ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart58e07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL807823.6| Mouse DNA sequence from clone RP23-328E6 on chro... 50 0.003
2emb|AL663087.14| Mouse DNA sequence from clone RP23-431M5 on chr... 44 0.18
3dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.18
4dbj|AP003268.4| Oryza sativa (japonica cultivar-group) genomic D... 44 0.18
5dbj|AP003249.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.18
6emb|AL928866.7| Zebrafish DNA sequence from clone DKEY-11E23 in ... 42 0.73
7gb|CP000027.1| Dehalococcoides ethenogenes 195, complete genome 40 2.9
8ref|NM_129824.1| Arabidopsis thaliana ATP binding / kinase/ prot... 40 2.9
9gb|AC118206.11| Mus musculus chromosome 3, clone RP24-159J16, co... 40 2.9
10emb|AL365495.14| Human DNA sequence from clone RP11-308K19 on ch... 40 2.9
11emb|AL109612.7|HSJ1018A4 Human DNA sequence from clone RP5-1018A... 40 2.9
12gb|AE008773.1| Salmonella typhimurium LT2, section 77 of 220 of ... 40 2.9
13emb|AL627270.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 2.9
14emb|AJ292319.1|ATH292319 Arabidopsis thaliana ptk1 gene for puta... 40 2.9
15emb|BX914198.13| Zebrafish DNA sequence from clone DKEY-7I21 in ... 40 2.9
16gb|AC044781.12| Homo sapiens chromosome 10 clone RP11-142M10, co... 40 2.9
17gb|AC007087.7| Arabidopsis thaliana chromosome 2 clone F14N22 ma... 40 2.9
18gb|AC093950.6| Homo sapiens 12 BAC RP11-212B17 (Roswell Park Can... 40 2.9
19gb|AC008728.7| Homo sapiens chromosome 5 clone CTB-99A3, complet... 40 2.9
20gb|AC091970.3| Homo sapiens chromosome 5 clone RP11-509B9, compl... 40 2.9
21gb|U22467.1|LCU22467 Lucilia cuprina transposon hermit transposa... 40 2.9
22dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.9
23gb|AC154843.2| Mus musculus BAC clone RP23-58N15 from chromosome... 40 2.9
24gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 40 2.9
25dbj|AP004746.3| Oryza sativa (japonica cultivar-group) genomic D... 40 2.9
26gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 40 2.9
27emb|AL133444.4|CNS01DV0 Human chromosome 14 DNA sequence BAC R-7... 40 2.9
28gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 40 2.9
29gb|AC151286.4| Mus musculus BAC clone RP23-368B8 from chromosome... 40 2.9
30gb|AC132149.4| Mus musculus BAC clone RP23-10H23 from 3, complet... 40 2.9
31dbj|AB215412.1| Equus caballus DNA, microsatellite TKY1469 40 2.9
32gb|AC165087.4| Mus musculus BAC clone RP23-198K7 from chromosome... 40 2.9
33gb|AY631404.1| Cryptocercus primarius 16S ribosomal RNA gene, pa... 40 2.9

>emb|AL807823.6| Mouse DNA sequence from clone RP23-328E6 on chromosome 4, complete
             sequence
          Length = 216239

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 122   ttaacttctctaaactcacaggaaaattt 150
             |||||||||||||| ||||||||||||||
Sbjct: 89717 ttaacttctctaaagtcacaggaaaattt 89689



to top

>emb|AL663087.14| Mouse DNA sequence from clone RP23-431M5 on chromosome 11 Contains the
             5' end of the Grb10 gene for growth factor receptor bound
             protein 10, a nucleosome assembly protein 1-like 1
             (Nap1l1) pseudogene and three CpG islands, complete
             sequence
          Length = 174389

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 172   aaaaaatccccactatccatgacaaaattgtactgggaaatt 213
             |||||||| | | |||||||||| || |||||||||||||||
Sbjct: 10992 aaaaaatctctaatatccatgactaacttgtactgggaaatt 10951



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 36       ctggatctgccaaaattatcttacaa 61
                |||||||| |||||||||||||||||
Sbjct: 31587757 ctggatcttccaaaattatcttacaa 31587732



to top

>dbj|AP003268.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
            clone:P0503C12
          Length = 147180

