ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart58c06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrins... 543 e-151
2gb|BT016583.1| Zea mays clone Contig416 mRNA sequence 184 1e-43
3gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds 176 3e-41
4gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein... 168 8e-39
5gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein... 153 5e-34
6dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA ... 153 5e-34
7gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, comp... 153 5e-34
8gb|AY109332.1| Zea mays CL502_5 mRNA sequence 153 5e-34
9dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 149 8e-33
10dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 149 8e-33
11ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA 145 1e-31
12ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group... 145 1e-31
13ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group... 145 1e-31
14dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
15dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
16dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
17dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 1e-31
18dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clon... 137 3e-29
19ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA 117 3e-23
20dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
21gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein... 103 4e-19
22gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein... 103 4e-19
23gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrins... 100 7e-18
24gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence 96 1e-16
25ref|NM_187081.2| Oryza sativa (japonica cultivar-group), mRNA 82 2e-12
26dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 2e-12
27gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putat... 78 2e-11
28dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin,... 78 2e-11
29gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water chann... 78 2e-11
30gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1)... 78 2e-11
31dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd 78 2e-11
32ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channe... 76 9e-11
33gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds 76 9e-11
34gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 76 9e-11
35gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 76 9e-11
36gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, comp... 76 9e-11
37dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 76 9e-11
38gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protei... 76 9e-11
39emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Co... 76 9e-11
40emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Co... 76 9e-11
41dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic D... 76 9e-11
42dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin ... 74 4e-10
43gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds 72 1e-09
44gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasm... 72 1e-09
45ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predic... 70 6e-09
46gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (... 66 9e-08
47gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, comple... 66 9e-08
48gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence 64 4e-07
49gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-... 64 4e-07
50emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein 64 4e-07
51emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for p... 64 4e-07
52emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for p... 64 4e-07
53dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membran... 62 1e-06
54emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein 58 2e-05
55emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complet... 58 2e-05
56emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp... 58 2e-05
57dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds 58 2e-05
58dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
59dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
60dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
61gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, ... 58 2e-05
62dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membran... 58 2e-05
63dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for ... 58 2e-05
64ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channe... 56 9e-05
65ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predic... 56 9e-05
66gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker 56 9e-05
67gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker 56 9e-05
68gb|AY081593.1| Arabidopsis thaliana water channel-like protein (... 56 9e-05
69gb|AY059948.1| Arabidopsis thaliana water channel - like protein... 56 9e-05
70dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - li... 56 9e-05
71dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
72emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
73emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
74emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
75emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
76gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete se... 56 9e-05
77gb|AY170841.1| Axonopus compressus plasma membrane MIP protein m... 56 9e-05
78dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
79dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
80dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
81dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
82dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
83dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds 56 9e-05
84emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4,... 56 9e-05
85emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for p... 54 3e-04
86emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for p... 54 3e-04
87emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides m... 54 3e-04
88gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, ... 54 3e-04
89gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds 54 3e-04
90ref|NM_187084.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.001
91ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group... 52 0.001
92emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for p... 52 0.001
93gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putat... 52 0.001
94gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water ... 52 0.001
95dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
96gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, c... 52 0.001
97ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channe... 50 0.005
98ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predic... 50 0.005
99gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic pr... 50 0.005
100gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence 50 0.005
101gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758)... 50 0.005
102gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP prote... 50 0.005
103gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP prote... 50 0.005
104emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4,... 50 0.005
105gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putat... 50 0.005
106gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds 50 0.005
107gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, c... 50 0.005
108gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, ... 50 0.005
109gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein... 50 0.005
110gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein... 50 0.005
111emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Co... 50 0.005
112gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete s... 50 0.005
113emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene... 50 0.005
114dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.005
115dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.005
116dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.005
117gb|AY103580.1| Zea mays PCO072544 mRNA sequence 50 0.005
118dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds 50 0.005
119gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic pr... 50 0.005
120gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, com... 50 0.005
121gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel prot... 50 0.005
122dbj|AB002149.1| Nicotiana excelsior mRNA for water channel prote... 50 0.005
123ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G0... 48 0.021
124emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel... 48 0.021
125emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrins... 48 0.021
126emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B 48 0.021
127gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic pr... 48 0.021
128gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative pl... 48 0.021
129gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein... 48 0.021
130emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Co... 48 0.021
131dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane in... 48 0.021
132gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, comp... 48 0.021
133emb|AJ605565.1| Ricinus communis partial mRNA for putative aquap... 48 0.021
134gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic pr... 48 0.021
135gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel... 48 0.021
136gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRN... 48 0.021
137gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA 48 0.021
138ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTR... 46 0.085
139gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence 46 0.085
140gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, ... 46 0.085
141emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic... 46 0.085
142emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for p... 46 0.085
143emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for p... 46 0.085
144gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic prot... 46 0.085
145gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.085
146gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic pr... 46 0.085
147gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 ... 46 0.085
148gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intr... 46 0.085
149emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Co... 46 0.085
150emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Co... 46 0.085
151emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Co... 46 0.085
152emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Co... 46 0.085
153gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mR... 46 0.085
154dbj|AB206100.1| Mimosa pudica pip2;2 mRNA for plasma membrane in... 46 0.085
155dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane in... 46 0.085
156gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete se... 46 0.085
157dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds 46 0.085
158dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.085
159gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, c... 46 0.085
160gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrin... 46 0.085
161gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, com... 46 0.085
162gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic pr... 44 0.33
163gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (... 44 0.33
164gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, ... 44 0.33
165emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative trans... 44 0.33
166gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic prot... 44 0.33
167gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA... 44 0.33
168gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP... 44 0.33
169gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds 44 0.33
170emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene... 44 0.33
171emb|AJ605568.1| Ricinus communis partial mRNA for putative aquap... 44 0.33
172gb|AY107589.1| Zea mays PCO085320 mRNA sequence 44 0.33
173gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, com... 44 0.33
174ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G4... 42 1.3
175gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 1.3
176gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic prot... 42 1.3
177gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.3
178gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 42 1.3
179emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein 42 1.3
180emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel... 42 1.3
181gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (... 42 1.3
182emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A 42 1.3
183gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma m... 42 1.3
184ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-form... 42 1.3
185emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.3
186emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for p... 42 1.3
187gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map ... 42 1.3
188gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205),... 42 1.3
189gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, c... 42 1.3
190gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, ... 42 1.3
191emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Co... 42 1.3
192emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Co... 42 1.3
193emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Co... 42 1.3
194emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Co... 42 1.3
195dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.3
196gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence 42 1.3
197gb|AY084470.1| Arabidopsis thaliana clone 108944 mRNA, complete ... 42 1.3
198gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, comp... 42 1.3
199gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, c... 42 1.3
200emb|AJ605569.1| Ricinus communis partial mRNA for putative aquap... 42 1.3
201dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membra... 42 1.3
202gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming i... 42 1.3
203gb|BC084131.1| Xenopus laevis hypothetical LOC495037, mRNA (cDNA... 42 1.3
204gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 1.3
205gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, co... 42 1.3
206gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein ... 42 1.3
207gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrins... 42 1.3
208gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mip... 42 1.3
209ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative... 40 5.2
210gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 5.2
211gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (... 40 5.2
212gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, compl... 40 5.2
213emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4,... 40 5.2
214emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, ... 40 5.2
215emb|AL138650.1|ATT5N23 Arabidopsis thaliana DNA chromosome 3, BA... 40 5.2
216emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, B... 40 5.2
217emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, B... 40 5.2
218emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on ch... 40 5.2
219gb|AC083943.8| Genomic sequence for Oryza sativa, Nipponbare str... 40 5.2
220gb|AF452013.1|AF452013 Petunia x hybrida aquaporin-like protein ... 40 5.2
221gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, comp... 40 5.2
222gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrin... 40 5.2
223dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
224dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 5.2
225dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.2
226emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 5.2
227gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.2
228gb|U27347.1|GMU27347 Glycine max putative water channel protein ... 40 5.2

