ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart58f08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein,... 92 4e-16
2gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, com... 40 1.2
3gb|AC024083.3|AC024083 Homo sapiens chromosome 7 clone RP11-24I2... 40 1.2
4gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, com... 40 1.2
5gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, co... 40 1.2
6gb|AC129477.11| Mus musculus chromosome 13, clone RP23-98D15, co... 38 4.8
7gb|AC164110.4| Mus musculus BAC clone RP23-307N19 from chromosom... 38 4.8
8gb|AC175380.2| Mus musculus BAC clone RP24-333L5 from chromosome... 38 4.8
9gb|AC108821.6| Mus musculus chromosome 15, clone RP23-61D6, comp... 38 4.8
10gb|AC134596.3| Mus musculus BAC clone RP23-435C1 from chromosome... 38 4.8
11emb|AL358354.16| Human DNA sequence from clone RP11-522D2 on chr... 38 4.8
12gb|AC158775.8| Mus musculus chromosome 19, clone RP23-53N8, comp... 38 4.8
13gb|AC087115.10| Mus Musculus Strain C57Bl6/J Chromosome 8 RP23-9... 38 4.8
14gb|AC093671.3| Homo sapiens BAC clone RP11-542P2 from 4, complet... 38 4.8
15gb|AC154203.2| Mus musculus BAC clone RP24-387L1 from chromosome... 38 4.8
16gb|AC153849.8| Mus musculus BAC RP23-97L11 (Roswell Park Cancer... 38 4.8
17gb|AC127540.10| Homo sapiens chromosome 17, clone RP1-77H15, com... 38 4.8
18gb|AC103382.18| Mus musculus chromosome 19, clone RP24-336D23, c... 38 4.8
19gb|AC005822.1|AC005822 Homo sapiens chromosome 17, clone hRPK.20... 38 4.8
20gb|AF003304.1|AF003304 Mus musculus IgG kappa light chain variab... 38 4.8
21emb|AL929259.13| Mouse DNA sequence from clone RP23-141E12 on ch... 38 4.8
22emb|AL731679.9| Mouse DNA sequence from clone RP23-33J13 on chro... 38 4.8
23emb|AJ009612.5|HSAJ9612 Homo sapiens chromosome 17 sequence from... 38 4.8

>dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein, complete cds
          Length = 1053

 Score = 91.7 bits (46), Expect = 4e-16
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                        
Query: 29   aaacatccacattacatctagcagcatccatgggttcccaaatcaacaaacatcagggaa 88
            |||||||||||||||||||||||||| |||||||||| ||| ||||||||||||||| ||
Sbjct: 1035 aaacatccacattacatctagcagcaaccatgggttcacaattcaacaaacatcaggcaa 976

              
Query: 89   aa 90
            ||
Sbjct: 975  aa 974



to top

>gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, complete sequence
          Length = 184893

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    aaacatccacattacatcta 48
             ||||||||||||||||||||
Sbjct: 87241 aaacatccacattacatcta 87260



to top

>gb|AC024083.3|AC024083 Homo sapiens chromosome 7 clone RP11-24I23, complete sequence
          Length = 152283

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 55     tccatgggttcccaaatcaa 74
              ||||||||||||||||||||
Sbjct: 122875 tccatgggttcccaaatcaa 122856



to top

>gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, complete sequence
          Length = 260404

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 29   aaacatccacattacatcta 48
            ||||||||||||||||||||
Sbjct: 1569 aaacatccacattacatcta 1550



to top

>gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, complete sequence
          Length = 188713

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29    aaacatccacattacatcta 48
             ||||||||||||||||||||
Sbjct: 16088 aaacatccacattacatcta 16069



to top

>gb|AC129477.11| Mus musculus chromosome 13, clone RP23-98D15, complete sequence
          Length = 251066

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 65    cccaaatcaacaaacatcaggga 87
             |||| ||||||||||||||||||
Sbjct: 62469 cccagatcaacaaacatcaggga 62447



to top

>gb|AC164110.4| Mus musculus BAC clone RP23-307N19 from chromosome 12, complete
            sequence
          Length = 201050

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 65   cccaaatcaacaaacatcaggga 87
            |||||||||||||||| ||||||
Sbjct: 7888 cccaaatcaacaaacaccaggga 7910



to top

>gb|AC175380.2| Mus musculus BAC clone RP24-333L5 from chromosome 13, complete
            sequence
          Length = 164055

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 65   cccaaatcaacaaacatcaggga 87
            |||| ||||||||||||||||||
Sbjct: 7809 cccagatcaacaaacatcaggga 7831



to top

>gb|AC108821.6| Mus musculus chromosome 15, clone RP23-61D6, complete sequence
          Length = 216909