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 36   ctggatctgccaaaattatcttacaa 61
            |||||||| |||||||||||||||||
Sbjct: 1489 ctggatcttccaaaattatcttacaa 1464



to top

>dbj|AP003249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0435B05
          Length = 150997

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 36     ctggatctgccaaaattatcttacaa 61
              |||||||| |||||||||||||||||
Sbjct: 100780 ctggatcttccaaaattatcttacaa 100755



to top

>emb|AL928866.7| Zebrafish DNA sequence from clone DKEY-11E23 in linkage group 20,
              complete sequence
          Length = 249759

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 64     aatttacatcaataacattat 84
              |||||||||||||||||||||
Sbjct: 221552 aatttacatcaataacattat 221572



to top

>gb|CP000027.1| Dehalococcoides ethenogenes 195, complete genome
          Length = 1469720

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 48      aaattatcttacaaaaaatt 67
               ||||||||||||||||||||
Sbjct: 1010545 aaattatcttacaaaaaatt 1010564



to top

>ref|NM_129824.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein
           serine/threonine kinase/ protein-tyrosine kinase
           AT2G42630 mRNA, complete cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 82  tatgttccactcttcaaatgggaacaaa 109
           ||||||||| ||||||||||| ||||||
Sbjct: 297 tatgttccattcttcaaatggtaacaaa 270



to top

>gb|AC118206.11| Mus musculus chromosome 3, clone RP24-159J16, complete sequence
          Length = 255036

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 90     actcttcaaatgggaacaaaagca 113
              |||||||||| |||||||||||||
Sbjct: 243332 actcttcaaaagggaacaaaagca 243355



to top

>emb|AL365495.14| Human DNA sequence from clone RP11-308K19 on chromosome 10 Contains part
              of the gene for a novel protein (FLJ10210), complete
              sequence
          Length = 185049

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 142    ggaaaatttacatgttatatgtca 165
              ||||||||||||| ||||||||||
Sbjct: 169896 ggaaaatttacattttatatgtca 169873



to top

>emb|AL109612.7|HSJ1018A4 Human DNA sequence from clone RP5-1018A4 on chromosome 6q12-13 Contains
             part of a novel gene, part of the gene for a novel
             EGF-like domain containing protein and a novel gene,
             complete sequence
          Length = 106273

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 46    caaaattatcttacaaaaaattta 69
             |||||| |||||||||||||||||
Sbjct: 72061 caaaataatcttacaaaaaattta 72038



to top

>gb|AE008773.1| Salmonella typhimurium LT2, section 77 of 220 of the complete
           genome
          Length = 20449

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 47  aaaattatcttacaaaaaat 66
           ||||||||||||||||||||
Sbjct: 107 aaaattatcttacaaaaaat 88



to top

>emb|AL627270.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
             complete chromosome; segment 6/20
          Length = 266050

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    aaaattatcttacaaaaaat 66
             ||||||||||||||||||||
Sbjct: 66679 aaaattatcttacaaaaaat 66698



to top

>emb|AJ292319.1|ATH292319 Arabidopsis thaliana ptk1 gene for putative protein tyrosine
           kinase, exons 1-8
          Length = 2178

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 82  tatgttccactcttcaaatgggaacaaa 109
           ||||||||| ||||||||||| ||||||
Sbjct: 662 tatgttccattcttcaaatggtaacaaa 635



to top

>emb|BX914198.13| Zebrafish DNA sequence from clone DKEY-7I21 in linkage group 3,
             complete sequence
          Length = 119178

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 63    aaatttacatcaataacattatgt 86
             ||||||||||||||||||| ||||
Sbjct: 89871 aaatttacatcaataacataatgt 89848



to top

>gb|AC044781.12| Homo sapiens chromosome 10 clone RP11-142M10, complete sequence
          Length = 177448

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 142   ggaaaatttacatgttatatgtca 165
             ||||||||||||| ||||||||||
Sbjct: 36782 ggaaaatttacattttatatgtca 36759



to top

>gb|AC007087.7| Arabidopsis thaliana chromosome 2 clone F14N22 map mi551, complete
             sequence
          Length = 96685

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 82    tatgttccactcttcaaatgggaacaaa 109
             ||||||||| ||||||||||| ||||||
Sbjct: 25779 tatgttccattcttcaaatggtaacaaa 25752



to top

>gb|AC093950.6| Homo sapiens 12 BAC RP11-212B17 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 20794

