ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart58d08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 109 8e-22
2gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 58 3e-06
3gb|AC155942.6| Mus musculus 10 BAC RP24-492L7 (Roswell Park Canc... 44 0.040
4gb|AC153156.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 42 0.16
5gb|AC104706.2| Oryza sativa (japonica cultivar-group) chromosome... 42 0.16
6emb|BX537273.16| Zebrafish DNA sequence from clone CH211-151F2 i... 42 0.16
7gb|AC116631.6| Homo sapiens BAC clone RP11-429B11 from 4, comple... 42 0.16
8dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.16
9emb|CR361565.8| Zebrafish DNA sequence from clone CH211-242L1 in... 42 0.16
10emb|BX005014.5| Zebrafish DNA sequence from clone CH211-103E2 in... 42 0.16
11gb|AC117081.2| Dictyostelium discoideum chromosome 2 map 5862124... 40 0.62
12gb|AC122907.4| Mus musculus BAC clone RP23-49I4 from chromosome ... 40 0.62
13emb|BX511098.5| Zebrafish DNA sequence from clone CH211-202L3 in... 40 0.62
14gb|AC104511.5| Drosophila melanogaster X BAC RP98-39D14 (Roswell... 40 0.62
15emb|BX004760.10| Zebrafish DNA sequence from clone CH211-222O4 i... 40 0.62
16gb|AC011763.6|AC011763 Drosophila melanogaster, chromosome 3R, r... 40 0.62
17gb|AC155299.2| Mus musculus BAC clone RP24-229D17 from chromosom... 40 0.62
18emb|AL929213.5| Zebrafish DNA sequence from clone CH211-144A19, ... 40 0.62
19emb|BX255893.5| Zebrafish DNA sequence from clone CH211-272H10 i... 40 0.62
20gb|AE003717.2| Drosophila melanogaster chromosome 3R, section 55... 40 0.62
21gb|AE003491.4| Drosophila melanogaster chromosome X, section 43 ... 40 0.62
22gb|AC093196.2| Drosophila melanogaster clone BACR22H06, complete... 38 2.5
23gb|AC009744.8| Drosophila melanogaster clone BACR06G16, complete... 38 2.5
24gb|AY180151.1| Herpetomonas muscarum small subunit ribosomal RNA... 38 2.5
25gb|AC185533.1| Drosophila melanogaster clone BACR48D21, complete... 38 2.5
26emb|AL390785.15| Human DNA sequence from clone RP11-325N9 on chr... 38 2.5
27gb|AC160115.2| Mus musculus BAC clone RP23-473K23 from chromosom... 38 2.5
28emb|CR846090.6| Zebrafish DNA sequence from clone DKEYP-78E10 in... 38 2.5
29gb|AC089987.26| Homo sapiens 12q BAC RP11-722P11 (Roswell Park C... 38 2.5
30ref|NM_176004.1| Drosophila melanogaster CG13125-RB, transcript ... 38 2.5
31ref|NM_135481.2| Drosophila melanogaster CG13125-RA, transcript ... 38 2.5
32gb|AE009926.1|AE009926 Pyrobaculum aerophilum strain IM2 section... 38 2.5
33dbj|AK038482.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 38 2.5
34gb|AE003626.4| Drosophila melanogaster chromosome 2L, section 35... 38 2.5
35gb|AE003573.4| Drosophila melanogaster chromosome X, section 74 ... 38 2.5
36gb|AC125020.7| Mus musculus chromosome 12, clone RP24-181E5, com... 38 2.5
37gb|AC005135.1|AC005135 Drosophila melanogaster DNA sequence (P1 ... 38 2.5
38gb|AC119202.6| Mus musculus chromosome 8, clone RP24-185N3, comp... 38 2.5
39emb|AL845332.11| Mouse DNA sequence from clone RP23-326D18 on ch... 38 2.5
40emb|AL845170.5| Mouse DNA sequence from clone RP23-282A22 on chr... 38 2.5
41gb|AY689436.1| Deerpox virus W-848-83, complete genome 36 9.7
42gb|AC124810.14| Mus musculus chromosome 15, clone RP23-163N4, co... 36 9.7
43gb|AC164644.5| Mus musculus BAC clone RP23-276J7 from chromosome... 36 9.7
44gb|AE014832.1| Plasmodium falciparum 3D7 chromosome 10 section 4... 36 9.7
45gb|AE014850.1| Plasmodium falciparum 3D7 chromosome 12, section ... 36 9.7
46gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence 36 9.7
47gb|AC084047.3| Trypanosoma brucei chromosome 6 clone RPCI93-5F5,... 36 9.7
48gb|AC008341.3| Drosophila melanogaster clone BACR15P11, complete... 36 9.7
49gb|AC010848.14| Drosophila melanogaster clone BACR20N11, complet... 36 9.7
50gb|AC146506.1| Solanum demissum chromosome 5 BAC PGEC989P08 geno... 36 9.7
51gb|AC011251.6| Drosophila melanogaster clone BACR09F10, complete... 36 9.7
52ref|XM_457863.1| Debaryomyces hansenii CBS767 hypothetical prote... 36 9.7
53gb|AC133464.11| Mus musculus chromosome 16, clone RP24-459O21, c... 36 9.7
54gb|AC157930.7| Mus musculus chromosome 5, clone RP24-151E22, com... 36 9.7
55gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 36 9.7
56gb|AC116421.8| Mus musculus chromosome 9, clone RP24-142L1, comp... 36 9.7
57gb|AC134790.6| Mus musculus chromosome 15, clone RP24-541O5, com... 36 9.7
58gb|AC005158.3| Homo sapiens BAC clone GS1-250N6 from 7, complete... 36 9.7
59emb|CR382386.8| Zebrafish DNA sequence from clone DKEY-111O10 in... 36 9.7
60gb|AC122848.3| Mus musculus BAC clone RP23-166K13 from chromosom... 36 9.7
61emb|AL954219.1| Pan troglodytes chromosome 22 clone PTB-302M06 m... 36 9.7
62emb|BX927362.10| Zebrafish DNA sequence from clone CH211-170N20 ... 36 9.7
63gb|AC127259.3| Mus musculus BAC clone RP24-304A20 from chromosom... 36 9.7
64gb|AC126278.4| Mus musculus BAC clone RP23-161M1 from 7, complet... 36 9.7
65emb|AL713986.10| Mouse DNA sequence from clone RP23-142G13 on ch... 36 9.7
66gb|AC121599.3| Mus musculus BAC clone RP23-300H21 from 14, compl... 36 9.7
67ref|XM_726111.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 36 9.7
68ref|XM_949722.1| Theileria annulata strain Ankara hypothetical p... 36 9.7
69gb|AC073884.4| Homo sapiens BAC clone CTD-2006F7 from 7, complet... 36 9.7
70ref|XM_738210.1| Plasmodium chabaudi chabaudi hypothetical prote... 36 9.7
71gb|AC074085.7| Homo sapiens BAC clone RP11-3L10 from 7, complete... 36 9.7
72ref|XM_672224.1| Plasmodium berghei strain ANKA hypothetical pro... 36 9.7
73gb|AC113204.7| Mus musculus chromosome 12, clone RP23-312J1, com... 36 9.7
74gb|AC146185.2| Pan troglodytes BAC clone RP43-35O6 from 7, compl... 36 9.7
75gb|AC144823.2| Danio rerio clone CH211-150P19, complete sequence 36 9.7
76gb|AC102934.11| Mus musculus chromosome 3, clone RP24-209C11, co... 36 9.7
77emb|AL590239.7| Human DNA sequence from clone RP11-466D24 on chr... 36 9.7
78emb|AL590386.5| Human DNA sequence from clone RP11-721G21 on chr... 36 9.7
79gb|AC133340.4| Oryza sativa chromosome 3 BAC clone OSJNBb0024J17... 36 9.7
80emb|AL356100.8| Human DNA sequence from clone RP11-359H22 on chr... 36 9.7
81emb|AL135785.10| Human DNA sequence from clone RP11-113O24 on ch... 36 9.7
