|AF130358 Homo sapiens chromosome 21q11.2 PAC 90B5, complete sequence
          Length = 197778

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    caaaaattaagggaaaacat 116
             ||||||||||||||||||||
Sbjct: 40577 caaaaattaagggaaaacat 40596



to top

>emb|AL929026.10| Mouse DNA sequence from clone RP23-332K7 on chromosome 2, complete
             sequence
          Length = 124244

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gtaagtggccttgatggagg 261
             ||||||||||||||||||||
Sbjct: 64001 gtaagtggccttgatggagg 63982



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 274     ccttggccagggcctcgaac 293
               ||||||||||||||||||||
Sbjct: 4157398 ccttggccagggcctcgaac 4157417



to top

>gb|AF154918.1|AF154918 Ocimum basilicum caffeic acid O-methyltransferase (COMT2) mRNA,
           complete cds
          Length = 1187

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 305 cctctccctaccacctgggttgtgcgcgagcatgat 340
           ||||||| | |||||||||||||| || ||||||||
Sbjct: 995 cctctccttgccacctgggttgtgagccagcatgat 960



to top

>gb|AC006556.3|AC006556 Homo sapiens, clone hRPK.37_A_1, complete sequence
          Length = 156833

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 97    caaaaattaagggaaaacat 116
             ||||||||||||||||||||
Sbjct: 86222 caaaaattaagggaaaacat 86203



to top

>dbj|AP001660.1| Homo sapiens genomic DNA, chromosome 21q, section 4/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 97     caaaaattaagggaaaacat 116
              ||||||||||||||||||||
Sbjct: 255530 caaaaattaagggaaaacat 255549



to top

>emb|AL078615.2|HS98L15 Homo sapiens chromosome 21 PAC RPCIP704L1598Q2, complete sequence
          Length = 116189

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    caaaaattaagggaaaacat 116
             ||||||||||||||||||||
Sbjct: 66964 caaaaattaagggaaaacat 66983


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,397,702
Number of Sequences: 3902068
Number of extensions: 3397702
Number of successful extensions: 67224
Number of sequences better than 10.0: 102
Number of HSP's better than 10.0 without gapping: 102
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66860
Number of HSP's gapped (non-prelim): 318
length of query: 373
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 351
effective length of database: 17,147,199,772
effective search space: 6018667119972
effective search space used: 6018667119972
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top