>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA,
            complete cds
          Length = 1283

 Score =  543 bits (274), Expect = e-151
 Identities = 368/394 (93%), Gaps = 9/394 (2%)
 Strand = Plus / Minus

                                                                        
Query: 6    aggaaaaggaatgcgggctaattaagacaagcgatcccatggaccgaattacaacacacg 65
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 1189 aggaaaagcaatgcgggctaattaagacaagcgatcccatggaccgaattacaagacacg 1130

                                                                        
Query: 66   gcacgcatgactgggc-acatac---gcatatgcagctgccgacacataaataacacgac 121
            ||||||||||| || | || |||   |||||||||||||||||||||||| |||||||||
Sbjct: 1129 gcacgcatgaccggaccacgtactacgcatatgcagctgccgacacataa-taacacgac 1071

                                                                        
Query: 122  cattgcagcggcc-aactgaactgtcgagaagttgcaaaagcggctttctctttggatgg 180
            |||||| |||||| |||||||||||||||||||||||||||||  ||||||| |||||||
Sbjct: 1070 cattgcggcggccgaactgaactgtcgagaagttgcaaaagcgcatttctctctggatgg 1011

                                                                        
Query: 181  atggacacagcacaggtcgccattgcttcaatcttgcatgcacatcacatggat---aac 237
            ||||||||| ||| |||||||||||||||| |||||||| || || ||||||||   |||
Sbjct: 1010 atggacacaacacgggtcgccattgcttcagtcttgcatacagatgacatggatgataac 951

                                                                        
Query: 238  tcgttacgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgta 297
            | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 950  ttgttacgcgttgctcctgaaggagccgagggccttgatggcgccggccctgaggatgta 891

                                                                        
Query: 298  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 890  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 831

                                              
Query: 358  atcatcccaggccttgtccttgttgtagatgacg 391
            ||||||||||||||||||||||||||||||||||
Sbjct: 830  atcatcccaggccttgtccttgttgtagatgacg 797



to top

>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence
          Length = 1348

 Score =  184 bits (93), Expect = 1e-43
 Identities = 135/149 (90%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 924 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 865

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           |||||||||||||||| || ||||| |  | |||||| |||||||||||||| || || |
Sbjct: 864 ggtagaaggccgcgatggcagcgcccacgagggggcccacccagaagatccagtggtcgt 805

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
           |||||| ||||||||||||||||||||||
Sbjct: 804 cccagggcttgtccttgttgtagatgacg 776



to top

>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds
          Length = 1133

 Score =  176 bits (89), Expect = 3e-41
 Identities = 134/149 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||
Sbjct: 872 acgcgttgctcctgaaggagccgagggccttgatggcgccagcccggaggatgtactggt 813

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 812 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 753

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
           |||||| ||||||||||||||||||||||
Sbjct: 752 cccagggcttgtccttgttgtagatgacg 724



to top

>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete
           cds
          Length = 1171

 Score =  168 bits (85), Expect = 8e-39
 Identities = 133/149 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           ||||||||||||||||||||||||||||||||||||| || |||| ||| ||||||||||
Sbjct: 943 acgcgttgctcctgaaggagccgagggccttgatggccccagcccggaggatgtactggt 884

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           |||||||||||||||| || ||||| |  |  ||||| |||||||||||||| || || |
Sbjct: 883 ggtagaaggccgcgatggcagcgcccacgagagggcccacccagaagatccagtggtcgt 824

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
           |||||| ||||||||||||||||||||||
Sbjct: 823 cccagggcttgtccttgttgtagatgacg 795



to top

>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete
           cds
          Length = 1268

 Score =  153 bits (77), Expect = 5e-34
 Identities = 131/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 996 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 937

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 936 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 877

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
           |||| | ||||||||||||||||| ||||
Sbjct: 876 cccatggcttgtccttgttgtagacgacg 848



to top

>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel
           protein, partial cds
          Length = 880

 Score =  153 bits (77), Expect = 5e-34
 Identities = 131/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||
Sbjct: 544 acgcgttgctcctgaaggagccgagggccttgatggggccggcccggaggatgtactggt 485

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 484 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccattggttgt 425

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
            ||||||||| || |||||| ||||||||
Sbjct: 424 gccaggccttctcgttgttgaagatgacg 396



to top

>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds
          Length = 1328

 Score =  153 bits (77), Expect = 5e-34
 Identities = 131/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||
Sbjct: 968 acgcgttgctcctgaaggagccgagggccttgatggcgccggcccggaggatgtactggt 909

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 908 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 849

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
            ||| ||||| || |||||| ||||||||
Sbjct: 848 gccacgccttctcgttgttgaagatgacg 820



to top

>gb|AY109332.1| Zea mays CL502_5 mRNA sequence
          Length = 1969

 Score =  153 bits (77), Expect = 5e-34
 Identities = 131/149 (87%)
 Strand = Plus / Minus

                                                                        
Query: 243  acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
            ||||||||||||||||||||||||| |||||||||||||| |||| ||| ||||||||||
Sbjct: 1646 acgcgttgctcctgaaggagccgagagccttgatggcgcccgcccggaggatgtactggt 1587

                                                                        
Query: 303  ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
            |||||||||||||||| || ||||| |  |  ||||| |||||||| ||||| || ||||
Sbjct: 1586 ggtagaaggccgcgatggcagcgcccaggagcgggcccacccagaaaatccagtggtcat 1527

                                         
Query: 363  cccaggccttgtccttgttgtagatgacg 391
            |||| | ||||||||||||||||| ||||
Sbjct: 1526 cccatggcttgtccttgttgtagacgacg 1498



 Score =  103 bits (52), Expect = 4e-19
 Identities = 85/96 (88%)
 Strand = Plus / Minus

                                                                       
Query: 295 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 354
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 321 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 262

                                               
Query: 355 ctgatcatcccaggccttgtccttgttgtagatgac 390
            || || |||||||||||||||||||||||||||||
Sbjct: 261 ttggtcgtcccaggccttgtccttgttgtagatgac 226



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  149 bits (75), Expect = 8e-33
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                            
Query: 243      acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
                |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 15355852 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 15355793

                                                                       
Query: 303      ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
                ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 15355792 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 15355738



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 298      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
                ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 15316534 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 15316475



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                            
Query: 298      ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
                ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 15306498 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 15306439



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                            
Query: 314      gcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
                ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 15324431 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 15324388



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 242      tacgcgttgctcctgaaggagccg 265
                ||||||||||||| ||||||||||
Sbjct: 15306551 tacgcgttgctccggaaggagccg 15306528



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score =  149 bits (75), Expect = 8e-33
 Identities = 105/115 (91%)
 Strand = Plus / Minus

                                                                         
Query: 243   acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
             |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 62851 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 62792

                                                                    
Query: 303   ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||| |||||||| || |||||||  |  |||||||||||||||||||||||
Sbjct: 62791 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccactg 62737



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 298   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 23533 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 23474



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 298   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 13497 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 13438



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                         
Query: 314   gcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 31430 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 31387



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 242   tacgcgttgctcctgaaggagccg 265
             ||||||||||||| ||||||||||
Sbjct: 13550 tacgcgttgctccggaaggagccg 13527



to top

>ref|NM_187092.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1242

 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
            ||| ||||| || |||||| ||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacg 830



to top

>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1257

 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
            ||| ||||| || |||||| ||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacg 832



to top

>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117
           mRNA
          Length = 1298

 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
            ||| ||||| || |||||| ||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacg 833



to top

>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full
           insert sequence
          Length = 1216

 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
            ||| ||||| || |||||| ||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacg 830



to top

>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full
           insert sequence
          Length = 1451

 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 572 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 513

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 512 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 453

