ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart59d05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_225089.3| PREDICTED: Rattus norvegicus similar to Contact... 44 0.31
2emb|BX004984.6| Zebrafish DNA sequence from clone DKEY-3N4, comp... 44 0.31
3emb|AL953891.10| Zebrafish DNA sequence from clone DKEY-28P22, c... 44 0.31
4gb|AC171266.22| Medicago truncatula clone mth2-14o4, complete se... 42 1.2
5emb|BX663614.24| Zebrafish DNA sequence from clone DKEY-148L2 in... 42 1.2
6emb|CR533579.6| Zebrafish DNA sequence from clone CH211-232J20 i... 42 1.2
7gb|AC111111.11| Mus musculus chromosome 3, clone RP23-201A9, com... 42 1.2
8gb|AC110040.8| Mus musculus chromosome 3, clone RP23-276J3, comp... 42 1.2
9gb|AC144766.18| Medicago truncatula clone mth2-17c2, complete se... 42 1.2
10emb|AL163284.2|HS21C084 Homo sapiens chromosome 21 segment HS21C084 42 1.2
11gb|AC149268.21| Medicago truncatula clone mth2-94j16, complete s... 42 1.2
12gb|AC135467.15| Medicago truncatula clone mth2-34h12, complete s... 42 1.2
13emb|AL512641.9| Human DNA sequence from clone RP11-139J15 on chr... 42 1.2
14gb|AC134043.1| Homo sapiens chromosome 5 clone RP11-175K6, compl... 42 1.2
15gb|AC063918.21| Homo sapiens 3 BAC RP11-49C18 (Roswell Park Canc... 42 1.2
16gb|AC119414.51| Medicago truncatula clone mth2-23d7, complete se... 42 1.2
17gb|AC011376.5| Homo sapiens chromosome 5 clone CTB-11I22, comple... 42 1.2
18dbj|BS000160.1| Pan troglodytes chromosome 22 clone:PTB-043M13, ... 42 1.2
19gb|AC104928.8| Mus musculus chromosome 8, clone RP24-111K8, comp... 42 1.2
20emb|AL773569.1|HS247E2 Homo sapiens chromosome 21 from PAC RP1-2... 42 1.2
21emb|AL671888.8| Mouse DNA sequence from clone RP23-247O14 on chr... 42 1.2
22gb|AF500195.1| Oryzias latipes choriogenin H gene, complete cds 42 1.2
23gb|AC186002.3| Pan troglodytes BAC clone CH251-86D23 from chromo... 40 4.9
24gb|AC132385.5| Mus musculus BAC clone RP23-438F21 from chromosom... 40 4.9
25emb|CT009691.8| Zebrafish DNA sequence from clone CH73-64E1 in l... 40 4.9
26gb|AC125122.4| Mus musculus BAC clone RP24-269O4 from chromosome... 40 4.9
27gb|AC125481.23| Medicago truncatula clone mth2-15n13, complete s... 40 4.9
28gb|AC146692.14| Medicago truncatula clone mth2-7n20, complete se... 40 4.9
29emb|AL773545.13| Human DNA sequence from clone RP11-216M21 on ch... 40 4.9
30emb|AL591479.3| Human DNA sequence from clone RP11-154P18 on chr... 40 4.9
31emb|AL513478.10| Human DNA sequence from clone RP11-327I22 on ch... 40 4.9
32gb|L19443.1| Human adenovirus F, complete genome 40 4.9
33emb|AL354718.10| Human DNA sequence from clone RP11-187C18 on ch... 40 4.9
34gb|AC092931.8| Homo sapiens 3 BAC RP11-131O20 (Roswell Park Canc... 40 4.9
35emb|BX890572.9| Zebrafish DNA sequence from clone CH211-234F20 i... 40 4.9
36gb|AC183610.3| Pan troglodytes BAC clone CH251-223D9 from chromo... 40 4.9
37gb|AC146862.24| Medicago truncatula clone mth2-174p12, complete ... 40 4.9
38emb|CR392039.8| Human DNA sequence from clone bP-2171C21 on chro... 40 4.9
39gb|AC174352.7| Medicago truncatula clone mth2-7o1, complete sequ... 40 4.9
40gb|AC135461.11| Medicago truncatula clone mth2-34f24, complete s... 40 4.9
41gb|AC137701.25| Medicago truncatula clone mth2-35h1, complete se... 40 4.9
42gb|AC093795.3| Homo sapiens BAC clone RP11-299P3 from 4, complet... 40 4.9
43gb|AC098973.2| Homo sapiens chromosome 3 clone RP11-286D1, compl... 40 4.9
44emb|CR382287.6| Human DNA sequence from clone bP-21216K13 on chr... 40 4.9
45gb|AC010209.14| Homo sapiens 12 BAC RP11-427C3 (Roswell Park Can... 40 4.9
46gb|AF250284.1|AF250284 Amsacta moorei entomopoxvirus, complete g... 40 4.9
47emb|AL355000.11| Human DNA sequence from clone RP11-78N10 on chr... 40 4.9
48emb|AL929281.7| Zebrafish DNA sequence from clone CH211-237I22, ... 40 4.9
49emb|AL162252.17| Human DNA sequence from clone RP11-55J24 on chr... 40 4.9
50gb|AC161256.3| Mus musculus BAC clone RP24-70H20 from chromosome... 40 4.9
51emb|AL626768.21| Mouse DNA sequence from clone RP23-347B4 on chr... 40 4.9
52gb|M86665.1|ADRVA Enteric mastadenovirus h40 penton protein gene... 40 4.9
53emb|AL645687.13| Mouse DNA sequence from clone RP23-478H15 on ch... 40 4.9

