>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 318      ggggatcgatccaaggctggctggctgg 345
                ||||||||||||| ||||||||||||||
Sbjct: 30194713 ggggatcgatccatggctggctggctgg 30194686

>gb|AC096855.5| Oryza sativa chromosome 3 BAC OJ1365_D05 genomic sequence, complete
             sequence
          Length = 163972

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 318   ggggatcgatccaaggctggctggctgg 345
             ||||||||||||| ||||||||||||||
Sbjct: 29182 ggggatcgatccatggctggctggctgg 29209

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                            
Query: 318      ggggatcgatccaaggctggctggctgg 345
                ||||||||||||| ||||||||||||||
Sbjct: 30286135 ggggatcgatccatggctggctggctgg 30286108

>emb|AL449403.11| Human DNA sequence from clone RP11-569G13 on chromosome 9 Contains a
              eukaryotic translation initiation factor 4B (EIF4B)
              pseudogene and part of a novel gene, complete sequence
          Length = 173916

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 328    ccaaggctggctggctggctg 348
              |||||||||||||||||||||
Sbjct: 164891 ccaaggctggctggctggctg 164871

>dbj|AP006654.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT31E21, TM0340,
             complete sequence
          Length = 120480

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 102   gttcatcattagttaatgatg 122
             |||||||||||||||||||||
Sbjct: 49900 gttcatcattagttaatgatg 49880

>gb|AC134927.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05,
             complete sequence
          Length = 143400

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   gttgcatgagttcaccggag 145
             ||||||||||||||||||||
Sbjct: 47411 gttgcatgagttcaccggag 47430

>gb|AC121146.8| Mus musculus chromosome 3, clone RP24-297G3, complete sequence
          Length = 157105

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 256   cacttacttatgtatataat 275
             ||||||||||||||||||||
Sbjct: 91921 cacttacttatgtatataat 91940

>ref|XM_981931.1| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 2 (Gpr165), mRNA
          Length = 1700

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 327 tccaaggctggctggctggc 346
           ||||||||||||||||||||
Sbjct: 71  tccaaggctggctggctggc 52

>ref|XM_981895.1| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 1 (Gpr165), mRNA
          Length = 1408

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 327 tccaaggctggctggctggc 346
           ||||||||||||||||||||
Sbjct: 98  tccaaggctggctggctggc 79

>ref|XM_981971.1| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 3 (Gpr165), mRNA
          Length = 3799

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 327 tccaaggctggctggctggc 346
           ||||||||||||||||||||
Sbjct: 71  tccaaggctggctggctggc 52

>ref|XM_895668.2| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 2 (Gpr165), mRNA
          Length = 1700

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 327 tccaaggctggctggctggc 346
           ||||||||||||||||||||
Sbjct: 71  tccaaggctggctggctggc 52

>ref|XM_895689.2| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 3 (Gpr165), mRNA
          Length = 1408

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 327 tccaaggctggctggctggc 346
           ||||||||||||||||||||
Sbjct: 98  tccaaggctggctggctggc 79

>ref|XM_895702.2| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 4 (Gpr165), mRNA
          Length = 3799

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 327 tccaaggctggctggctggc 346
           ||||||||||||||||||||
Sbjct: 71  tccaaggctggctggctggc 52

>ref|XM_919039.2| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 6 (Gpr165), mRNA
          Length = 1700

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 327 tccaaggctggctggctggc 346
           ||||||||||||||||||||
Sbjct: 71  tccaaggctggctggctggc 52

>ref|XM_919056.2| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 7 (Gpr165), mRNA
          Length = 1408

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 327 tccaaggctggctggctggc 346
           ||||||||||||||||||||
Sbjct: 98  tccaaggctggctggctggc 79

>ref|XM_982599.1| PREDICTED: Mus musculus G protein-coupled receptor 165, transcript
           variant 8 (Gpr165), mRNA
          Length = 3694

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 327 tccaaggctggctggctggc 346
           ||||||||||||||||||||
Sbjct: 71  tccaaggctggctggctggc 52

>ref|XM_732823.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000602.03.0)
           partial mRNA
          Length = 561

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 6   aaatcaaattgtatatatgt 25
           ||||||||||||||||||||
Sbjct: 217 aaatcaaattgtatatatgt 236

>emb|AL353613.10| Human DNA sequence from clone RP11-395D3 on chromosome 9 Contains the
             5' end of a novel gene, complete sequence
          Length = 97898

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 328   ccaaggctggctggctggct 347
             ||||||||||||||||||||
Sbjct: 46138 ccaaggctggctggctggct 46157

>emb|AL354872.9| Human DNA sequence from clone RP11-42O15 on chromosome 1 Contains the CTH
              gene for cystathionase (cystathionine gamma-lyase) and a
              cysteine and histidine-rich domain (CHORD)-containing zinc
              binding protein 1 (CHORDC1) pseudogene, complete sequence
          Length = 151777

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 74     agtactaactaatcttatct 93
              ||||||||||||||||||||
Sbjct: 121011 agtactaactaatcttatct 120992