82emb|AL121922.16|HSJ647O12 Human DNA sequence from clone RP4-647O... 36 9.7
83gb|AC124157.4| Equus caballus clone CH241-37P10, complete sequence 36 9.7
84emb|AL022323.7|HS243E7 Human DNA sequence from clone CTA-243E7 o... 36 9.7
85ref|XM_965112.1| PREDICTED: Tribolium castaneum similar to CG311... 36 9.7
86emb|CR382135.1| Debaryomyces hansenii chromosome C of strain CBS... 36 9.7
87emb|AJ508355.1|BMA508355 Brugia malayi ORF1, ORF2, ORF3 and ORF4... 36 9.7
88emb|BX530030.12| Zebrafish DNA sequence from clone DKEY-38K9 in ... 36 9.7
89emb|BX005005.19| Zebrafish DNA sequence from clone DKEY-70O15 in... 36 9.7
90emb|AL662802.14| Mouse DNA sequence from clone RP23-34N10 on chr... 36 9.7
91gb|AC005185.1| Homo sapiens Xp22 BAC GSHB-383H3 (Genome Systems ... 36 9.7
92gb|AC055788.7| Homo sapiens chromosome 8, clone RP11-252H14, com... 36 9.7
93gb|AC159903.3| Pan troglodytes BAC clone CH251-459A3 from chromo... 36 9.7
94emb|BX323012.5| Zebrafish DNA sequence from clone DKEYP-46F3, co... 36 9.7
95gb|AC112247.5| Homo sapiens BAC clone RP11-606P2 from 4, complet... 36 9.7
96emb|BX649556.9| Zebrafish DNA sequence from clone DKEY-29M1 in l... 36 9.7
97gb|AC012417.13| Homo sapiens chromosome 18, clone RP11-408H20, c... 36 9.7
98gb|AC096763.2| Homo sapiens BAC clone RP11-625A6 from 4, complet... 36 9.7
99gb|AC093768.3| Homo sapiens BAC clone RP11-113G13 from 4, comple... 36 9.7
100gb|AC009520.16| Homo sapiens 3 BAC RP11-392H18 (Roswell Park Can... 36 9.7
101gb|AY061050.1| Drosophila melanogaster LD02060 full length cDNA 36 9.7
102gb|AC114412.9| Mus musculus chromosome 12, clone RP23-56P12, com... 36 9.7
103gb|AF165613.1|AF165613 Pecari tajacu protein kinase C iota gene,... 36 9.7
104gb|AC102477.18| Mus musculus chromosome 5, clone RP24-405C17, co... 36 9.7
105gb|AC160246.2| Mus musculus BAC clone RP24-465F1 from chromosome... 36 9.7
106gb|AC091123.4| Oryza sativa chromosome 3 BAC OSJNBb0093E13 genom... 36 9.7
107gb|AC155231.2| Mus musculus BAC clone RP24-336I23 from chromosom... 36 9.7
108gb|AF210192.1|AF210192 Neotragus moschatus protein kinase C iota... 36 9.7
109gb|AC025212.5|AC025212 Homo sapiens chromosome 18, clone RP11-28... 36 9.7
110gb|AC153992.7| Mus musculus 6 BAC RP24-116E17 (Roswell Park Canc... 36 9.7
111dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 36 9.7
112dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 36 9.7
113gb|AC007086.10|AC007086 Drosophila melanogaster, chromosome 2R, ... 36 9.7
114emb|BX323804.9| Zebrafish DNA sequence from clone DKEY-270K22 in... 36 9.7
115emb|BX537121.4| Zebrafish DNA sequence from clone CH211-196P24 i... 36 9.7
116gb|BT006008.1| Drosophila melanogaster LD18978 full insert cDNA 36 9.7
117gb|AC008314.7|AC008314 Drosophila melanogaster, chromosome 3R, r... 36 9.7
118gb|AC007402.3| Homo sapiens BAC clone RP11-545K2 from 2, complet... 36 9.7
119gb|AC156946.1| Pan troglodytes BAC clone CH251-342L21 from chrom... 36 9.7
120gb|AC154840.2| Mus musculus BAC clone RP23-61I7 from chromosome ... 36 9.7
121gb|AC146165.2| Pan troglodytes BAC clone RP43-36N14 from chromos... 36 9.7
122gb|AC154656.2| Mus musculus BAC clone RP24-268M5 from chromosome... 36 9.7
123gb|AC017071.9| Homo sapiens BAC clone RP11-410E4 from 2, complet... 36 9.7
124gb|AF293359.1|AF293359 Homo sapiens desmocollin 3 (DSC3) gene, c... 36 9.7
125gb|AC008169.2| Homo sapiens BAC clone RP11-252D22 from 2, comple... 36 9.7
126gb|AC068764.18| Homo sapiens 3 BAC RP11-138E24 (Roswell Park Can... 36 9.7
127emb|BX119910.7| Zebrafish DNA sequence from clone DKEY-17C10 in ... 36 9.7
128gb|AC127287.4| Mus musculus BAC clone RP23-345G7 from chromosome... 36 9.7
129emb|BX004868.9| Zebrafish DNA sequence from clone DKEY-209F8, co... 36 9.7
130emb|AL928668.7| Zebrafish DNA sequence from clone CH211-208M1, c... 36 9.7
131dbj|AB016882.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 36 9.7
132emb|BX537337.9| Zebrafish DNA sequence from clone CH211-222E23 i... 36 9.7
133emb|BX321888.21| Zebrafish DNA sequence from clone DKEYP-47D4 in... 36 9.7
134emb|BX530065.7| Zebrafish DNA sequence from clone CH211-73J11 in... 36 9.7
135gb|AC154869.3| Monodelphis domestica, clone XX-216E9, complete s... 36 9.7
136emb|CT025695.6| Zebrafish DNA sequence from clone CH211-246B8 in... 36 9.7
137emb|CT009613.14| Mouse DNA sequence from clone RP23-55L9 on chro... 36 9.7
138gb|AE003680.4| Drosophila melanogaster chromosome 3R, section 18... 36 9.7
139gb|AE003833.4| Drosophila melanogaster chromosome 2R, section 17... 36 9.7
140gb|AE003568.4| Drosophila melanogaster chromosome X, section 71 ... 36 9.7
141gb|AC138245.11| Mus musculus chromosome 17, clone RP23-75D10, co... 36 9.7
142gb|AC131325.8| Mus musculus chromosome 17, clone RP23-431O10, co... 36 9.7
143emb|CT573089.2| RP43-058A24, complete sequence 36 9.7
144emb|CT573031.6| Mouse DNA sequence from clone RP24-244H14 on chr... 36 9.7
145emb|BX088545.7| Zebrafish DNA sequence from clone DKEY-60G19 in ... 36 9.7
146emb|AL831731.6| Mouse DNA sequence from clone RP23-442K11 on chr... 36 9.7
147gb|AC119921.12| Mus musculus chromosome 12, clone RP24-252B23, c... 36 9.7
148gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 36 9.7
149emb|BX005077.5| Zebrafish DNA sequence from clone CH211-113D11 i... 36 9.7
150emb|AL954871.5|CNS08CDA Oryza sativa chromosome 12, . BAC OSJNBb... 36 9.7
151emb|AL845342.2|CNS08CB4 Oryza sativa chromosome 12, . BAC OSJNBa... 36 9.7
152gb|U93163.1|HSU93163 Homo sapiens MAGE-B2 (MAGE-B2), MAGE-B3 (MA... 36 9.7
153gb|AC002366.1|AC002366 Human Xp22 BAC CT-285I15 (from CalTech/Re... 36 9.7
154emb|AL928876.12| Mouse DNA sequence from clone RP23-236O6 on chr... 36 9.7
155emb|CR384057.25| Zebrafish DNA sequence from clone CH211-243K10 ... 36 9.7
156emb|CR376825.16| Zebrafish DNA sequence from clone CH211-136O20 ... 36 9.7
157emb|BX005452.7| Mouse DNA sequence from clone RP23-158K12 on chr... 36 9.7
158emb|CT010457.7| Mouse DNA sequence from clone RP23-96M8 on chrom... 36 9.7
159emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 36 9.7
160gb|DP000020.1| Equus caballus target 1 genomic scaffold 36 9.7
161emb|AL935057.7| Mouse DNA sequence from clone RP23-90D6 on chrom... 36 9.7 
>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score =  109 bits (55), Expect = 8e-22
 Identities = 55/55 (100%)
 Strand = Plus / Minus