>ref|XM_225089.3| PREDICTED: Rattus norvegicus similar to Contactin associated
            protein-like 3 precursor (Cell recognition molecule
            Caspr3) (LOC290952), mRNA
          Length = 3738

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 279  accaccatttcttctggtgtat 300
            ||||||||||||||||||||||
Sbjct: 2347 accaccatttcttctggtgtat 2368



to top

>emb|BX004984.6| Zebrafish DNA sequence from clone DKEY-3N4, complete sequence
          Length = 264738

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 224    gaataataaataaatcatataa 245
              ||||||||||||||||||||||
Sbjct: 176553 gaataataaataaatcatataa 176574



to top

>emb|AL953891.10| Zebrafish DNA sequence from clone DKEY-28P22, complete sequence
          Length = 242282

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 224   gaataataaataaatcatataa 245
             ||||||||||||||||||||||
Sbjct: 97743 gaataataaataaatcatataa 97764



to top

>gb|AC171266.22| Medicago truncatula clone mth2-14o4, complete sequence
          Length = 137052

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 225   aataataaataaatcatataa 245
             |||||||||||||||||||||
Sbjct: 67974 aataataaataaatcatataa 67954



to top

>emb|BX663614.24| Zebrafish DNA sequence from clone DKEY-148L2 in linkage group 6, complete
              sequence
          Length = 191715

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 225    aataataaataaatcatataa 245
              |||||||||||||||||||||
Sbjct: 127948 aataataaataaatcatataa 127968



to top

>emb|CR533579.6| Zebrafish DNA sequence from clone CH211-232J20 in linkage group 25,
             complete sequence
          Length = 199156

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 225   aataataaataaatcatataa 245
             |||||||||||||||||||||
Sbjct: 55164 aataataaataaatcatataa 55184



to top

>gb|AC111111.11| Mus musculus chromosome 3, clone RP23-201A9, complete sequence
          Length = 233326

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 225    aataataaataaatcatataa 245
              |||||||||||||||||||||
Sbjct: 192611 aataataaataaatcatataa 192591



to top

>gb|AC110040.8| Mus musculus chromosome 3, clone RP23-276J3, complete sequence
          Length = 202391

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 225    aataataaataaatcatataa 245
              |||||||||||||||||||||
Sbjct: 181271 aataataaataaatcatataa 181291



to top

>gb|AC144766.18| Medicago truncatula clone mth2-17c2, complete sequence
          Length = 92099

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 225   aataataaataaatcatataa 245
             |||||||||||||||||||||
Sbjct: 12768 aataataaataaatcatataa 12748



to top

>emb|AL163284.2|HS21C084 Homo sapiens chromosome 21 segment HS21C084
          Length = 340000

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 288    tcttctggtgtatgtagtcttctgt 312
              ||||||| |||||||||||||||||
Sbjct: 134068 tcttctgctgtatgtagtcttctgt 134044



to top

>gb|AC149268.21| Medicago truncatula clone mth2-94j16, complete sequence
          Length = 146810

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 228   aataaataaatcatataacag 248
             |||||||||||||||||||||
Sbjct: 71033 aataaataaatcatataacag 71013



to top

>gb|AC135467.15| Medicago truncatula clone mth2-34h12, complete sequence
          Length = 114945