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 52    tatcttacaaaaaatttacatcaa 75
             |||||||||||||| |||||||||
Sbjct: 12033 tatcttacaaaaaacttacatcaa 12056



to top

>gb|AC008728.7| Homo sapiens chromosome 5 clone CTB-99A3, complete sequence
          Length = 165853

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 156    ttatatgtcacgaattaaaa 175
              ||||||||||||||||||||
Sbjct: 140200 ttatatgtcacgaattaaaa 140181



to top

>gb|AC091970.3| Homo sapiens chromosome 5 clone RP11-509B9, complete sequence
          Length = 170119

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    attatgttccactcttcaaa 99
             ||||||||||||||||||||
Sbjct: 98788 attatgttccactcttcaaa 98807



to top

>gb|U22467.1|LCU22467 Lucilia cuprina transposon hermit transposase gene, complete cds
          Length = 2716

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 50   attatcttacaaaaaattta 69
            ||||||||||||||||||||
Sbjct: 2223 attatcttacaaaaaattta 2204



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 144     aaaatttacatgttatatgt 163
               ||||||||||||||||||||
Sbjct: 5528691 aaaatttacatgttatatgt 5528710



to top

>gb|AC154843.2| Mus musculus BAC clone RP23-58N15 from chromosome 14, complete sequence
          Length = 199716

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 187    tccatgacaaaattgtactg 206
              ||||||||||||||||||||
Sbjct: 160608 tccatgacaaaattgtactg 160627



to top

>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 47      aaaattatcttacaaaaaat 66
               ||||||||||||||||||||
Sbjct: 1309234 aaaattatcttacaaaaaat 1309253



to top

>dbj|AP004746.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0035F08
          Length = 167446

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 144   aaaatttacatgttatatgt 163
             ||||||||||||||||||||
Sbjct: 54919 aaaatttacatgttatatgt 54938



to top

>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 47      aaaattatcttacaaaaaat 66
               ||||||||||||||||||||
Sbjct: 1607503 aaaattatcttacaaaaaat 1607484



to top

>emb|AL133444.4|CNS01DV0 Human chromosome 14 DNA sequence BAC R-724F15 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 192387

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   aaaagcataaaatggttaac 126
             ||||||||||||||||||||
Sbjct: 25175 aaaagcataaaatggttaac 25156



to top

>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
               complete genome
          Length = 4755700

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 47      aaaattatcttacaaaaaat 66
               ||||||||||||||||||||
Sbjct: 1753170 aaaattatcttacaaaaaat 1753151



to top

>gb|AC151286.4| Mus musculus BAC clone RP23-368B8 from chromosome 17, complete sequence
          Length = 178835

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 57     tacaaaaaatttacatcaataaca 80
              |||||||||| |||||||||||||
Sbjct: 100198 tacaaaaaatatacatcaataaca 100221



to top

>gb|AC132149.4| Mus musculus BAC clone RP23-10H23 from 3, complete sequence
          Length = 217329

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 90     actcttcaaatgggaacaaaagca 113
              |||||||||| |||||||||||||
Sbjct: 137538 actcttcaaaagggaacaaaagca 137515



to top

>dbj|AB215412.1| Equus caballus DNA, microsatellite TKY1469
          Length = 284

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 195 aaaattgtactgggaaattt 214
           ||||||||||||||||||||
Sbjct: 140 aaaattgtactgggaaattt 159



to top

>gb|AC165087.4| Mus musculus BAC clone RP23-198K7 from chromosome 17, complete
            sequence
          Length = 211272

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 57   tacaaaaaatttacatcaataaca 80
            |||||||||| |||||||||||||
Sbjct: 2993 tacaaaaaatatacatcaataaca 2970



to top

>gb|AY631404.1| Cryptocercus primarius 16S ribosomal RNA gene, partial sequence;
           mitochondrial
          Length = 408

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  aaaattatcttacaaaaaat 66
           ||||||||||||||||||||
Sbjct: 136 aaaattatcttacaaaaaat 155


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,142,571
Number of Sequences: 3902068
Number of extensions: 3142571
Number of successful extensions: 224257
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 223919
Number of HSP's gapped (non-prelim): 338
length of query: 226
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 204
effective length of database: 17,147,199,772
effective search space: 3498028753488
effective search space used: 3498028753488
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top