Clone Name | rbart59e05 |
---|---|
Clone Library Name | barley_pub |
>gb|AC093289.2| Homo sapiens chromosome 5 clone RP11-473L15, complete sequence Length = 159956 Score = 42.1 bits (21), Expect = 1.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 126 atatgtaagaacagatagggtaaag 150 ||||||||||||||| ||||||||| Sbjct: 85224 atatgtaagaacagaaagggtaaag 85200
>gb|AC135500.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0034J04 map S1466, complete sequence Length = 140012 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 cggcttgccggccatggcgg 299 |||||||||||||||||||| Sbjct: 22794 cggcttgccggccatggcgg 22775
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 cggcttgccggccatggcgg 299 |||||||||||||||||||| Sbjct: 22752863 cggcttgccggccatggcgg 22752844
>gb|AC135501.4| Oryza sativa chromosome 3 BAC OSJNBb0011J16 genomic sequence, complete sequence Length = 124170 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 cggcttgccggccatggcgg 299 |||||||||||||||||||| Sbjct: 90527 cggcttgccggccatggcgg 90508
>emb|AL365444.11| Human DNA sequence from clone RP11-115P16 on chromosome 1 Contains the 3' UTR of a novel gene (DKFZp761P211), the ITPKB gene for inositol 1,4,5-trisphosphate 3-kinase B, two novel genes, a ribosomal protein S27 (metallopanstimulin 1) (RPS27) pseudogene and a CpG island, complete sequence Length = 181144 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 141 tagggtaaagcacattcacg 160 |||||||||||||||||||| Sbjct: 149623 tagggtaaagcacattcacg 149642
>gb|AC132032.1| Homo sapiens 3 BAC RP11-4H14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 106938 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 ctaagcagcataaaccaaca 73 |||||||||||||||||||| Sbjct: 3881 ctaagcagcataaaccaaca 3900
>gb|AC161009.5| Pan troglodytes BAC clone CH251-560O18 from chromosome unknown, complete sequence Length = 168542 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 162 tttcttctccccaaccatac 181 |||||||||||||||||||| Sbjct: 18646 tttcttctccccaaccatac 18627
>gb|AC159908.3| Pan troglodytes BAC clone CH251-330C3 from chromosome unknown, complete sequence Length = 199237 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 162 tttcttctccccaaccatac 181 |||||||||||||||||||| Sbjct: 34549 tttcttctccccaaccatac 34568
>gb|AC154596.2| Mus musculus BAC clone RP23-354C17 from chromosome 17, complete sequence Length = 208266 Score = 40.1 bits (20), Expect = 4.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 71 acagggaccatgcttaaggatgga 94 |||||||||| ||||||||||||| Sbjct: 115967 acagggaccaagcttaaggatgga 115990
>emb|AL114356.1|CNS01BKS Botrytis cinerea strain T4 cDNA library Length = 1140 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 131 taagaacagatagggtaaag 150 |||||||||||||||||||| Sbjct: 822 taagaacagatagggtaaag 803
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 cggcttgccggccatggcgg 299 |||||||||||||||||||| Sbjct: 22745892 cggcttgccggccatggcgg 22745873
>gb|AC092599.3| Homo sapiens BAC clone RP11-118B7 from 2, complete sequence Length = 87341 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 162 tttcttctccccaaccatac 181 |||||||||||||||||||| Sbjct: 66253 tttcttctccccaaccatac 66272
>gb|AE004966.1| Pseudomonas aeruginosa PAO1, section 527 of 529 of the complete genome Length = 10821 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 285 tgccggccatggcggcaagg 304 |||||||||||||||||||| Sbjct: 3587 tgccggccatggcggcaagg 3568
>gb|AY944144.1| HIV-1 clone CHNHLJBF04016c5 from China envelope glycoprotein (env) gene, complete cds Length = 2553 Score = 40.1 bits (20), Expect = 4.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 227 aatagtaatagcagtaccccgaca 250 |||||||||||||||| ||||||| Sbjct: 430 aatagtaatagcagtagcccgaca 453
>gb|AY944143.1| HIV-1 clone CHNHLJBF04016c3 from China envelope glycoprotein (env) gene, complete cds Length = 2553 Score = 40.1 bits (20), Expect = 4.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 227 aatagtaatagcagtaccccgaca 250 |||||||||||||||| ||||||| Sbjct: 430 aatagtaatagcagtagcccgaca 453
>gb|AY905497.1| HIV-1 clone CHNHLJBF04016c4 from China envelope glycoprotein (env) gene, complete cds Length = 2553 Score = 40.1 bits (20), Expect = 4.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 227 aatagtaatagcagtaccccgaca 250 |||||||||||||||| ||||||| Sbjct: 430 aatagtaatagcagtagcccgaca 453
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome Length = 5224283 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 166 ttctccccaaccatacacat 185 |||||||||||||||||||| Sbjct: 3536439 ttctccccaaccatacacat 3536458
>emb|AL772179.17| Mouse DNA sequence from clone RP23-100B18 on chromosome 2, complete sequence Length = 194065 Score = 40.1 bits (20), Expect = 4.3 Identities = 26/28 (92%) Strand = Plus / Plus Query: 117 aaattgaccatatgtaagaacagatagg 144 |||||||||| ||||||||||| ||||| Sbjct: 11638 aaattgaccacatgtaagaacacatagg 11665
>dbj|AB010579.1| Bombyx mori gene for xanthine dehydrogenase, partial cds Length = 18575 Score = 40.1 bits (20), Expect = 4.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 acataatcatgtttgggcat 115 |||||||||||||||||||| Sbjct: 2427 acataatcatgtttgggcat 2408 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,073,283 Number of Sequences: 3902068 Number of extensions: 2073283 Number of successful extensions: 35068 Number of sequences better than 10.0: 19 Number of HSP's better than 10.0 without gapping: 19 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 35007 Number of HSP's gapped (non-prelim): 61 length of query: 323 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 301 effective length of database: 17,147,199,772 effective search space: 5161307131372 effective search space used: 5161307131372 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)