                                                                   
Query: 7    ttaataataatttacatacatatgcacgctggattaaatggcgtgcgtggtactg 61
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1264 ttaataataatttacatacatatgcacgctggattaaatggcgtgcgtggtactg 1210
to top
>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 58.0 bits (29), Expect = 3e-06
 Identities = 48/53 (90%), Gaps = 1/53 (1%)
 Strand = Plus / Minus

                                                                 
Query: 2    ccttcttaat-aataatttacatacatatgcacgctggattaaatggcgtgcg 53
            |||||||||| |||||||||||||||||||||||||   |||||| |||||||
Sbjct: 1229 ccttcttaattaataatttacatacatatgcacgctccgttaaatcgcgtgcg 1177
to top
>gb|AC155942.6| Mus musculus 10 BAC RP24-492L7 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 174309

 Score = 44.1 bits (22), Expect = 0.040
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 8     taataataatttacatacatat 29
             ||||||||||||||||||||||
Sbjct: 29491 taataataatttacatacatat 29512
to top
>gb|AC153156.1| Ornithorhynchus anatinus chromosome UNK clone OABb-289A1, complete
             sequence
          Length = 109794

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 13    ataatttacatacatatgcac 33
             |||||||||||||||||||||
Sbjct: 95031 ataatttacatacatatgcac 95011
to top
>gb|AC104706.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1116_F05,
             complete sequence
          Length = 119573

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 8     taataataatttacatacatatgca 32
             ||||||||| |||||||||||||||
Sbjct: 27479 taataataacttacatacatatgca 27503
to top
>emb|BX537273.16| Zebrafish DNA sequence from clone CH211-151F2 in linkage group 10,
             complete sequence
          Length = 167226

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     taataataatttacatacata 28
             |||||||||||||||||||||
Sbjct: 60087 taataataatttacatacata 60107
to top
>gb|AC116631.6| Homo sapiens BAC clone RP11-429B11 from 4, complete sequence
          Length = 125133

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 13    ataatttacatacatatgcac 33
             |||||||||||||||||||||
Sbjct: 18615 ataatttacatacatatgcac 18635
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 8        taataataatttacatacatatgca 32
                ||||||||| |||||||||||||||
Sbjct: 15861488 taataataacttacatacatatgca 15861464
to top
>emb|CR361565.8| Zebrafish DNA sequence from clone CH211-242L1 in linkage group 22,
             complete sequence
          Length = 164475

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 9     aataataatttacatacatat 29
             |||||||||||||||||||||
Sbjct: 30255 aataataatttacatacatat 30275
to top
>emb|BX005014.5| Zebrafish DNA sequence from clone CH211-103E2 in linkage group 10,
             complete sequence
          Length = 160621

 Score = 42.1 bits (21), Expect = 0.16
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 8     taataataatttacatacata 28
             |||||||||||||||||||||
Sbjct: 47614 taataataatttacatacata 47634
to top
>gb|AC117081.2| Dictyostelium discoideum chromosome 2 map 5862124-6045772 strain AX4,
            complete sequence
          Length = 183648

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 8    taataataatttacatacat 27
            ||||||||||||||||||||
Sbjct: 3763 taataataatttacatacat 3744
to top
>gb|AC122907.4| Mus musculus BAC clone RP23-49I4 from chromosome 15, complete sequence
          Length = 233904

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 7      ttaataataatttacatacatatg 30
              ||||||||||| ||||||||||||
Sbjct: 205619 ttaataataatatacatacatatg 205596
to top
>emb|BX511098.5| Zebrafish DNA sequence from clone CH211-202L3 in linkage group 5,
             complete sequence
          Length = 72481

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 4     ttcttaataataatttacat 23
             ||||||||||||||||||||
Sbjct: 25089 ttcttaataataatttacat 25108
to top
>gb|AC104511.5| Drosophila melanogaster X BAC RP98-39D14 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 166000

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 8      taataataatttacatacat 27
              ||||||||||||||||||||
Sbjct: 100924 taataataatttacatacat 100943
to top
>emb|BX004760.10| Zebrafish DNA sequence from clone CH211-222O4 in linkage group 3,
             complete sequence
          Length = 190220

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 8     taataataatttacatacat 27
             ||||||||||||||||||||
Sbjct: 69241 taataataatttacatacat 69260
to top
>gb|AC011763.6|AC011763 Drosophila melanogaster, chromosome 3R, region 90A-90A, BAC clone
              BACR48C05, complete sequence
          Length = 164450

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     tacatacatatgcacgctgg 38
              ||||||||||||||||||||
Sbjct: 141958 tacatacatatgcacgctgg 141939
to top
>gb|AC155299.2| Mus musculus BAC clone RP24-229D17 from chromosome 15, complete
             sequence
          Length = 198559

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 7     ttaataataatttacatacatatg 30
             ||||||||||| ||||||||||||
Sbjct: 83579 ttaataataatatacatacatatg 83602
to top
>emb|AL929213.5| Zebrafish DNA sequence from clone CH211-144A19, complete sequence
          Length = 169897

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     ttcttaataataatttacat 23
             ||||||||||||||||||||
Sbjct: 69809 ttcttaataataatttacat 69790
to top
>emb|BX255893.5| Zebrafish DNA sequence from clone CH211-272H10 in linkage group 4,
             complete sequence
          Length = 99176

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 8     taataataatttacatacat 27
             ||||||||||||||||||||
Sbjct: 76094 taataataatttacatacat 76075
to top
>gb|AE003717.2| Drosophila melanogaster chromosome 3R, section 55 of 118 of the complete
              sequence
          Length = 217725

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     tacatacatatgcacgctgg 38
              ||||||||||||||||||||
Sbjct: 123669 tacatacatatgcacgctgg 123650
to top
>gb|AE003491.4| Drosophila melanogaster chromosome X, section 43 of 74 of the complete
             sequence
          Length = 332030

 Score = 40.1 bits (20), Expect = 0.62
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 8     taataataatttacatacat 27
             ||||||||||||||||||||
Sbjct: 23638 taataataatttacatacat 23619
to top
>gb|AC093196.2| Drosophila melanogaster clone BACR22H06, complete sequence
          Length = 173008