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 65     cccaaatcaacaaacatcaggga 87
              |||||||||||||||| ||||||
Sbjct: 128670 cccaaatcaacaaacaccaggga 128648



to top

>gb|AC134596.3| Mus musculus BAC clone RP23-435C1 from chromosome 12, complete sequence
          Length = 193068

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 65     cccaaatcaacaaacatcaggga 87
              |||||||||||||||| ||||||
Sbjct: 100331 cccaaatcaacaaacaccaggga 100309



to top

>emb|AL358354.16| Human DNA sequence from clone RP11-522D2 on chromosome 1 Contains the
             5' end of the ACBD6 gene for acyl-Coenzyme A binding
             domain containing 6 and a novel gene (LOC148756), complete
             sequence
          Length = 134060

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 52    gcatccatgggttcccaaa 70
             |||||||||||||||||||
Sbjct: 99475 gcatccatgggttcccaaa 99493



to top

>gb|AC158775.8| Mus musculus chromosome 19, clone RP23-53N8, complete sequence
          Length = 177315

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 65     cccaaatcaacaaacatcaggga 87
              |||| ||||||||||||||||||
Sbjct: 158447 cccagatcaacaaacatcaggga 158469



to top

>gb|AC087115.10| Mus Musculus Strain C57Bl6/J Chromosome 8 RP23-93A22, complete sequence
          Length = 181849

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 65     cccaaatcaacaaacatcaggga 87
              |||| ||||||||||||||||||
Sbjct: 123786 cccagatcaacaaacatcaggga 123764



to top

>gb|AC093671.3| Homo sapiens BAC clone RP11-542P2 from 4, complete sequence
          Length = 186370

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     tagcagcatccatgggttc 65
              |||||||||||||||||||
Sbjct: 123939 tagcagcatccatgggttc 123921



to top

>gb|AC154203.2| Mus musculus BAC clone RP24-387L1 from chromosome 13, complete sequence
          Length = 174845

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 65    cccaaatcaacaaacatcaggga 87
             |||| ||||||||||||||||||
Sbjct: 14351 cccagatcaacaaacatcaggga 14329



to top

>gb|AC153849.8| Mus musculus  BAC RP23-97L11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 205220

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 65     cccaaatcaacaaacatcaggga 87
              |||| ||||||||||||||||||
Sbjct: 101845 cccagatcaacaaacatcaggga 101823



to top

>gb|AC127540.10| Homo sapiens chromosome 17, clone RP1-77H15, complete sequence
          Length = 149000

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 17     acttaataagggaaacatc 35
              |||||||||||||||||||
Sbjct: 100810 acttaataagggaaacatc 100792



to top

>gb|AC103382.18| Mus musculus chromosome 19, clone RP24-336D23, complete sequence
          Length = 172647

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 65     cccaaatcaacaaacatcaggga 87
              |||| ||||||||||||||||||
Sbjct: 121766 cccagatcaacaaacatcaggga 121744



to top

>gb|AC005822.1|AC005822 Homo sapiens chromosome 17, clone hRPK.209_J_20, complete sequence
          Length = 169931

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 17    acttaataagggaaacatc 35
             |||||||||||||||||||
Sbjct: 39810 acttaataagggaaacatc 39828



to top

>gb|AF003304.1|AF003304 Mus musculus IgG kappa light chain variable region mRNA, partial
           cds
          Length = 321

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 71  tcaacaaacatcagggaaa 89
           |||||||||||||||||||
Sbjct: 108 tcaacaaacatcagggaaa 126



to top

>emb|AL929259.13| Mouse DNA sequence from clone RP23-141E12 on chromosome 2, complete
              sequence
          Length = 153645

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 12     ataacacttaataagggaaacat 34
              ||||||||||| |||||||||||
Sbjct: 138191 ataacacttaaaaagggaaacat 138169



to top

>emb|AL731679.9| Mouse DNA sequence from clone RP23-33J13 on chromosome X, complete
             sequence
          Length = 228007

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 71    tcaacaaacatcagggaaa 89
             |||||||||||||||||||
Sbjct: 30806 tcaacaaacatcagggaaa 30824



to top

>emb|AJ009612.5|HSAJ9612 Homo sapiens chromosome 17 sequence from PAC 77H15 region
             D17S842-D17S953 map 17p11.2, complete sequence
          Length = 148978

 Score = 38.2 bits (19), Expect = 4.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 17    acttaataagggaaacatc 35
             |||||||||||||||||||
Sbjct: 48192 acttaataagggaaacatc 48210


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 966,644
Number of Sequences: 3902068
Number of extensions: 966644
Number of successful extensions: 75558
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75517
Number of HSP's gapped (non-prelim): 41
length of query: 106
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 85
effective length of database: 17,151,101,840
effective search space: 1457843656400
effective search space used: 1457843656400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top