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 225    aataataaataaatcatataa 245
              |||||||||||||||||||||
Sbjct: 110341 aataataaataaatcatataa 110321



to top

>emb|AL512641.9| Human DNA sequence from clone RP11-139J15 on chromosome 10 Contains the
              5' end of a novel gene (LOC221078) (FLJ23743), two novel
              genes, the gene for ADP-ribosylation-like factor 8 (ARL8),
              a programmed cell death 8 (apoptosis-inducing factor)
              (PDCD8) pseudogene and a CpG island, complete sequence
          Length = 172688

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 228    aataaataaatcatataacagcacatgat 256
              |||||||||||||||| |||| |||||||
Sbjct: 115705 aataaataaatcatatgacagaacatgat 115677



to top

>gb|AC134043.1| Homo sapiens chromosome 5 clone RP11-175K6, complete sequence
          Length = 154098

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 218   atccaagaataataaataaat 238
             |||||||||||||||||||||
Sbjct: 21212 atccaagaataataaataaat 21232



to top

>gb|AC063918.21| Homo sapiens 3 BAC RP11-49C18 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 97001

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 28    tatgcaatgaatagaggacaa 48
             |||||||||||||||||||||
Sbjct: 27042 tatgcaatgaatagaggacaa 27022



to top

>gb|AC119414.51| Medicago truncatula clone mth2-23d7, complete sequence
          Length = 159149

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 225   aataataaataaatcatataa 245
             |||||||||||||||||||||
Sbjct: 54392 aataataaataaatcatataa 54372



to top

>gb|AC011376.5| Homo sapiens chromosome 5 clone CTB-11I22, complete sequence
          Length = 132768

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 218   atccaagaataataaataaat 238
             |||||||||||||||||||||
Sbjct: 82722 atccaagaataataaataaat 82702



to top

>dbj|BS000160.1| Pan troglodytes chromosome 22 clone:PTB-043M13, map 22, complete
             sequences
          Length = 141932

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 288   tcttctggtgtatgtagtcttctgt 312
             ||||||| |||||||||||||||||
Sbjct: 38449 tcttctgctgtatgtagtcttctgt 38425



to top

>gb|AC104928.8| Mus musculus chromosome 8, clone RP24-111K8, complete sequence
          Length = 177873

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 217    catccaagaataataaataaa 237
              |||||||||||||||||||||
Sbjct: 106055 catccaagaataataaataaa 106075



to top

>emb|AL773569.1|HS247E2 Homo sapiens chromosome 21 from PAC RP1-247E2 map 21q22.2,D21S349-MX1,
              complete sequence
          Length = 153402

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 288    tcttctggtgtatgtagtcttctgt 312
              ||||||| |||||||||||||||||
Sbjct: 105703 tcttctgctgtatgtagtcttctgt 105679



to top

>emb|AL671888.8| Mouse DNA sequence from clone RP23-247O14 on chromosome X, complete
            sequence
          Length = 52491

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 338  tgtgcatcctaatcctgatca 358
            |||||||||||||||||||||
Sbjct: 6226 tgtgcatcctaatcctgatca 6206



to top

>gb|AF500195.1| Oryzias latipes choriogenin H gene, complete cds
          Length = 2646

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 50   tatgtttgtcaaacgtttgaa 70
            |||||||||||||||||||||
Sbjct: 1714 tatgtttgtcaaacgtttgaa 1734



to top

>gb|AC186002.3| Pan troglodytes BAC clone CH251-86D23 from chromosome 9, complete
             sequence
          Length = 162651

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   catgatttggaaacctttta 270
             ||||||||||||||||||||
Sbjct: 33903 catgatttggaaacctttta 33922



to top

>gb|AC132385.5| Mus musculus BAC clone RP23-438F21 from chromosome 18, complete
            sequence
          Length = 184478

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 225  aataataaataaatcatata 244
            ||||||||||||||||||||
Sbjct: 7560 aataataaataaatcatata 7541



to top

>emb|CT009691.8| Zebrafish DNA sequence from clone CH73-64E1 in linkage group 5,
             complete sequence
          Length = 99497

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 55    ttgtcaaacgtttgaatttt 74
             ||||||||||||||||||||
Sbjct: 42528 ttgtcaaacgtttgaatttt 42547



to top

>gb|AC125122.4| Mus musculus BAC clone RP24-269O4 from chromosome 18, complete sequence
          Length = 173614

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 225   aataataaataaatcatata 244
             ||||||||||||||||||||
Sbjct: 28486 aataataaataaatcatata 28505



to top

>gb|AC125481.23| Medicago truncatula clone mth2-15n13, complete sequence
          Length = 121953