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 7      ttaataataatttacatacatat 29
              ||||||| |||||||||||||||
Sbjct: 138839 ttaataaaaatttacatacatat 138817
to top
>gb|AC009744.8| Drosophila melanogaster clone BACR06G16, complete sequence
          Length = 179038

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 7     ttaataataatttacatacatat 29
             ||||||| |||||||||||||||
Sbjct: 31698 ttaataaaaatttacatacatat 31676
to top
>gb|AY180151.1| Herpetomonas muscarum small subunit ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and large subunit ribosomal RNA gene, partial
           sequence
          Length = 773

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 19  tacatacatatgcacgctg 37
           |||||||||||||||||||
Sbjct: 430 tacatacatatgcacgctg 412
to top
>gb|AC185533.1| Drosophila melanogaster clone BACR48D21, complete sequence
          Length = 95808

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 10    ataataatttacatacatatgca 32
             |||||||| ||||||||||||||
Sbjct: 56117 ataataatatacatacatatgca 56095
to top
>emb|AL390785.15| Human DNA sequence from clone RP11-325N9 on chromosome 10, complete
             sequence
          Length = 203169

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 9     aataataatttacatacat 27
             |||||||||||||||||||
Sbjct: 49489 aataataatttacatacat 49507
to top
>gb|AC160115.2| Mus musculus BAC clone RP23-473K23 from chromosome 13, complete
             sequence
          Length = 182345

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 7     ttaataataatttacatac 25
             |||||||||||||||||||
Sbjct: 35132 ttaataataatttacatac 35114
to top
>emb|CR846090.6| Zebrafish DNA sequence from clone DKEYP-78E10 in linkage group 14,
             complete sequence
          Length = 78515

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 8     taataataatttacataca 26
             |||||||||||||||||||
Sbjct: 75886 taataataatttacataca 75868
to top
>gb|AC089987.26| Homo sapiens 12q BAC RP11-722P11 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 164945

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    ataataatttacatacata 28
             |||||||||||||||||||
Sbjct: 95473 ataataatttacatacata 95491
to top
>ref|NM_176004.1| Drosophila melanogaster CG13125-RB, transcript variant B (CG13125),
            mRNA
          Length = 1335

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 7    ttaataataatttacatacatat 29
            ||||||| |||||||||||||||
Sbjct: 1283 ttaataaaaatttacatacatat 1305
to top
>ref|NM_135481.2| Drosophila melanogaster CG13125-RA, transcript variant A (CG13125),
            mRNA
          Length = 1758

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 7    ttaataataatttacatacatat 29
            ||||||| |||||||||||||||
Sbjct: 1706 ttaataaaaatttacatacatat 1728
to top
>gb|AE009926.1|AE009926 Pyrobaculum aerophilum strain IM2 section 181 of 201 of the complete
            genome
          Length = 10255

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 2    ccttcttaataataatttacata 24
            ||||||||||||| |||||||||
Sbjct: 5538 ccttcttaataatgatttacata 5560
to top
>dbj|AK038482.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length
           enriched library, clone:A230019I21
           product:unclassifiable, full insert sequence
          Length = 2378

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 15  aatttacatacatatgcac 33
           |||||||||||||||||||
Sbjct: 793 aatttacatacatatgcac 775
to top
>gb|AE003626.4| Drosophila melanogaster chromosome 2L, section 35 of 83 of the complete
              sequence
          Length = 264919

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 7      ttaataataatttacatacatat 29
              ||||||| |||||||||||||||
Sbjct: 213928 ttaataaaaatttacatacatat 213906
to top
>gb|AE003573.4| Drosophila melanogaster chromosome X, section 74 of 74 of the complete
              sequence
          Length = 313035

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 10     ataataatttacatacatatgca 32
              |||||||| ||||||||||||||
Sbjct: 193281 ataataatatacatacatatgca 193259
to top
>gb|AC125020.7| Mus musculus chromosome 12, clone RP24-181E5, complete sequence
          Length = 200586

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 15    aatttacatacatatgcac 33
             |||||||||||||||||||
Sbjct: 80606 aatttacatacatatgcac 80588
to top
>gb|AC005135.1|AC005135 Drosophila melanogaster DNA sequence (P1 DS07070 (D331)), complete
             sequence
          Length = 67297

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 7     ttaataataatttacatacatat 29
             ||||||| |||||||||||||||
Sbjct: 64484 ttaataaaaatttacatacatat 64462
to top
>gb|AC119202.6| Mus musculus chromosome 8, clone RP24-185N3, complete sequence
          Length = 159765

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 7     ttaataataatttacatac 25
             |||||||||||||||||||
Sbjct: 74759 ttaataataatttacatac 74741
to top
>emb|AL845332.11| Mouse DNA sequence from clone RP23-326D18 on chromosome 2, complete
              sequence
          Length = 200453

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 8      taataataatttacataca 26
              |||||||||||||||||||
Sbjct: 136421 taataataatttacataca 136403
to top
>emb|AL845170.5| Mouse DNA sequence from clone RP23-282A22 on chromosome 2, complete
              sequence
          Length = 183985

 Score = 38.2 bits (19), Expect = 2.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 12     aataatttacatacatatg 30
              |||||||||||||||||||
Sbjct: 150354 aataatttacatacatatg 150336
to top
>gb|AY689436.1| Deerpox virus W-848-83, complete genome
          Length = 166259

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 9     aataataatttacatacatatg 30
             ||||||||| ||||||||||||
Sbjct: 12121 aataataatgtacatacatatg 12142
to top
>gb|AC124810.14| Mus musculus chromosome 15, clone RP23-163N4, complete sequence
          Length = 212156

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 11    taataatttacatacatatgca 32
             |||||||||| |||||||||||
Sbjct: 25952 taataatttatatacatatgca 25973
to top
>gb|AC164644.5| Mus musculus BAC clone RP23-276J7 from chromosome 5, complete sequence
          Length = 171252

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 19    tacatacatatgcacgct 36
             ||||||||||||||||||
Sbjct: 95658 tacatacatatgcacgct 95641
to top
>gb|AE014832.1| Plasmodium falciparum 3D7 chromosome 10 section 4 of 7 of the complete
             sequence
          Length = 258658

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    aataatttacatacatat 29
             ||||||||||||||||||
Sbjct: 97271 aataatttacatacatat 97254
to top
>gb|AE014850.1| Plasmodium falciparum 3D7 chromosome 12, section 7 of 9 of the complete
              sequence
          Length = 250713

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 7      ttaataataatttacata 24
              ||||||||||||||||||
Sbjct: 171328 ttaataataatttacata 171311
to top
>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence
          Length = 1618915

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 6      cttaataataatttacat 23
              ||||||||||||||||||
Sbjct: 906584 cttaataataatttacat 906601
to top
>gb|AC084047.3| Trypanosoma brucei chromosome 6 clone RPCI93-5F5, complete sequence
          Length = 152595

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 6      cttaataataatttacat 23
              ||||||||||||||||||
Sbjct: 116309 cttaataataatttacat 116326
to top
>gb|AC008341.3| Drosophila melanogaster clone BACR15P11, complete sequence
          Length = 171235

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 12     aataatttacatacatat 29
              ||||||||||||||||||
Sbjct: 160226 aataatttacatacatat 160209
to top
>gb|AC010848.14| Drosophila melanogaster clone BACR20N11, complete sequence
          Length = 175978

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 15     aatttacatacatatgca 32
              ||||||||||||||||||
Sbjct: 172606 aatttacatacatatgca 172623
to top
>gb|AC146506.1| Solanum demissum chromosome 5 BAC PGEC989P08 genomic sequence, complete
             sequence
          Length = 121915