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
            ||| ||||| || |||||| ||||||||
Sbjct: 452 gccacgccttctcgttgttgaagatgacg 424



to top

>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full
           insert sequence
          Length = 1242

 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 978 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 919

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 918 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 859

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
            ||| ||||| || |||||| ||||||||
Sbjct: 858 gccacgccttctcgttgttgaagatgacg 830



to top

>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full
           insert sequence
          Length = 1298

 Score =  145 bits (73), Expect = 1e-31
 Identities = 130/149 (87%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           |||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 981 acgcgttgctcctgaaggagccgagggctttgatggcgccggcccggaggatgtactggt 922

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 921 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 862

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
            ||| ||||| || |||||| ||||||||
Sbjct: 861 gccacgccttctcgttgttgaagatgacg 833



to top

>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full
           insert sequence
          Length = 1257

 Score =  137 bits (69), Expect = 3e-29
 Identities = 129/149 (86%)
 Strand = Plus / Minus

                                                                       
Query: 243 acgcgttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggt 302
           ||||||||||||||| |||||||||||| |||||||||||||||| ||| ||||||||||
Sbjct: 980 acgcgttgctcctgagggagccgagggctttgatggcgccggcccggaggatgtactggt 921

                                                                       
Query: 303 ggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcat 362
           ||||||| |||||||| || |||||||  |  |||||||||||||||||||| || |  |
Sbjct: 920 ggtagaacgccgcgatggcggcgccgacgaacgggccgacccagaagatccaatggttgt 861

                                        
Query: 363 cccaggccttgtccttgttgtagatgacg 391
            ||| ||||| || |||||| ||||||||
Sbjct: 860 gccacgccttctcgttgttgaagatgacg 832



to top

>ref|XM_466869.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1214

 Score =  117 bits (59), Expect = 3e-23
 Identities = 98/111 (88%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                              
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||| |||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagat 791



to top

>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full
           insert sequence
          Length = 1214

 Score =  117 bits (59), Expect = 3e-23
 Identities = 98/111 (88%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 901 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 842

                                                              
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||| |||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 841 gcccacccagaagatccattggtcatcccaggccttgtccttgttgtagat 791



to top

>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete
           cds
          Length = 1171

 Score =  103 bits (52), Expect = 4e-19
 Identities = 103/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 330
           |||| |||||| |||||| || | |||||||||||||  ||| ||||| || ||||| ||
Sbjct: 927 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 868

                                                                       
Query: 331 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
           ||  ||||| |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 867 cagtgggcccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 808



to top

>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete
           cds
          Length = 1156

 Score =  103 bits (52), Expect = 4e-19
 Identities = 85/96 (88%)
 Strand = Plus / Minus

                                                                       
Query: 295 gtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 354
           |||||||||||||  ||| ||||| || ||||||||||  ||||| ||||||||||||||
Sbjct: 893 gtactggtggtaggcggcggcgatggcggcgccgatcagtgggcccacccagaagatcca 834

                                               
Query: 355 ctgatcatcccaggccttgtccttgttgtagatgac 390
            || || |||||||||||||||||||||||||||||
Sbjct: 833 ttggtcgtcccaggccttgtccttgttgtagatgac 798



to top

>gb|AF139815.1|AF139815 Triticum aestivum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           complete cds
          Length = 1235

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 98/114 (85%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | |||||||||||||  ||| ||||| || ||||||||||  ||
Sbjct: 875 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagcgg 816

                                                                 
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
            || |||||||||||||| || ||||||||||||||||| ||||||||||||||
Sbjct: 815 ccccacccagaagatccattggtcatcccaggccttgtctttgttgtagatgac 762



to top

>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence
          Length = 1215

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 102/120 (85%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 330
           |||| |||||| |||||| || | |||||||||||||  ||| ||||| || ||||| ||
Sbjct: 935 cttggtggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccaat 876

                                                                       
Query: 331 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
           ||  || || |||||||||||||| || || |||||||||||||||||||||||||||||
Sbjct: 875 cagtggacccacccagaagatccattggtcgtcccaggccttgtccttgttgtagatgac 816



to top

>ref|NM_187081.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1215

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                        
Query: 358 atcatcccaggccttgtccttgttgtaga 386
           ||||  |||||||||||  ||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtaga 813



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 242 tacgcgttgctcctgaaggagccg 265
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>dbj|AK072632.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132K03, full
           insert sequence
          Length = 1215

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 901 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 842

                                        
Query: 358 atcatcccaggccttgtccttgttgtaga 386
           ||||  |||||||||||  ||||||||||
Sbjct: 841 atcactccaggccttgttgttgttgtaga 813



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 242 tacgcgttgctcctgaaggagccg 265
           ||||||||||||| ||||||||||
Sbjct: 954 tacgcgttgctccggaaggagccg 931



to top

>gb|AF141642.1|AF141642 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-1
           (PIP2-1) mRNA, complete cds
          Length = 1300

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 114/139 (82%)
 Strand = Plus / Minus

                                                                       
Query: 249 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 308
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 912 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 853

                                                                       
Query: 309 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 368
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 852 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 793

                              
Query: 369 ccttgtccttgttgtagat 387
           |||| || |||||||||||
Sbjct: 792 ccttctcattgttgtagat 774



to top

>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds
          Length = 1318

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 296 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 355
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 944 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 885

                                              
Query: 356 tgatcatcccaggccttgtccttgttgtagatgac 390
           || |||||||||||||||||  |||||||||||||
Sbjct: 884 tggtcatcccaggccttgtcagtgttgtagatgac 850



to top

>gb|AF133530.1|AF133530 Mesembryanthemum crystallinum water channel protein MipH (MipH)
           mRNA, complete cds
          Length = 1347

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 293 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 352
           ||||| |||||||||| ||| ||||| || || || || |  || ||||||||||| |||
Sbjct: 890 atgtattggtggtagatggcggcgatggcagccccaatgaacggtccgacccagaaaatc 831

                                              
Query: 353 cactgatcatcccaggccttgtccttgttgtagat 387
           ||||||||||||||||||||||  |||||||||||
Sbjct: 830 cactgatcatcccaggccttgttgttgttgtagat 796



to top

>gb|DQ339464.1| Vitis pseudoreticulata aquaporin protein (PIP2-1) mRNA, complete
           cds
          Length = 480

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 114/139 (82%)
 Strand = Plus / Minus

                                                                       
Query: 249 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtaga 308
           |||||||||| || || || |||||||| || || || || | |||| ||||||||||||
Sbjct: 466 tgctcctgaatgacccaagagccttgatagctccagctctcaatatgaactggtggtaga 407

                                                                       
Query: 309 aggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccagg 368
           |||| || || || || || || | ||| || ||||| ||||||||||| ||||||||||
Sbjct: 406 aggctgcaatggctgcaccaatgaagggtccaacccaaaagatccactggtcatcccagg 347

                              
Query: 369 ccttgtccttgttgtagat 387
           |||| || |||||||||||
Sbjct: 346 ccttctcattgttgtagat 328



to top

>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd
          Length = 1251

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                       
Query: 296 tactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccac 355
           ||||||||||||  ||| || || || ||||||||||  || || |||||||||||||| 
Sbjct: 864 tactggtggtaggcggcggcaatggcggcgccgatcagtggccccacccagaagatccat 805

                                              
Query: 356 tgatcatcccaggccttgtccttgttgtagatgac 390
           || |||||||||||||||||  |||||||||||||
Sbjct: 804 tggtcatcccaggccttgtcagtgttgtagatgac 770



to top

>ref|NM_129458.2| Arabidopsis thaliana PIP2;6/PIP2E; water channel AT2G39010
           (PIP2;6/PIP2E) mRNA, complete cds
          Length = 1245

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacg 391
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||
Sbjct: 845 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 792



to top

>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds
          Length = 1104

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 95/114 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | ||||||||||||    || ||||| || |||||||| |  ||
Sbjct: 825 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 766