>gb|AY342401.1| Homo sapiens vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR) gene,
             complete cds
          Length = 67076

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 332   ggctggctggctggctgcga 351
             ||||||||||||||||||||
Sbjct: 29674 ggctggctggctggctgcga 29655

>gb|AC010052.7| Drosophila melanogaster 3L BAC RP98-5G1 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 164941

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 6      aaatcaaattgtatatatgt 25
              ||||||||||||||||||||
Sbjct: 142874 aaatcaaattgtatatatgt 142893

>emb|BX470157.6| Zebrafish DNA sequence from clone CH211-119P14 in linkage group 14,
             complete sequence
          Length = 201228

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    aaattgtatatatgtttgta 30
             ||||||||||||||||||||
Sbjct: 59492 aaattgtatatatgtttgta 59473

>emb|BX530085.3| Zebrafish DNA sequence from clone DKEY-18A21 in linkage group 14,
             complete sequence
          Length = 227326

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    aaattgtatatatgtttgta 30
             ||||||||||||||||||||
Sbjct: 49407 aaattgtatatatgtttgta 49388

>gb|AC023722.4| Drosophila melanogaster X BAC RP98-48O24 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 191590

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 329   caaggctggctggctggctg 348
             ||||||||||||||||||||
Sbjct: 89987 caaggctggctggctggctg 89968

>gb|AC010558.4| Drosophila melanogaster 3L BAC RPCI98-1K9 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 170356

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     aaatcaaattgtatatatgt 25
             ||||||||||||||||||||
Sbjct: 68574 aaatcaaattgtatatatgt 68593

>dbj|AK045935.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN
           full-length enriched library, clone:B230324O03
           product:hypothetical Rhodopsin-like GPCR
           superfamily/G-protein coupled receptors family 1 profile
           containing protein, full insert sequence
          Length = 1656

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 327 tccaaggctggctggctggc 346
           ||||||||||||||||||||
Sbjct: 27  tccaaggctggctggctggc 8

>dbj|AK042723.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730018P10 product:hypothetical
           Rhodopsin-like GPCR superfamily/G-protein coupled
           receptors family 1 profile containing protein, full
           insert sequence
          Length = 2558

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 327 tccaaggctggctggctggc 346
           ||||||||||||||||||||
Sbjct: 48  tccaaggctggctggctggc 29

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 126      gttgcatgagttcaccggag 145
                ||||||||||||||||||||
Sbjct: 16096241 gttgcatgagttcaccggag 16096260

>gb|AC004466.1| Homo sapiens 12 PAC RPCI5-1057I20 (Roswell Park Cancer Institute Human
             PAC library) complete sequence
          Length = 122186

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 332   ggctggctggctggctgcga 351
             ||||||||||||||||||||
Sbjct: 13873 ggctggctggctggctgcga 13854

>dbj|AP007253.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0004O05
          Length = 140513

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    gttgcatgagttcaccggag 145
              ||||||||||||||||||||
Sbjct: 126158 gttgcatgagttcaccggag 126139

>emb|AL805947.8| Zebrafish DNA sequence from clone CH211-212P13, complete sequence
          Length = 226542

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      aaatcaaattgtatatatgt 25
              ||||||||||||||||||||
Sbjct: 170618 aaatcaaattgtatatatgt 170599

>emb|BX248242.5| Zebrafish DNA sequence from clone BUSM1-205D10 in linkage group 20,
             complete sequence
          Length = 104779

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 10    caaattgtatatatgtttgt 29
             ||||||||||||||||||||
Sbjct: 31414 caaattgtatatatgtttgt 31433

>gb|AE003548.3| Drosophila melanogaster chromosome 3L, section 37 of 83 of the complete
             sequence
          Length = 244140

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     aaatcaaattgtatatatgt 25
             ||||||||||||||||||||
Sbjct: 79859 aaatcaaattgtatatatgt 79878

>gb|AE003438.3| Drosophila melanogaster chromosome X, section 22 of 74 of the complete
              sequence
          Length = 299943

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 329    caaggctggctggctggctg 348
              ||||||||||||||||||||
Sbjct: 235978 caaggctggctggctggctg 235959

>emb|AL672095.6| Mouse DNA sequence from clone RP23-387N22 on chromosome X, complete
              sequence
          Length = 165970

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 327    tccaaggctggctggctggc 346
              ||||||||||||||||||||
Sbjct: 113744 tccaaggctggctggctggc 113725

>dbj|AP005137.2| Homo sapiens genomic DNA, chromosome 18p clone:RP11-78A19, complete
             sequences
          Length = 80992

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 329   caaggctggctggctggctg 348
             ||||||||||||||||||||
Sbjct: 74613 caaggctggctggctggctg 74594


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,026,380
Number of Sequences: 3902068
Number of extensions: 3026380
Number of successful extensions: 74679
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 74529
Number of HSP's gapped (non-prelim): 150
length of query: 386
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 364
effective length of database: 17,147,199,772
effective search space: 6241580717008
effective search space used: 6241580717008
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)