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 14    taatttacatacatatgc 31
             ||||||||||||||||||
Sbjct: 63571 taatttacatacatatgc 63588
to top
>gb|AC011251.6| Drosophila melanogaster clone BACR09F10, complete sequence
          Length = 173988

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 15  aatttacatacatatgca 32
           ||||||||||||||||||
Sbjct: 730 aatttacatacatatgca 747
to top
>ref|XM_457863.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0C04708g)
           partial mRNA
          Length = 429

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 9   aataataatttacataca 26
           ||||||||||||||||||
Sbjct: 377 aataataatttacataca 360
to top
>gb|AC133464.11| Mus musculus chromosome 16, clone RP24-459O21, complete sequence
          Length = 142742

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 12   aataatttacatacatat 29
            ||||||||||||||||||
Sbjct: 8705 aataatttacatacatat 8722
to top
>gb|AC157930.7| Mus musculus chromosome 5, clone RP24-151E22, complete sequence
          Length = 146346

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    ataataatttacatacat 27
             ||||||||||||||||||
Sbjct: 32492 ataataatttacatacat 32475
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                  
Query: 26       atatgcacgctggattaa 43
                ||||||||||||||||||
Sbjct: 32277067 atatgcacgctggattaa 32277050
to top
>gb|AC116421.8| Mus musculus chromosome 9, clone RP24-142L1, complete sequence
          Length = 175142

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 8      taataataatttacatacatat 29
              |||||||||| |||||||||||
Sbjct: 158065 taataataatatacatacatat 158086
to top
>gb|AC134790.6| Mus musculus chromosome 15, clone RP24-541O5, complete sequence
          Length = 185593

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 11   taataatttacatacatatgca 32
            |||||||||| |||||||||||
Sbjct: 8101 taataatttatatacatatgca 8080
to top
>gb|AC005158.3| Homo sapiens BAC clone GS1-250N6 from 7, complete sequence
          Length = 266344

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 6     cttaataataatttacat 23
             ||||||||||||||||||
Sbjct: 94401 cttaataataatttacat 94418
to top
>emb|CR382386.8| Zebrafish DNA sequence from clone DKEY-111O10 in linkage group 14,
             complete sequence
          Length = 162528

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 7     ttaataataatttacata 24
             ||||||||||||||||||
Sbjct: 38562 ttaataataatttacata 38579
to top
>gb|AC122848.3| Mus musculus BAC clone RP23-166K13 from chromosome 18, complete sequence
          Length = 204254

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 7      ttaataataatttacata 24
              ||||||||||||||||||
Sbjct: 159598 ttaataataatttacata 159615
to top
>emb|AL954219.1| Pan troglodytes chromosome 22 clone PTB-302M06 map q21.2, complete
             sequence
          Length = 128963

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 1     cccttcttaataataatt 18
             ||||||||||||||||||
Sbjct: 47265 cccttcttaataataatt 47282
to top
>emb|BX927362.10| Zebrafish DNA sequence from clone CH211-170N20 in linkage group 6,
             complete sequence
          Length = 131893

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 7     ttaataataatttacata 24
             ||||||||||||||||||
Sbjct: 79214 ttaataataatttacata 79197
to top
>gb|AC127259.3| Mus musculus BAC clone RP24-304A20 from chromosome 9, complete sequence
          Length = 162717

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 12     aataatttacatacatat 29
              ||||||||||||||||||
Sbjct: 137503 aataatttacatacatat 137520
to top
>gb|AC126278.4| Mus musculus BAC clone RP23-161M1 from 7, complete sequence
          Length = 201387

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 7      ttaataataatttacata 24
              ||||||||||||||||||
Sbjct: 163587 ttaataataatttacata 163570
to top
>emb|AL713986.10| Mouse DNA sequence from clone RP23-142G13 on chromosome X, complete
              sequence
          Length = 204903

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 2      ccttcttaataataattt 19
              ||||||||||||||||||
Sbjct: 131596 ccttcttaataataattt 131613
to top
>gb|AC121599.3| Mus musculus BAC clone RP23-300H21 from 14, complete sequence
          Length = 218747

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 16     atttacatacatatgcac 33
              ||||||||||||||||||
Sbjct: 168098 atttacatacatatgcac 168081
to top
>ref|XM_726111.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY03215)
            partial mRNA
          Length = 2199

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 7    ttaataataatttacata 24
            ||||||||||||||||||
Sbjct: 1783 ttaataataatttacata 1766
to top
>ref|XM_949722.1| Theileria annulata strain Ankara hypothetical protein (TA04700)
            partial mRNA
          Length = 2202

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 7    ttaataataatttacata 24
            ||||||||||||||||||
Sbjct: 1703 ttaataataatttacata 1720
to top
>gb|AC073884.4| Homo sapiens BAC clone CTD-2006F7 from 7, complete sequence
          Length = 66224

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 7     ttaataataatttacata 24
             ||||||||||||||||||
Sbjct: 10824 ttaataataatttacata 10841
to top
>ref|XM_738210.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000843.03.0)
            partial mRNA
          Length = 2127

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 7    ttaataataatttacata 24
            ||||||||||||||||||
Sbjct: 1753 ttaataataatttacata 1736
to top
>gb|AC074085.7| Homo sapiens BAC clone RP11-3L10 from 7, complete sequence
          Length = 155260

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 7     ttaataataatttacata 24
             ||||||||||||||||||
Sbjct: 68902 ttaataataatttacata 68885
to top
>ref|XM_672224.1| Plasmodium berghei strain ANKA hypothetical protein (PB000207.01.0)
            partial mRNA
          Length = 2193

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 7    ttaataataatttacata 24
            ||||||||||||||||||
Sbjct: 1777 ttaataataatttacata 1760
to top
>gb|AC113204.7| Mus musculus chromosome 12, clone RP23-312J1, complete sequence
          Length = 207293

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 9     aataataatttacataca 26
             ||||||||||||||||||
Sbjct: 88310 aataataatttacataca 88293
to top
>gb|AC146185.2| Pan troglodytes BAC clone RP43-35O6 from 7, complete sequence
          Length = 156598

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 7   ttaataataatttacata 24
           ||||||||||||||||||
Sbjct: 956 ttaataataatttacata 939
to top
>gb|AC144823.2| Danio rerio clone CH211-150P19, complete sequence
          Length = 159419

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 8      taataataatttacatacatat 29
              ||||||||||||||| ||||||
Sbjct: 124510 taataataatttacaaacatat 124489
to top
>gb|AC102934.11| Mus musculus chromosome 3, clone RP24-209C11, complete sequence
          Length = 172970

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 8      taataataatttacatacatat 29
              ||||||||||||| ||||||||
Sbjct: 114255 taataataatttatatacatat 114276
to top
>emb|AL590239.7| Human DNA sequence from clone RP11-466D24 on chromosome 6, complete
            sequence
          Length = 127316

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 7    ttaataataatttacata 24
            ||||||||||||||||||
Sbjct: 9372 ttaataataatttacata 9355
to top
>emb|AL590386.5| Human DNA sequence from clone RP11-721G21 on chromosome 9, complete
             sequence
          Length = 90510

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    aataatttacatacatat 29
             ||||||||||||||||||
Sbjct: 45490 aataatttacatacatat 45473
to top
>gb|AC133340.4| Oryza sativa chromosome 3 BAC clone OSJNBb0024J17, complete sequence
          Length = 102751

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 26    atatgcacgctggattaa 43
             ||||||||||||||||||
Sbjct: 10834 atatgcacgctggattaa 10817
to top
>emb|AL356100.8| Human DNA sequence from clone RP11-359H22 on chromosome 10 Contains part
              of a novel gene (KIAA0534), complete sequence
          Length = 190361