                                                                 
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
            || |||||||||||||| || ||||||||||||||||| ||||||||||||||
Sbjct: 765 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgac 712



to top

>gb|AY057559.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1201

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacg 391
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||
Sbjct: 840 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 787



to top

>gb|AY054142.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 870

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacg 391
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||
Sbjct: 758 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 705



to top

>gb|AY045690.1| Arabidopsis thaliana At2g39010/T7F6.18 mRNA, complete cds
          Length = 1169

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacg 391
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||
Sbjct: 842 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 789



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                            
Query: 277      ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
                ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 25184682 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 25184623

                                      
Query: 337      gccgacccagaagatccactga 358
                ||| ||||||||||||||||||
Sbjct: 25184622 gcccacccagaagatccactga 25184601



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                             
Query: 359      tcatcccaggccttgtccttgttgtagat 387
                |||||||||||||||||||||||||||||
Sbjct: 25184038 tcatcccaggccttgtccttgttgtagat 25184010



to top

>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete
           cds
          Length = 1207

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 95/114 (83%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | ||||||||||||    || ||||| || |||||||| |  ||
Sbjct: 880 ggcgctggccctcagcacgtactggtggtacgccgcggcgatggcggcgccgatgaatgg 821

                                                                 
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
            || |||||||||||||| || ||||||||||||||||| ||||||||||||||
Sbjct: 820 acccacccagaagatccagtggtcatcccaggccttgtcgttgttgtagatgac 767



to top

>emb|BX819407.1|CNS0A8TU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB75ZE10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1128

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacg 391
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||
Sbjct: 819 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 766



to top

>emb|BX820104.1|CNS0A8J8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZC11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1160

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 50/54 (92%)
 Strand = Plus / Minus

                                                                 
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacg 391
           ||||||||||||||||||||||||||||| ||||| |  |||||||||||||||
Sbjct: 829 ccgacccagaagatccactgatcatcccaagccttttgattgttgtagatgacg 776



to top

>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1469H02
          Length = 136602

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 71/82 (86%)
 Strand = Plus / Minus

                                                                         
Query: 277   ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
             ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||||| |||
Sbjct: 85075 ggcgctggccctcagcacgtactggtggtaggcggcggcgatggcggcgccgatcagggg 85016

                                   
Query: 337   gccgacccagaagatccactga 358
             ||| ||||||||||||||||||
Sbjct: 85015 gcccacccagaagatccactga 84994



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                          
Query: 359   tcatcccaggccttgtccttgttgtagat 387
             |||||||||||||||||||||||||||||
Sbjct: 84431 tcatcccaggccttgtccttgttgtagat 84403



to top

>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 97/117 (82%)
 Strand = Plus / Minus

                                                                       
Query: 271 cttgatggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgat 330
           |||| |||||| |||||| || | |||||||||||| ||||| ||||| || || |||||
Sbjct: 913 cttggtggcgctggccctcagcacgtactggtggtacaaggcggcgatggcggccccgat 854

                                                                    
Query: 331 catggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
            |  || || |||||||| ||||| || |||||||||||||| || |||||||||||
Sbjct: 853 gaatggccccacccagaacatccagtggtcatcccaggccttctcgttgttgtagat 797



to top

>gb|AY823263.1| Vitis vinifera aquaporin (PIP2-1) mRNA, complete cds
          Length = 1216

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 81/96 (84%)
 Strand = Plus / Minus

                                                                       
Query: 292 tatgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagat 351
           |||| |||||||||||||||| || || || || || || | ||| || ||||| |||||
Sbjct: 873 tatgaactggtggtagaaggctgcaatggctgcaccaatgaagggtccaacccaaaagat 814

                                               
Query: 352 ccactgatcatcccaggccttgtccttgttgtagat 387
           |||||| |||||||||||||| || |||||||||||
Sbjct: 813 ccactggtcatcccaggccttctcattgttgtagat 778



to top

>gb|AY903443.1| Astragalus membranaceus clone AM79 putative plasma membrane
           intrinsic protein mRNA, complete cds
          Length = 1120

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgta 384
           ||||||||||||||||| |||||||| |||||||||||||||||
Sbjct: 746 acccagaagatccactggtcatcccatgccttgtccttgttgta 703



 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 248 ttgctcctgaaggagccgagggccttgatggc 279
           |||||||||||||| ||||| |||||||||||
Sbjct: 839 ttgctcctgaaggatccgagagccttgatggc 808



to top

>ref|XM_473219.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 873

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 92/111 (82%)
 Strand = Plus / Minus

                                                                       
Query: 277 ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
           ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 837 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 778

                                                              
Query: 337 gccgacccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
            || |||||||||||||| || |||| ||| ||||||| || |||||||||
Sbjct: 777 ccccacccagaagatccagtggtcatgccatgccttgtgctggttgtagat 727



to top

>gb|DQ202708.1| Olea europaea plasma membrane intrinsic protein (pip1) mRNA,
           complete cds
          Length = 1152

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||||||||| |||||||| |||||||||||||
Sbjct: 799 acccagaatatccagtgatcatcccatgccttgtctttgttgtagatga 751



to top

>gb|DQ358107.1| Vitis vinifera aquaporin PIP2 (pip2) mRNA, complete cds
          Length = 901

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
           ||||||||||| ||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 771 ccgacccagaacatccaatggtcatcccaggccttgtcgttgttatagatgac 719



to top

>gb|BT017668.1| Zea mays clone EL01N0441H09.c mRNA sequence
          Length = 698

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 397 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 338

                       
Query: 358 atcatcccaggc 369
            ||| |||||||
Sbjct: 337 gtcagcccaggc 326



to top

>gb|AY243800.1| Zea mays plasma membrane intrinsic protein (PIP1-1) mRNA, complete
           cds
          Length = 1086

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 828 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 769

                       
Query: 358 atcatcccaggc 369
            ||| |||||||
Sbjct: 768 gtcagcccaggc 757



to top

>emb|X82633.1|ZMTRAPRO Z.mays mRNA for transmembrane protein
          Length = 1169

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||| ||
Sbjct: 885 ctggtggtagatggcagccagcgcagcgccgatgaaggggccgacccagaagatccagtg 826

                       
Query: 358 atcatcccaggc 369
            ||| |||||||
Sbjct: 825 gtcagcccaggc 814



to top

>emb|AJ849323.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.1 gene)
          Length = 943

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||| |||||||| ||||| ||||||||||||||  ||||||||||| ||||||
Sbjct: 883 ggggccaacccagaaaatccagtgatcatcccaggcgctgtccttgttgaagatga 828



to top

>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin
          Length = 1291

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 298  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
            ||||||||||| ||| || | ||| |||||||| | ||||||||||||||||||||||||
Sbjct: 1291 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatccactg 1232



to top

>dbj|AB058678.1| Pyrus communis Py-PIP2-1 mRNA for plasma membrane intrinsic protein
           2-1, complete cds
          Length = 1311

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 115/143 (80%)
 Strand = Plus / Minus

                                                                       
Query: 248 ttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtag 307
           ||||| ||||| || || || ||||||||||| || || || || ||||| |||||||||
Sbjct: 907 ttgcttctgaaagatcccagagccttgatggctcctgctctcagaatgtattggtggtag 848

                                                                       
Query: 308 aaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccag 367
           ||||| || || || || || || |  || || | |||||||||||| || |||||||| 
Sbjct: 847 aaggcagcaatggcagctccaatgaaaggtccaagccagaagatccattggtcatcccaa 788

                                  
Query: 368 gccttgtccttgttgtagatgac 390
           || ||||||||||| ||||||||
Sbjct: 787 gctttgtccttgttatagatgac 765



to top

>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein
          Length = 1225

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 354
           ||||||||||| ||| || | ||| |||||||| | |||||||||||||||||||||
Sbjct: 898 ctggtggtagatggcggccagcgcggcgccgatgaaggggccgacccagaagatcca 842



to top

>emb|AJ224327.1|OSAJ4327 Oryza sativa mRNA for aquaporin, complete CDS
          Length = 1139