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 225   aataataaataaatcatata 244
             ||||||||||||||||||||
Sbjct: 34771 aataataaataaatcatata 34790



to top

>gb|AC146692.14| Medicago truncatula clone mth2-7n20, complete sequence
          Length = 108084

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 225   aataataaataaatcatata 244
             ||||||||||||||||||||
Sbjct: 69583 aataataaataaatcatata 69564



to top

>emb|AL773545.13| Human DNA sequence from clone RP11-216M21 on chromosome 9 Contains
             three novel pseudogenes, a pseudogene similar to part of
             meprin A, alpha (PABA peptide hydrolase) (MEP1A), a
             pseudogene similar to part of G protein-coupled receptor
             116 (GPR116), two novel genes, the 5' end of a novel gene
             similar to ankyrin repeat domain 20A (ANKRD20A) and three
             CpG islands, complete sequence
          Length = 165886

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 251   catgatttggaaacctttta 270
             ||||||||||||||||||||
Sbjct: 82508 catgatttggaaacctttta 82489



to top

>emb|AL591479.3| Human DNA sequence from clone RP11-154P18 on chromosome 9 Contains two
              novel pseudogene, a CDRT15 protein pseudogene, a pseudogene
              similar to part of meprin A, alpha (PABA peptide hydrolase)
              (MEP1A) and two CpG islands, complete sequence
          Length = 178933

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 251    catgatttggaaacctttta 270
              ||||||||||||||||||||
Sbjct: 135446 catgatttggaaacctttta 135427



to top

>emb|AL513478.10| Human DNA sequence from clone RP11-327I22 on chromosome 9 Contains a
              pseudogene similar to part of sorting nexin associated
              golgi protein 1 (SNAG1), the ANKRD20A gene for ankyrin
              repeat domain 20A, five novel genes, a pseudogene similar
              to part of eprin A, alpha (PABA peptide hydrolase) (MEP1A)
              and a CpG island, complete sequence
          Length = 180498

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 251    catgatttggaaacctttta 270
              ||||||||||||||||||||
Sbjct: 171845 catgatttggaaacctttta 171864



to top

>gb|L19443.1| Human adenovirus F, complete genome
          Length = 34214

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 250   acatgatttggaaacctttt 269
             ||||||||||||||||||||
Sbjct: 14051 acatgatttggaaacctttt 14032



to top

>emb|AL354718.10| Human DNA sequence from clone RP11-187C18 on chromosome 9 Contains a
              pseudogene similar to part of ribosomal protein L7a
              (RPL7A), three novel genes, three novel pseudogene and two
              CpG islands, complete sequence
          Length = 175271

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 251    catgatttggaaacctttta 270
              ||||||||||||||||||||
Sbjct: 170811 catgatttggaaacctttta 170792



to top

>gb|AC092931.8| Homo sapiens 3 BAC RP11-131O20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 152737

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 251   catgatttggaaacctttta 270
             ||||||||||||||||||||
Sbjct: 49932 catgatttggaaacctttta 49913



to top

>emb|BX890572.9| Zebrafish DNA sequence from clone CH211-234F20 in linkage group 4
             Contains the gene for a novel protein containing two notch
             (DSL) domains and an EF hand domain, the gene for a novel
             protein similar to vertebrate myosin binding protein H
             (MYBPH), the gene for a novel protein sinilar to human and
             mouse CWF19-like 1, cell cycle control (S. pombe)
             (CWF19L1), the gene for a novel protein (zgc:55718), the
             gene for a novel protein containing Kelch motifs and a
             BTB/POZ domain, the sycp3 gene for synaptonemal complex
             protein 3, a novel gene and a CpG island, complete
             sequence
          Length = 166208

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 39    tagaggacaaatatgtttgtcaaa 62
             |||||||||||||||| |||||||
Sbjct: 96713 tagaggacaaatatgtctgtcaaa 96690



to top

>gb|AC183610.3| Pan troglodytes BAC clone CH251-223D9 from chromosome 9, complete
             sequence
          Length = 159456

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   catgatttggaaacctttta 270
             ||||||||||||||||||||
Sbjct: 45717 catgatttggaaacctttta 45736



to top

>gb|AC146862.24| Medicago truncatula clone mth2-174p12, complete sequence
          Length = 114731

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 216   gcatccaagaataataaata 235
             ||||||||||||||||||||
Sbjct: 46503 gcatccaagaataataaata 46484



to top

>emb|CR392039.8| Human DNA sequence from clone bP-2171C21 on chromosome 21, complete
              sequence
          Length = 158069