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 12     aataatttacatacatat 29
              ||||||||||||||||||
Sbjct: 161068 aataatttacatacatat 161051
to top
>emb|AL135785.10| Human DNA sequence from clone RP11-113O24 on chromosome 9p11-13.3
              Contains a novel gene, possible ortholog of mouse
              insulin-like growth factor binding protein 7 (IGFBP7), a
              novel gene similar to aldehyde dehydrogenase 1 family,
              member B1 (ALDH5, ALDHX, MGC2230) (ALDH1B1), a novel gene
              and four CpG islands, complete sequence
          Length = 166207

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 9      aataataatttacataca 26
              ||||||||||||||||||
Sbjct: 136411 aataataatttacataca 136428
to top
>emb|AL121922.16|HSJ647O12 Human DNA sequence from clone RP4-647O12 on chromosome 20q13.13-13.32
            Contains ESTs, STSs and GSSs, complete sequence
          Length = 37474

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 10   ataataatttacatacat 27
            ||||||||||||||||||
Sbjct: 8308 ataataatttacatacat 8291
to top
>gb|AC124157.4| Equus caballus clone CH241-37P10, complete sequence
          Length = 193986

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    ataatttacatacatatg 30
             ||||||||||||||||||
Sbjct: 37412 ataatttacatacatatg 37429
to top
>emb|AL022323.7|HS243E7 Human DNA sequence from clone CTA-243E7 on chromosome 22q12.1, complete
             sequence
          Length = 183113

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    ataatttacatacatatg 30
             ||||||||||||||||||
Sbjct: 51965 ataatttacatacatatg 51982
to top
>ref|XM_965112.1| PREDICTED: Tribolium castaneum similar to CG31136-PA (LOC658750),
            mRNA
          Length = 1445

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 7    ttaataataatttacata 24
            ||||||||||||||||||
Sbjct: 1431 ttaataataatttacata 1414
to top
>emb|CR382135.1| Debaryomyces hansenii chromosome C of strain CBS767 of Debaryomyces
              hansenii
          Length = 1592360

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 9      aataataatttacataca 26
              ||||||||||||||||||
Sbjct: 387548 aataataatttacataca 387531
to top
>emb|AJ508355.1|BMA508355 Brugia malayi ORF1, ORF2, ORF3 and ORF4 DNA and alt-1 gene
          Length = 32442

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 7     ttaataataatttacata 24
             ||||||||||||||||||
Sbjct: 31333 ttaataataatttacata 31350
to top
>emb|BX530030.12| Zebrafish DNA sequence from clone DKEY-38K9 in linkage group 21, complete
              sequence
          Length = 180154

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 4      ttcttaataataatttac 21
              ||||||||||||||||||
Sbjct: 168300 ttcttaataataatttac 168317
to top
>emb|BX005005.19| Zebrafish DNA sequence from clone DKEY-70O15 in linkage group 13,
             complete sequence
          Length = 153184

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 10    ataataatttacatacat 27
             ||||||||||||||||||
Sbjct: 88508 ataataatttacatacat 88525
to top
>emb|AL662802.14| Mouse DNA sequence from clone RP23-34N10 on chromosome 11, complete
              sequence
          Length = 224024

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 11     taataatttacatacatatgca 32
              ||||||||| ||||||||||||
Sbjct: 214013 taataatttccatacatatgca 213992
to top
>gb|AC005185.1| Homo sapiens Xp22 BAC GSHB-383H3 (Genome Systems Human BAC Library)
             complete sequence
          Length = 124351

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    ataatttacatacatatg 30
             ||||||||||||||||||
Sbjct: 42357 ataatttacatacatatg 42374
to top
>gb|AC055788.7| Homo sapiens chromosome 8, clone RP11-252H14, complete sequence
          Length = 145570

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 15    aatttacatacatatgca 32
             ||||||||||||||||||
Sbjct: 88651 aatttacatacatatgca 88668
to top
>gb|AC159903.3| Pan troglodytes BAC clone CH251-459A3 from chromosome unknown, complete
              sequence
          Length = 216963

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 10     ataataatttacatacat 27
              ||||||||||||||||||
Sbjct: 180625 ataataatttacatacat 180608
to top
>emb|BX323012.5| Zebrafish DNA sequence from clone DKEYP-46F3, complete sequence
          Length = 175238

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 7      ttaataataatttacata 24
              ||||||||||||||||||
Sbjct: 119288 ttaataataatttacata 119271
to top
>gb|AC112247.5| Homo sapiens BAC clone RP11-606P2 from 4, complete sequence
          Length = 86576

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 15   aatttacatacatatgca 32
            ||||||||||||||||||
Sbjct: 2881 aatttacatacatatgca 2898
to top
>emb|BX649556.9| Zebrafish DNA sequence from clone DKEY-29M1 in linkage group 11, complete
              sequence
          Length = 197002

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 12     aataatttacatacatat 29
              ||||||||||||||||||
Sbjct: 170859 aataatttacatacatat 170876
to top
>gb|AC012417.13| Homo sapiens chromosome 18, clone RP11-408H20, complete sequence
          Length = 181552

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 9      aataataatttacatacatatg 30
              ||||||||||||||| ||||||
Sbjct: 175452 aataataatttacattcatatg 175431
to top
>gb|AC096763.2| Homo sapiens BAC clone RP11-625A6 from 4, complete sequence
          Length = 168710

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 7     ttaataataatttacata 24
             ||||||||||||||||||
Sbjct: 74739 ttaataataatttacata 74722
to top
>gb|AC093768.3| Homo sapiens BAC clone RP11-113G13 from 4, complete sequence
          Length = 187624

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 8    taataataatttacatac 25
            ||||||||||||||||||
Sbjct: 7819 taataataatttacatac 7802
to top
>gb|AC009520.16| Homo sapiens 3 BAC RP11-392H18 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 161517

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 13   ataatttacatacatatg 30
            ||||||||||||||||||
Sbjct: 2415 ataatttacatacatatg 2432
to top
>gb|AY061050.1| Drosophila melanogaster LD02060 full length cDNA
          Length = 1556

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 12  aataatttacatacatat 29
           ||||||||||||||||||
Sbjct: 794 aataatttacatacatat 777
to top
>gb|AC114412.9| Mus musculus chromosome 12, clone RP23-56P12, complete sequence
          Length = 115890

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 10    ataataatttacatacatatgc 31
             ||||||| ||||||||||||||
Sbjct: 83580 ataataaattacatacatatgc 83559
to top
>gb|AF165613.1|AF165613 Pecari tajacu protein kinase C iota gene, partial sequence
          Length = 499

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 9   aataataatttacataca 26
           ||||||||||||||||||
Sbjct: 360 aataataatttacataca 343
to top
>gb|AC102477.18| Mus musculus chromosome 5, clone RP24-405C17, complete sequence
          Length = 179495

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 10    ataataatttacatacat 27
             ||||||||||||||||||
Sbjct: 87533 ataataatttacatacat 87550
to top
>gb|AC160246.2| Mus musculus BAC clone RP24-465F1 from chromosome 9, complete sequence
          Length = 157105

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 8     taataataatttacatacatat 29
             |||||||||| |||||||||||
Sbjct: 14456 taataataatatacatacatat 14477
to top
>gb|AC091123.4| Oryza sativa chromosome 3 BAC OSJNBb0093E13 genomic sequence, complete
              sequence
          Length = 129778