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| || |||| |||||| | |||||||||||||||||
Sbjct: 812 acccagaagatccaatggtcattccaggcatggtccttgttgtagatga 764



to top

>emb|AJ843992.1| Plantago major partial mRNA for aquaporin 2 (aqp2 gene)
          Length = 1089

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| || ||||||||||| | |||| ||||||||||||
Sbjct: 770 acccagaagatccagtggtcatcccaggcgtggtccctgttgtagatga 722



to top

>dbj|AB218716.1| Prunus mume Pm3 mRNA for aquaporin, complete cds
          Length = 1278

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 343 ccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           |||||||||||| || |||||||| || |||||||||||||||||
Sbjct: 768 ccagaagatccattggtcatcccaagctttgtccttgttgtagat 724



to top

>dbj|AK104658.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-D06, full
           insert sequence
          Length = 1128

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| || |||| |||||| | |||||||||||||||||
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatga 797



to top

>dbj|AK103807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147A07, full
           insert sequence
          Length = 1205

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| || |||| |||||| | |||||||||||||||||
Sbjct: 900 acccagaagatccaatggtcattccaggcatggtccttgttgtagatga 852



to top

>dbj|AK061769.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-C05, full
           insert sequence
          Length = 1136

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| || |||| |||||| | |||||||||||||||||
Sbjct: 845 acccagaagatccaatggtcattccaggcatggtccttgttgtagatga 797



to top

>gb|AF022737.1|AF022737 Oryza sativa transmembrane protein mRNA, complete cds
          Length = 1140

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| || |||| |||||| | |||||||||||||||||
Sbjct: 840 acccagaagatccaatggtcattccaggcatggtccttgttgtagatga 792



to top

>dbj|AB058680.1| Pyrus communis Py-PIP2-2 mRNA for plasma membrane intrinsic protein
           2-2, complete cds
          Length = 1051

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 299 tggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactga 358
           |||||||||||||| || || || || || || | ||| || |||||||| ||||| || 
Sbjct: 874 tggtggtagaaggctgcaattgctgctccaatgaagggtcctacccagaaaatccattgg 815

                                        
Query: 359 tcatcccaggccttgtccttgttgtagat 387
           |||||||| |||||||| |||||||||||
Sbjct: 814 tcatcccaagccttgtctttgttgtagat 786



to top

>dbj|AB009665.1| Oryza sativa (japonica cultivar-group) mRNA for water channel
           protein, complete cds
          Length = 1116

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| || |||| |||||| | |||||||||||||||||
Sbjct: 843 acccagaagatccaatggtcattccaggcatggtccttgttgtagatga 795



to top

>ref|NM_118469.2| Arabidopsis thaliana PIP1;5/PIP1D; water channel AT4G23400
           (PIP1;5/PIP1D) mRNA, complete cds
          Length = 1128

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||||||||| || |||||||| || |  ||||||||||||||||
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatga 783



to top

>ref|XM_473480.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||| |||||||||||||| || ||||||||||| | | || ||||||||||||
Sbjct: 774 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 719



to top

>gb|DQ207683.1| Zea mays cultivar inbred line Mo17 IDP251 marker
          Length = 824

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||||||
Sbjct: 288 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccactg 347



to top

>gb|DQ207682.1| Zea mays cultivar B73 IDP251 marker
          Length = 763

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || |||||||| | ||||||||||||||||||||||||
Sbjct: 489 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatccactg 430



to top

>gb|AY081593.1| Arabidopsis thaliana water channel-like protein (At4g23400) mRNA,
           complete cds
          Length = 956

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||||||||| || |||||||| || |  ||||||||||||||||
Sbjct: 785 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatga 734



to top

>gb|AY059948.1| Arabidopsis thaliana water channel - like protein (At4g23400;
           F16G20.100) mRNA, complete cds
          Length = 1125

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||||||||| || |||||||| || |  ||||||||||||||||
Sbjct: 834 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatga 783



to top

>dbj|AK221275.1| Arabidopsis thaliana mRNA for water channel - like protein, partial
           cds, clone: RAFL24-17-A12
          Length = 392

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||||||||| || |||||||| || |  ||||||||||||||||
Sbjct: 90  ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatga 39



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                            
Query: 277      ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
                ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 26074829 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 26074770

                                    
Query: 337      gccgacccagaagatccact 356
                 || ||||||||||||||||
Sbjct: 26074769 ccccacccagaagatccact 26074750



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                        
Query: 247     gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
               |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 8906703 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 8906759



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 334      ggggccgacccagaagatccactg 357
                |||||| |||||||||||||||||
Sbjct: 28021379 ggggccaacccagaagatccactg 28021356



to top

>emb|BX826565.1|CNS0A4GR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 454

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||||||||| || |||||||| || |  ||||||||||||||||
Sbjct: 158 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatga 107



to top

>emb|BX826657.1|CNS0A38E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB51ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 710

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||||||||| || |||||||| || |  ||||||||||||||||
Sbjct: 417 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatga 366



to top

>emb|BX827146.1|CNS0A2UM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZB08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1066

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||||||||| || |||||||| || |  ||||||||||||||||
Sbjct: 823 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatga 772



to top

>emb|BX827200.1|CNS0A2RC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS21ZB06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1078

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||||||||| || |||||||| || |  ||||||||||||||||
Sbjct: 798 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatga 747



to top

>gb|AY087945.1| Arabidopsis thaliana clone 3982 mRNA, complete sequence
          Length = 1089

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||||||||| || |||||||| || |  ||||||||||||||||
Sbjct: 832 ccgacccagaagatccaatggtcatcccaagcatgatccttgttgtagatga 781



to top

>gb|AY170841.1| Axonopus compressus plasma membrane MIP protein mRNA, partial cds
          Length = 423

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || ||||| || | ||||||||||||||||||||| ||
Sbjct: 384 ctggtggtagatggcggctagggcagcgccaatgaaggggccgacccagaagatccaatg 325

                                           
Query: 358 atcatcccaggccttgtccttgttgtagatga 389
            |||| |||||| |  ||| ||||||||||||
Sbjct: 324 gtcattccaggcgtgctccctgttgtagatga 293



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                          
Query: 298    ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
              ||||||||| |  |||||||||||||| ||||| |  || ||||||||||||||||||||
Sbjct: 102547 ctggtggtacagcgccgcgatcgccgccccgatgaacggcccgacccagaagatccactg 102488



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 298   ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
             ||||||||| |  |||||||||||||||||||| |  || || |||||||||||||||||
Sbjct: 92511 ctggtggtacagcgccgcgatcgccgcgccgatgaacggcccaacccagaagatccactg 92452



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                          
Query: 314    gcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
              ||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 110444 gcgatcgccgccccgatgaacggcccaacccagaagatccactg 110401



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 242   tacgcgttgctcctgaaggagccg 265
             ||||||||||||| ||||||||||
Sbjct: 92564 tacgcgttgctccggaaggagccg 92541



to top

>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full
           insert sequence
          Length = 1163

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||| |||||||||||||| || ||||||||||| | | || ||||||||||||
Sbjct: 851 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 796



to top

>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full
           insert sequence
          Length = 1164

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||| || |  || ||||| || | |||||| |||||||||||||| ||
Sbjct: 888 ctggtggtagatggcagcaagggcagcgccaatgaaggggccaacccagaagatccaatg 829

                                           
Query: 358 atcatcccaggccttgtccttgttgtagatga 389
            ||||||||||| | | || ||||||||||||
Sbjct: 828 gtcatcccaggcatggcccctgttgtagatga 797



to top

>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full
           insert sequence
          Length = 1167

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||| |||||||||||||| || ||||||||||| | | || ||||||||||||
Sbjct: 854 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 799



to top

>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full
            insert sequence
          Length = 1462