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 251    catgatttggaaacctttta 270
              ||||||||||||||||||||
Sbjct: 147163 catgatttggaaacctttta 147144



to top

>gb|AC174352.7| Medicago truncatula clone mth2-7o1, complete sequence
          Length = 121626

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 216  gcatccaagaataataaata 235
            ||||||||||||||||||||
Sbjct: 2070 gcatccaagaataataaata 2089



to top

>gb|AC135461.11| Medicago truncatula clone mth2-34f24, complete sequence
          Length = 132875

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 225    aataataaataaatcatata 244
              ||||||||||||||||||||
Sbjct: 113436 aataataaataaatcatata 113455



to top

>gb|AC137701.25| Medicago truncatula clone mth2-35h1, complete sequence
          Length = 151417

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 225   aataataaataaatcatata 244
             ||||||||||||||||||||
Sbjct: 51074 aataataaataaatcatata 51055



to top

>gb|AC093795.3| Homo sapiens BAC clone RP11-299P3 from 4, complete sequence
          Length = 183917

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   catgatttggaaacctttta 270
             ||||||||||||||||||||
Sbjct: 80016 catgatttggaaacctttta 80035



to top

>gb|AC098973.2| Homo sapiens chromosome 3 clone RP11-286D1, complete sequence
          Length = 216172

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    tccaagaataataaataaat 238
              ||||||||||||||||||||
Sbjct: 138387 tccaagaataataaataaat 138368



to top

>emb|CR382287.6| Human DNA sequence from clone bP-21216K13 on chromosome 21, complete
              sequence
          Length = 278310

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 251    catgatttggaaacctttta 270
              ||||||||||||||||||||
Sbjct: 146092 catgatttggaaacctttta 146073



to top

>gb|AC010209.14| Homo sapiens 12 BAC RP11-427C3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 191148

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 221   caagaataataaataaatcatata 244
             |||||| |||||||||||||||||
Sbjct: 79833 caagaaaaataaataaatcatata 79810



to top

>gb|AF250284.1|AF250284 Amsacta moorei entomopoxvirus, complete genome
          Length = 232392

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   aataaataaatcatataaca 247
             ||||||||||||||||||||
Sbjct: 90286 aataaataaatcatataaca 90305



to top

>emb|AL355000.11| Human DNA sequence from clone RP11-78N10 on chromosome 22, complete
             sequence
          Length = 219376

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 251   catgatttggaaacctttta 270
             ||||||||||||||||||||
Sbjct: 89027 catgatttggaaacctttta 89008



to top

>emb|AL929281.7| Zebrafish DNA sequence from clone CH211-237I22, complete sequence
          Length = 148678

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 252  atgatttggaaaccttttagatcc 275
            ||||||||| ||||||||||||||
Sbjct: 5481 atgatttgggaaccttttagatcc 5458



to top

>emb|AL162252.17| Human DNA sequence from clone RP11-55J24 on chromosome 9, complete
              sequence
          Length = 176845

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 251    catgatttggaaacctttta 270
              ||||||||||||||||||||
Sbjct: 134948 catgatttggaaacctttta 134929



to top

>gb|AC161256.3| Mus musculus BAC clone RP24-70H20 from chromosome 9, complete sequence
          Length = 190832

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 225   aataataaataaatcatata 244
             ||||||||||||||||||||
Sbjct: 91229 aataataaataaatcatata 91248



to top

>emb|AL626768.21| Mouse DNA sequence from clone RP23-347B4 on chromosome 4, complete
              sequence
          Length = 227165

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 225    aataataaataaatcatata 244
              ||||||||||||||||||||
Sbjct: 152060 aataataaataaatcatata 152041



to top

>gb|M86665.1|ADRVA Enteric mastadenovirus h40 penton protein gene, complete cds
          Length = 6351

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 250  acatgatttggaaacctttt 269
            ||||||||||||||||||||
Sbjct: 4657 acatgatttggaaacctttt 4638



to top

>emb|AL645687.13| Mouse DNA sequence from clone RP23-478H15 on chromosome 11, complete
             sequence
          Length = 156174

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 225   aataataaataaatcatata 244
             ||||||||||||||||||||
Sbjct: 90006 aataataaataaatcatata 90025


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,660,870
Number of Sequences: 3902068
Number of extensions: 4660870
Number of successful extensions: 111810
Number of sequences better than 10.0: 53
Number of HSP's better than 10.0 without gapping: 53
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 111660
Number of HSP's gapped (non-prelim): 150
length of query: 369
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 347
effective length of database: 17,147,199,772
effective search space: 5950078320884
effective search space used: 5950078320884
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top