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 26     atatgcacgctggattaa 43
              ||||||||||||||||||
Sbjct: 128739 atatgcacgctggattaa 128722
to top
>gb|AC155231.2| Mus musculus BAC clone RP24-336I23 from chromosome 12, complete sequence
          Length = 175296

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 31     cacgctggattaaatggc 48
              ||||||||||||||||||
Sbjct: 169953 cacgctggattaaatggc 169970
to top
>gb|AF210192.1|AF210192 Neotragus moschatus protein kinase C iota (PRKCI) gene, partial cds
          Length = 512

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 9   aataataatttacataca 26
           ||||||||||||||||||
Sbjct: 359 aataataatttacataca 342
to top
>gb|AC025212.5|AC025212 Homo sapiens chromosome 18, clone RP11-289A1, complete sequence
          Length = 182258

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 9      aataataatttacatacatatg 30
              ||||||||||||||| ||||||
Sbjct: 151915 aataataatttacattcatatg 151936
to top
>gb|AC153992.7| Mus musculus 6 BAC RP24-116E17 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 195972

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 10    ataataatttacatacat 27
             ||||||||||||||||||
Sbjct: 65596 ataataatttacatacat 65613
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                  
Query: 8        taataataatttacatac 25
                ||||||||||||||||||
Sbjct: 22605411 taataataatttacatac 22605428
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                  
Query: 26       atatgcacgctggattaa 43
                ||||||||||||||||||
Sbjct: 32367577 atatgcacgctggattaa 32367560
to top
>gb|AC007086.10|AC007086 Drosophila melanogaster, chromosome 2R, region 45A-46A, BAC clone
              BACR14J24, complete sequence
          Length = 186241

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 12     aataatttacatacatat 29
              ||||||||||||||||||
Sbjct: 155256 aataatttacatacatat 155273
to top
>emb|BX323804.9| Zebrafish DNA sequence from clone DKEY-270K22 in linkage group 2,
             complete sequence
          Length = 121116

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 7     ttaataataatttacata 24
             ||||||||||||||||||
Sbjct: 21967 ttaataataatttacata 21984
to top
>emb|BX537121.4| Zebrafish DNA sequence from clone CH211-196P24 in linkage group 3,
              complete sequence
          Length = 184845

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 27     tatgcacgctggattaaa 44
              ||||||||||||||||||
Sbjct: 178262 tatgcacgctggattaaa 178245
to top
>gb|BT006008.1| Drosophila melanogaster LD18978 full insert cDNA
          Length = 2966

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 12   aataatttacatacatat 29
            ||||||||||||||||||
Sbjct: 1556 aataatttacatacatat 1539
to top
>gb|AC008314.7|AC008314 Drosophila melanogaster, chromosome 3R, region 85B-85B, BAC clone
              BACR02B21, complete sequence
          Length = 186322

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 12     aataatttacatacatat 29
              ||||||||||||||||||
Sbjct: 114416 aataatttacatacatat 114433
to top
>gb|AC007402.3| Homo sapiens BAC clone RP11-545K2 from 2, complete sequence
          Length = 191104

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     ataataatttacatacat 27
              ||||||||||||||||||
Sbjct: 184092 ataataatttacatacat 184109
to top
>gb|AC156946.1| Pan troglodytes BAC clone CH251-342L21 from chromosome unknown, complete
              sequence
          Length = 170162

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     ataataatttacatacat 27
              ||||||||||||||||||
Sbjct: 163141 ataataatttacatacat 163158
to top
>gb|AC154840.2| Mus musculus BAC clone RP23-61I7 from chromosome 14, complete sequence
          Length = 195596

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 16     atttacatacatatgcac 33
              ||||||||||||||||||
Sbjct: 144494 atttacatacatatgcac 144511
to top
>gb|AC146165.2| Pan troglodytes BAC clone RP43-36N14 from chromosome 7, complete
             sequence
          Length = 159324

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 6     cttaataataatttacat 23
             ||||||||||||||||||
Sbjct: 37758 cttaataataatttacat 37775
to top
>gb|AC154656.2| Mus musculus BAC clone RP24-268M5 from chromosome 16, complete sequence
          Length = 166376

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 15    aatttacatacatatgcacgct 36
             |||||| |||||||||||||||
Sbjct: 11990 aatttaaatacatatgcacgct 11969
to top
>gb|AC017071.9| Homo sapiens BAC clone RP11-410E4 from 2, complete sequence
          Length = 163456

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 7     ttaataataatttacata 24
             ||||||||||||||||||
Sbjct: 93347 ttaataataatttacata 93364
to top
>gb|AF293359.1|AF293359 Homo sapiens desmocollin 3 (DSC3) gene, complete cds, alternatively
             spliced
          Length = 49087

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 9     aataataatttacatacatatg 30
             ||||||||||||||| ||||||
Sbjct: 28670 aataataatttacattcatatg 28649
to top
>gb|AC008169.2| Homo sapiens BAC clone RP11-252D22 from 2, complete sequence
          Length = 173201

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 12   aataatttacatacatat 29
            ||||||||||||||||||
Sbjct: 7565 aataatttacatacatat 7582
to top
>gb|AC068764.18| Homo sapiens 3 BAC RP11-138E24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 183965

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 11    taataatttacatacatatgca 32
             |||||||||| |||||||||||
Sbjct: 72325 taataatttaaatacatatgca 72346
to top
>emb|BX119910.7| Zebrafish DNA sequence from clone DKEY-17C10 in linkage group 10,
              complete sequence
          Length = 199662

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 8      taataataatttacatacatat 29
              ||||||||||||||| ||||||
Sbjct: 171673 taataataatttacaaacatat 171694
to top
>gb|AC127287.4| Mus musculus BAC clone RP23-345G7 from chromosome 7, complete sequence
          Length = 209901

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 14     taatttacatacatatgc 31
              ||||||||||||||||||
Sbjct: 164005 taatttacatacatatgc 163988
to top
>emb|BX004868.9| Zebrafish DNA sequence from clone DKEY-209F8, complete sequence
          Length = 153986

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 19    tacatacatatgcacgct 36
             ||||||||||||||||||
Sbjct: 20668 tacatacatatgcacgct 20685
to top
>emb|AL928668.7| Zebrafish DNA sequence from clone CH211-208M1, complete sequence
          Length = 241975

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 4     ttcttaataataatttac 21
             ||||||||||||||||||
Sbjct: 39053 ttcttaataataatttac 39036
to top
>dbj|AB016882.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MZA15
          Length = 79995

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 8     taataataatttacatacatat 29
             ||||||||||||||| ||||||
Sbjct: 32431 taataataatttacacacatat 32410
to top
>emb|BX537337.9| Zebrafish DNA sequence from clone CH211-222E23 in linkage group 19,
             complete sequence
          Length = 217375

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 7     ttaataataatttacata 24
             ||||||||||||||||||
Sbjct: 90157 ttaataataatttacata 90140
to top
>emb|BX321888.21| Zebrafish DNA sequence from clone DKEYP-47D4 in linkage group 20,
              complete sequence
          Length = 176463

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                        
Query: 4      ttcttaataataatttacatacatat 29
              |||||||||||||| || ||||||||
Sbjct: 126393 ttcttaataataatatatatacatat 126368
to top
>emb|BX530065.7| Zebrafish DNA sequence from clone CH211-73J11 in linkage group 20,
             complete sequence
          Length = 39806

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                       
Query: 4     ttcttaataataatttacatacatat 29
             |||||||||||||| || ||||||||
Sbjct: 18201 ttcttaataataatatatatacatat 18226
to top
>gb|AC154869.3| Monodelphis domestica, clone XX-216E9, complete sequence
          Length = 159803