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 334  ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
            |||||| |||||||||||||| || ||||||||||| | | || ||||||||||||
Sbjct: 1150 ggggccaacccagaagatccaatggtcatcccaggcatggcccctgttgtagatga 1095



to top

>dbj|AB009309.2| Hordeum vulgare HvPIP1;5 mRNA, complete cds
          Length = 1147

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||| |||||||||||||| || |||| |||||| | |||| ||||||||||||
Sbjct: 877 ggggcccacccagaagatccaatggtcattccaggcatggtccctgttgtagatga 822



to top

>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11,
              complete sequence
          Length = 163039

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                          
Query: 277    ggcgccggccctgagtatgtactggtggtagaaggccgcgatcgccgcgccgatcatggg 336
              ||||| |||||| || | |||||||||||||  ||| ||||| || |||||||| | |||
Sbjct: 109156 ggcgctggccctcaggacgtactggtggtaggcggcggcgatggcggcgccgatgagggg 109097

                                  
Query: 337    gccgacccagaagatccact 356
               || ||||||||||||||||
Sbjct: 109096 ccccacccagaagatccact 109077



to top

>emb|AJ849328.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.5 gene)
          Length = 1094

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgta 384
           ||||||||||||||||| || |||||||| |||||||| | ||||||
Sbjct: 809 ccgacccagaagatccaatggtcatcccatgccttgtcttcgttgta 763



to top

>emb|AJ849326.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.3 gene)
          Length = 1187

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           |||||||| ||||| || |||||||| ||||| ||||||||||||||
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagat 754



to top

>emb|AJ299449.1|PTR299449 Populus tremula x Populus tremuloides mRNA for major intrinsic
           protein 1 (mip1 gene)
          Length = 1187

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           |||||||| ||||| || |||||||| ||||| ||||||||||||||
Sbjct: 800 acccagaaaatccagtggtcatcccatgccttttccttgttgtagat 754



to top

>gb|AF314656.1|AF314656 Brassica oleracea aquaporin (PIP3) mRNA, complete cds
          Length = 909

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           |||||||||||||| || |||||||| ||||| || |||||||||||
Sbjct: 740 acccagaagatccaatggtcatcccacgccttctcgttgttgtagat 694



to top

>gb|DQ269455.1| Stevia rebaudiana aquaporin mRNA, partial cds
          Length = 1070

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           |||||||| ||||| ||||||||||| || ||||| |||||||||||
Sbjct: 746 acccagaaaatccattgatcatcccaagctttgtctttgttgtagat 700



to top

>ref|NM_187084.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 852

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                       
Query: 314 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 373
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 782 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 723

                             
Query: 374 tccttgttgtagatgacg 391
              |||||||||| ||||
Sbjct: 722 ctgttgttgtagacgacg 705



to top

>ref|XM_506303.1| PREDICTED Oryza sativa (japonica cultivar-group), P0475E07.134 mRNA
          Length = 619

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                       
Query: 314 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 373
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 340 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 281

                             
Query: 374 tccttgttgtagatgacg 391
              |||||||||| ||||
Sbjct: 280 ctgttgttgtagacgacg 263



to top

>emb|AJ849325.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.2 gene)
          Length = 978

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
           |||||||| ||||| |||||||||||||| || || |||||| |||||||
Sbjct: 826 acccagaaaatccaatgatcatcccaggctttttcattgttgaagatgac 777



to top

>gb|AF141900.1|AF141900 Vitis berlandieri x Vitis rupestris putative aquaporin PIP2-2
           (PIP2-2) mRNA, complete cds
          Length = 1171

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatgacg 391
           |||||||||||||||||||| || |||||  | || || |||||||||||||||
Sbjct: 787 ccgacccagaagatccactggtcgtcccaaactttttcattgttgtagatgacg 734



to top

>gb|U56603.1|BMU56603 Bufo marinus vasopressin-insensitive water channel AQP-t1 mRNA,
           complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 326 ccgatcatggggccgacccagaagatccactgat 359
           ||||||||||| ||||||||||||||||| ||||
Sbjct: 761 ccgatcatgggaccgacccagaagatccagtgat 728



to top

>dbj|AK107700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-132-C10, full
           insert sequence
          Length = 618

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                       
Query: 314 gcgatcgccgcgccgatcatggggccgacccagaagatccactgatcatcccaggccttg 373
           ||||||||||| ||||| |  || || |||||||||||||||||||||  ||| ||||||
Sbjct: 339 gcgatcgccgccccgatgaacggcccaacccagaagatccactgatcactccatgccttg 280

                             
Query: 374 tccttgttgtagatgacg 391
              |||||||||| ||||
Sbjct: 279 ctgttgttgtagacgacg 262



to top

>gb|AF020620.1| Bufo marinus aquaporin-1 homolog (AQP-t1) mRNA, complete cds
          Length = 939

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 326 ccgatcatggggccgacccagaagatccactgat 359
           ||||||||||| ||||||||||||||||| ||||
Sbjct: 761 ccgatcatgggaccgacccagaagatccagtgat 728



to top

>ref|NM_115339.2| Arabidopsis thaliana PIP2;5/PIP2D; water channel AT3G54820
           (PIP2;5/PIP2D) mRNA, complete cds
          Length = 1229

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 851 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 803



to top

>ref|XM_475029.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 849

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 247 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 837 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 781



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacg 391
           ||||||||||||| || || ||||| ||||| | || |||||||||||||
Sbjct: 742 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacg 693



to top

>gb|DQ228330.1| Solanum tuberosum clone 137E08 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1086

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| || |||||||| |||| ||| |||||||||||||
Sbjct: 815 acccagaaaatccagtggtcatcccatgcctcgtctttgttgtagatga 767



to top

>gb|BT018400.1| Zea mays clone EL01N0323H01.d mRNA sequence
          Length = 1154

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 354
           ||||||||||| ||| || |  || |||||||| | |||||||||||||||||||||
Sbjct: 790 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatcca 734



to top

>gb|BT000670.1| Arabidopsis thaliana clone RAFL07-09-N03 (R10758) putative
           aquaporin/plasma membrane intrinsic protein (At3g54820)
           mRNA, complete cds
          Length = 1143

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 771 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 723



to top

>gb|AY062981.1| Arabidopsis thaliana putative aquaporin/MIP protein (At3g54820)
           mRNA, complete cds
          Length = 892

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 755 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 707



to top

>gb|AF370351.1| Arabidopsis thaliana putative aquaporin/MIP protein (At3g54820)
           mRNA, complete cds
          Length = 1194

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 850 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 802



to top

>emb|AL731636.3|OSJN00281 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0093G06,
             complete sequence
          Length = 127420

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 247   gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
             |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 91012 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 91068



to top

>gb|AF141643.1|AF141643 Vitis berlandieri x Vitis rupestris putative aquaporin PIP1-1
           (PIP1-1) mRNA, complete cds
          Length = 1115

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| || || ||||| || | |||||||||||||||||
Sbjct: 810 acccagaagatccagtggtcgtcccatgcgtggtccttgttgtagatga 762



to top

>gb|AY714380.1| Aegiceras corniculatum aquaporin 1 mRNA, partial cds
          Length = 534

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||
Sbjct: 458 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatga 410



to top

>gb|AY671949.1| Aegiceras corniculatum aquaporin 1 (PIP1) mRNA, complete cds
          Length = 867

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| || ||||||||||| |  ||||||||||||||||
Sbjct: 788 acccagaatatccaatgttcatcccaggcttgatccttgttgtagatga 740



to top

>gb|AF299050.1|AF299050 Brassica oleracea aquaporin PIP1b1 mRNA, complete cds
          Length = 1084

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 815 acccagaagacccaatggtcatcccaagcgttgtccttgttgaagatga 767



to top

>gb|AF326488.1|AF326488 Zea mays plasma membrane integral protein ZmPIP1-4 mRNA, complete
           cds
          Length = 1153