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 31    cacgctggattaaatggc 48
             ||||||||||||||||||
Sbjct: 74004 cacgctggattaaatggc 74021
to top
>emb|CT025695.6| Zebrafish DNA sequence from clone CH211-246B8 in linkage group 4,
             complete sequence
          Length = 90788

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    aataatttacatacatat 29
             ||||||||||||||||||
Sbjct: 56890 aataatttacatacatat 56873
to top
>emb|CT009613.14| Mouse DNA sequence from clone RP23-55L9 on chromosome 12, complete
              sequence
          Length = 214861

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 31     cacgctggattaaatggc 48
              ||||||||||||||||||
Sbjct: 171582 cacgctggattaaatggc 171565
to top
>gb|AE003680.4| Drosophila melanogaster chromosome 3R, section 18 of 118 of the complete
              sequence
          Length = 270517

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 12     aataatttacatacatat 29
              ||||||||||||||||||
Sbjct: 155278 aataatttacatacatat 155295
to top
>gb|AE003833.4| Drosophila melanogaster chromosome 2R, section 17 of 73 of the complete
              sequence
          Length = 297107

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 12     aataatttacatacatat 29
              ||||||||||||||||||
Sbjct: 103895 aataatttacatacatat 103878
to top
>gb|AE003568.4| Drosophila melanogaster chromosome X, section 71 of 74 of the complete
              sequence
          Length = 315815

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 15     aatttacatacatatgca 32
              ||||||||||||||||||
Sbjct: 100710 aatttacatacatatgca 100727
to top
>gb|AC138245.11| Mus musculus chromosome 17, clone RP23-75D10, complete sequence
          Length = 216692

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 10     ataataatttacatacat 27
              ||||||||||||||||||
Sbjct: 194816 ataataatttacatacat 194833
to top
>gb|AC131325.8| Mus musculus chromosome 17, clone RP23-431O10, complete sequence
          Length = 191331

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 10     ataataatttacatacat 27
              ||||||||||||||||||
Sbjct: 160579 ataataatttacatacat 160562
to top
>emb|CT573089.2| RP43-058A24, complete sequence
          Length = 216040

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 13    ataatttacatacatatg 30
             ||||||||||||||||||
Sbjct: 13713 ataatttacatacatatg 13696
to top
>emb|CT573031.6| Mouse DNA sequence from clone RP24-244H14 on chromosome 16, complete
             sequence
          Length = 170444

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 12    aataatttacatacatat 29
             ||||||||||||||||||
Sbjct: 10737 aataatttacatacatat 10720
to top
>emb|BX088545.7| Zebrafish DNA sequence from clone DKEY-60G19 in linkage group 17,
             complete sequence
          Length = 156881

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 5     tcttaataataatttaca 22
             ||||||||||||||||||
Sbjct: 23758 tcttaataataatttaca 23775
to top
>emb|AL831731.6| Mouse DNA sequence from clone RP23-442K11 on chromosome 2, complete
              sequence
          Length = 165232

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 9      aataataatttacataca 26
              ||||||||||||||||||
Sbjct: 139067 aataataatttacataca 139050
to top
>gb|AC119921.12| Mus musculus chromosome 12, clone RP24-252B23, complete sequence
          Length = 162290

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 18    ttacatacatatgcacgc 35
             ||||||||||||||||||
Sbjct: 57969 ttacatacatatgcacgc 57986
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                  
Query: 8        taataataatttacatac 25
                ||||||||||||||||||
Sbjct: 22533603 taataataatttacatac 22533620
to top
>emb|BX005077.5| Zebrafish DNA sequence from clone CH211-113D11 in linkage group 1,
             complete sequence
          Length = 127560

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    ataataatttacatacat 27
             ||||||||||||||||||
Sbjct: 77331 ataataatttacatacat 77314
to top
>emb|AL954871.5|CNS08CDA Oryza sativa chromosome 12, . BAC OSJNBb0085B24 of library OSJNBb from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 131441

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 8      taataataatttacatac 25
              ||||||||||||||||||
Sbjct: 107990 taataataatttacatac 108007
to top
>emb|AL845342.2|CNS08CB4 Oryza sativa chromosome 12, . BAC OSJNBa0027H05 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 138368

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 8     taataataatttacatac 25
             ||||||||||||||||||
Sbjct: 50532 taataataatttacatac 50549
to top
>gb|U93163.1|HSU93163 Homo sapiens MAGE-B2 (MAGE-B2), MAGE-B3 (MAGE-B3), MAGE-B4 (MAGE-B4),
             and MAGE-B1 (MAGE-B1) genes, complete cds
          Length = 40351

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    ataatttacatacatatg 30
             ||||||||||||||||||
Sbjct: 11879 ataatttacatacatatg 11896
to top
>gb|AC002366.1|AC002366 Human Xp22 BAC CT-285I15 (from CalTech/Research Genetics) , PAC
            RPCI1-27C22 (from Roswell Park Cancer Center), and Cosmid
            U35B5 (from Lawrence Livermore), complete sequence
          Length = 259202

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 14   taatttacatacatatgc 31
            ||||||||||||||||||
Sbjct: 6260 taatttacatacatatgc 6277
to top
>emb|AL928876.12| Mouse DNA sequence from clone RP23-236O6 on chromosome 2, complete
             sequence
          Length = 201545

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 8     taataataatttacatacatat 29
             |||||||||||| |||||||||
Sbjct: 42568 taataataattttcatacatat 42589
to top
>emb|CR384057.25| Zebrafish DNA sequence from clone CH211-243K10 in linkage group 17,
             complete sequence
          Length = 154493

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 5     tcttaataataatttaca 22
             ||||||||||||||||||
Sbjct: 83814 tcttaataataatttaca 83797
to top
>emb|CR376825.16| Zebrafish DNA sequence from clone CH211-136O20 in linkage group 14,
             complete sequence
          Length = 176973

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 19    tacatacatatgcacgct 36
             ||||||||||||||||||
Sbjct: 62820 tacatacatatgcacgct 62803
to top
>emb|BX005452.7| Mouse DNA sequence from clone RP23-158K12 on chromosome X, complete
             sequence
          Length = 167118

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    ataataatttacatacat 27
             ||||||||||||||||||
Sbjct: 11196 ataataatttacatacat 11179
to top
>emb|CT010457.7| Mouse DNA sequence from clone RP23-96M8 on chromosome 9, complete
             sequence
          Length = 259964

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 12    aataatttacatacatat 29
             ||||||||||||||||||
Sbjct: 29871 aataatttacatacatat 29888
to top
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 35      ctggattaaatggcgtgc 52
               ||||||||||||||||||
Sbjct: 1413408 ctggattaaatggcgtgc 1413391
to top
>gb|DP000020.1| Equus caballus target 1 genomic scaffold
          Length = 1907055

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 13     ataatttacatacatatg 30
              ||||||||||||||||||
Sbjct: 870415 ataatttacatacatatg 870432
to top
>emb|AL935057.7| Mouse DNA sequence from clone RP23-90D6 on chromosome 2, complete
              sequence
          Length = 148247

 Score = 36.2 bits (18), Expect = 9.7
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 7      ttaataataatttacata 24
              ||||||||||||||||||
Sbjct: 143202 ttaataataatttacata 143219


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,037,864
Number of Sequences: 3902068
Number of extensions: 1037864
Number of successful extensions: 80407
Number of sequences better than 10.0: 161
Number of HSP's better than 10.0 without gapping: 161
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79890
Number of HSP's gapped (non-prelim): 517
length of query: 65
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 44
effective length of database: 17,151,101,840
effective search space: 754648480960
effective search space used: 754648480960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top