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 354
           ||||||||||| ||| || |  || |||||||| | |||||||||||||||||||||
Sbjct: 940 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatcca 884



to top

>gb|AF326487.1|AF326487 Zea mays plasma membrane integral protein ZmPIP1-3 mRNA, complete
           cds
          Length = 1296

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 298 ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 354
           ||||||||||| ||| || |  || |||||||| | |||||||||||||||||||||
Sbjct: 935 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatcca 879



to top

>emb|BX822631.1|CNS0A61A Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB54ZF09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 897

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 571 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 523



to top

>gb|AY084843.1| Arabidopsis thaliana clone 11929 mRNA, complete sequence
          Length = 1222

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||  ||||| || |||||||||||||||||||
Sbjct: 852 acccagaatatccaatgatggtcccaagctttgtccttgttgtagatga 804



to top

>emb|AJ605574.1| Ricinus communis mRNA for aquaporin (Pip1-1 gene), clone pP2L
          Length = 1095

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| |||||||||||| | | |||||||||| ||||||
Sbjct: 868 acccagaaaatccaatgatcatcccagccttggtccttgttgaagatga 820



to top

>dbj|AK102155.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086E18, full
           insert sequence
          Length = 1308

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 247 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 936 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 880



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacg 391
           ||||||||||||| || || ||||| ||||| | || |||||||||||||
Sbjct: 841 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacg 792



to top

>dbj|AK061491.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-B05, full
           insert sequence
          Length = 1309

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 247 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 930 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 874



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacg 391
           ||||||||||||| || || ||||| ||||| | || |||||||||||||
Sbjct: 835 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacg 786



to top

>dbj|AK061312.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-B10, full
           insert sequence
          Length = 1296

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 247 gttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 924 gttgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 868



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacg 391
           ||||||||||||| || || ||||| ||||| | || |||||||||||||
Sbjct: 829 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacg 780



to top

>gb|AY103580.1| Zea mays PCO072544 mRNA sequence
          Length = 1633

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                     
Query: 298  ctggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatcca 354
            ||||||||||| ||| || |  || |||||||| | |||||||||||||||||||||
Sbjct: 1264 ctggtggtagatggcagccagggcggcgccgatgaaggggccgacccagaagatcca 1208



to top

>dbj|AB009308.2| Hordeum vulgare HvPIP1;3 mRNA, complete cds
          Length = 1285

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 301 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 360
           ||||||||  ||||| | |||||||||||| |  || || |||||||||||||| || ||
Sbjct: 914 gtggtagatcgccgccagcgccgcgccgatgaacggtcccacccagaagatccagtggtc 855

                                        
Query: 361 atcccaggccttgtccttgttgtagatga 389
            ||||| ||||  | ||||||||||||||
Sbjct: 854 gtcccacgcctgcttcttgttgtagatga 826



to top

>gb|DQ294260.1| Solanum tuberosum clone 108A04 major intrinsic protein 1-like
           protein mRNA, complete cds
          Length = 1153

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||
Sbjct: 825 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatga 777



to top

>gb|AF366564.1| Triticum aestivum aquaporin PIP1 (Pip1) mRNA, complete cds
          Length = 1248

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 301 gtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatccactgatc 360
           |||||||| |||||| | |||||| ||||| |  || || |||||||||||||| || ||
Sbjct: 899 gtggtagatggccgccagcgccgcaccgatgaacggaccaacccagaagatccagtggtc 840

                                        
Query: 361 atcccaggccttgtccttgttgtagatga 389
            ||||| ||||  | ||||||||||||||
Sbjct: 839 gtcccacgcctgcttcttgttgtagatga 811



to top

>gb|DQ241832.1| Solanum tuberosum clone 174H05 water channel protein-like mRNA,
           complete cds
          Length = 1172

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| || |||| ||| |||| ||| |||||||||||||
Sbjct: 815 acccagaagatccagtggtcattccatgcctcgtctttgttgtagatga 767



to top

>dbj|AB002149.1| Nicotiana excelsior mRNA for water channel protein, complete cds
          Length = 1064

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| ||||||||||| |||| ||| | |||| ||||||
Sbjct: 815 acccagaagatccagtgatcatcccatgcctggtcgtggttgaagatga 767



to top

>ref|NM_100044.3| Arabidopsis thaliana PIP1C; water channel AT1G01620 (PIP1C) mRNA,
           complete cds
          Length = 1251

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 908 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 857



to top

>emb|X95640.1|BOMIPBTCP B.oleracea mRNA for transmembrane channel protein (mipB)
          Length = 1114

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 800 ccgacccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatga 749



to top

>emb|X75882.1|ATPIP1C A.thaliana mRNA for plasma membrane intrinsic protein 1c
          Length = 986

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 814 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 763



to top

>emb|X69294.1|ATTMPB A.thaliana mRNA for transmembrane protein TMP-B
          Length = 1057

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 795 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 744



to top

>gb|AY062610.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (F22L4.16) mRNA, complete cds
          Length = 1031

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 836 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 785



to top

>gb|AF348574.1| Arabidopsis thaliana clone C00104 (e) putative plasma membrane
           intrinsic protein 1c (At1g01620) mRNA, complete cds
          Length = 861

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 731



to top

>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete
           cds
          Length = 1257

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 314 gcgatcgccgcgccgatcatggggccgacccagaagatccactg 357
           ||||||||||| ||||| |  ||||| |||||||||||||||||
Sbjct: 884 gcgatcgccgctccgatgaacgggcccacccagaagatccactg 841



to top

>emb|BX816517.1|CNS0AD43 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZE08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 826 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 775



to top

>dbj|AB206103.1| Mimosa pudica pip2;5 mRNA for plasma membrane intrinsic protein
           2;5, complete cds
          Length = 1126

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgta 384
           |||||||||||||| || |||||||| |||||| | ||||||||
Sbjct: 786 acccagaagatccaatggtcatcccaagccttgccattgttgta 743



to top

>gb|AF255795.1|AF255795 Allium cepa aquaporin 1 (Aqp1) mRNA, complete cds
          Length = 1237

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgta 384
           |||||||| ||||||||||| ||||| || || |||||||||||
Sbjct: 816 acccagaatatccactgatcgtcccaagctttatccttgttgta 773



to top

>emb|AJ605565.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-2 gene),
           clone pR450-3
          Length = 452

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 352 ccactgatcatcccaggccttgtccttgttgtagat 387
           |||||| |||||||| ||||| ||||||||||||||
Sbjct: 435 ccactggtcatcccatgccttctccttgttgtagat 400



to top

>gb|BT002101.1| Arabidopsis thaliana plasma membrane intrinsic protein 1C
           (transmembrane protein B) (At1g01620) mRNA, complete cds
          Length = 903

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||| ||||| || || ||||| || | |||||||||||||||||
Sbjct: 782 ccgacccagaatatccagtggtcgtcccaagcgtggtccttgttgtagatga 731



to top

>gb|U73466.1|MCU73466 Mesembryanthemum crystallinum water channel protein MipC mRNA,
           complete cds
          Length = 1066

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 341 acccagaagatccactgatcatcccaggcctt 372
           |||||||| ||||| |||||||||||||||||
Sbjct: 838 acccagaaaatccaatgatcatcccaggcctt 807



to top

>gb|AF131201.1| Zea mays plasma membrane MIP protein (pip1-2) mRNA, complete cds
          Length = 1280

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 334 ggggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||||||||||||||||||| || || | |||||| |  ||| ||||||||||||
Sbjct: 855 ggggccgacccagaagatccaatggtcgttccaggcgtgatccctgttgtagatga 800



to top

>gb|L36096.1|CIPMIPC Mesembryanthemum crystallinum mipC mRNA
          Length = 582

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 341 acccagaagatccactgatcatcccaggcctt 372
           |||||||| ||||| |||||||||||||||||
Sbjct: 354 acccagaaaatccaatgatcatcccaggcctt 323



to top

>ref|NM_119676.2| Arabidopsis thaliana PIP3 (PLASMA MEMBRANE INTRINSIC PROTEIN 3);
           water channel AT4G35100 (PIP3) mRNA, complete cds
          Length = 1182

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>gb|DQ226873.1| Boechera divaricarpa isolate SLW-C-G04 mRNA sequence
          Length = 514

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 163 acccaaaagatccaatggtcatcccaagccttctcgttgttgtagat 117



to top

>gb|AY189974.1| Juglans regia plasma intrinsic protein 2,2 mRNA, complete cds
          Length = 1278

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 293 atgtactggtggtagaaggccgcgatcgccgcgccgatcatggggccgacccagaagatc 352
           ||||||||||| ||||| || || || || || || || | ||| ||||||||||| |||
Sbjct: 937 atgtactggtgatagaatgcagctattgcggcaccaatgaagggtccgacccagaaaatc 878

                                      
Query: 353 cactgatcatcccaggccttgtccttg 379
           || || |||||||| ||||| ||||||
Sbjct: 877 cattggtcatcccatgccttatccttg 851



to top

>emb|Y18311.1|STU18311 Solanum tuberosum mRNA for major intrinsic protein 1
          Length = 1108

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           |||||||||||||| || |||||||| |||| ||| | |||||||||
Sbjct: 863 acccagaagatccagtggtcatcccatgcctggtcttggttgtagat 817



to top

>emb|AJ849327.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.4 gene)
          Length = 1135

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           |||||||||||||| || |  |||||||||||||| | |||||||||
Sbjct: 771 acccagaagatccagtggtggtcccaggccttgtcttggttgtagat 725



to top

>emb|AJ849322.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip1.2 gene)
          Length = 1124

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 335 gggccgacccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||||||||||||| || |||||||| || | ||| |||||| ||||||
Sbjct: 866 gggccaacccagaagatccagtggtcatcccatgcatggtctttgttgaagatga 812



to top

>gb|AF367458.1| Prunus persica clone Mip2 membrane intrinsic protein (mip2) mRNA,
           partial cds
          Length = 495

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 357 gatcatcccaggccttgtccttgttgtagat 387
           |||| |||||||| |||||||||||||||||
Sbjct: 490 gatcgtcccaggctttgtccttgttgtagat 460



to top

>gb|AY081580.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100) mRNA, complete cds
          Length = 946

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 737 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 691



to top

>gb|AY062803.1| Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           (At4g35100; M4E13.150) mRNA, complete cds
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 738



to top

>gb|AF412110.1|AF412110 Arabidopsis thaliana AT4g35100/M4E13_150 mRNA, complete cds
          Length = 1026

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>gb|AF003728.1|AF003728 Arabidopsis thaliana plasma membrane intrinsic protein (SIMIP)
           mRNA, complete cds
          Length = 1030

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 765 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 719



to top

>emb|BX826680.1|CNS0A37C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 777 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 731



to top

>emb|BX826294.1|CNS0A39S Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB11ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 775 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 729



to top

>emb|BX827919.1|CNS0A2ZT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH35ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1019

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 774 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 728



to top

>emb|BX827124.1|CNS0A2UI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS11ZH09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 769 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 723



to top

>gb|AY995195.1| Phaseolus vulgaris putative aquaporin (PIP2;1) mRNA, complete cds
          Length = 1330

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           |||||||| ||||||||||||||||||   || || |||||||||||
Sbjct: 810 acccagaaaatccactgatcatcccagattttttcattgttgtagat 764



to top

>dbj|AB206100.1| Mimosa pudica pip2;2 mRNA for plasma membrane intrinsic protein
           2;2, complete cds
          Length = 1223

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           |||||||| ||||| |||||||||||   ||| ||||||||||||||
Sbjct: 819 acccagaatatccaatgatcatcccaaatcttatccttgttgtagat 773



to top

>dbj|AB206099.1| Mimosa pudica pip2;1 mRNA for plasma membrane intrinsic protein
           2;1, complete cds
          Length = 1235

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 335 gggccgacccagaagatccactgatcatcccaggccttg 373
           ||||| |||||||| ||||| ||||||||||| ||||||
Sbjct: 804 gggccaacccagaaaatccaatgatcatcccaagccttg 766



to top

>gb|AY088485.1| Arabidopsis thaliana clone 7108 mRNA, complete sequence
          Length = 1033

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 786 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 740



to top

>dbj|D85193.1| Arabidopsis thaliana mRNA, partial cds
          Length = 748

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 476 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 430



to top

>dbj|AK119661.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B01, full
           insert sequence
          Length = 1067

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 249 tgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtg 303
           |||||| ||||||||| || |||||||||||  | |||| ||| |||||||||||
Sbjct: 821 tgctccggaaggagcccagcgccttgatggctgccgcccggaggatgtactggtg 767



 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgacg 391
           ||||||||||||| || || ||||| ||||| | || |||||||||||||
Sbjct: 728 cccagaagatccagtggtcgtcccatgccttcttctggttgtagatgacg 679



to top

>gb|DQ341104.1| Rhododendron catawbiense aquaporin PIP2-1 mRNA, complete cds
          Length = 1192

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 338 ccgacccagaagatccactgatcatcccaggcctt 372
           |||||||| || ||||| |||||||||||||||||
Sbjct: 816 ccgacccaaaatatccattgatcatcccaggcctt 782



to top

>gb|U78297.1|ATU78297 Arabidopsis thaliana plasma membrane intrinsic protein PIP3 mRNA,
           complete cds
          Length = 1046

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||| |||||||| || |||||||| ||||| || |||||||||||
Sbjct: 784 acccaaaagatccattggtcatcccacgccttctcgttgttgtagat 738



to top

>gb|AF366565.1| Triticum aestivum aquaporin PIP2 (Pip2) mRNA, complete cds
          Length = 1071

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 335 gggccgacccagaagatccactgatcatcccaggccttg 373
           ||||| ||||||||||||||||| || ||||| ||||||
Sbjct: 777 gggccaacccagaagatccactggtcgtcccaagccttg 739



to top

>gb|DQ235182.1| Solanum tuberosum clone 163E01 major intrinsic protein 2-like mRNA,
           complete cds
          Length = 1277

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 338 ccgacccagaagatccactgatcatcccaggccttgtc 375
           ||||||||||| ||||| || |||||||| ||||||||
Sbjct: 828 ccgacccagaaaatccagtgttcatcccacgccttgtc 791



to top

>gb|DQ202709.1| Olea europaea plasma membrane intrinsic protein (pip2) mRNA,
           complete cds
          Length = 1260

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
           ||||| || ||||| || |||||||||| |||||| | ||||||||||||
Sbjct: 843 acccaaaaaatccaatggtcatcccagggcttgtcttcgttgtagatgac 794



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 269 gccttgatggcgccggccctgagtatgtactggtggtaga 308
           ||||||||||| || ||||| || ||||| ||||||||||
Sbjct: 915 gccttgatggctcctgcccttaggatgtattggtggtaga 876



to top

>gb|AY189973.1| Juglans regia plasma intrinsic protein 2,1 mRNA, complete cds
          Length = 1278

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
           |||||||| ||||| || |||| ||| ||||||||||||  |||||||||
Sbjct: 838 acccagaaaatccattggtcattccatgccttgtccttgccgtagatgac 789



to top

>emb|AJ005869.1|CAR005869 Cicer arietinum mRNA for putative transmembrane channel protein,
           partial
          Length = 634

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 341 acccagaagatccactgatcatccca 366
           |||||||||||||| |||||||||||
Sbjct: 269 acccagaagatccaatgatcatccca 244



to top

>gb|AF367460.1| Prunus persica clone Mip3 membrane intrinsic protein (mip3) mRNA,
           partial cds
          Length = 495

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 362 tcccaggccttgtccttgttgtagat 387
           |||||||||||||| |||||||||||
Sbjct: 485 tcccaggccttgtcattgttgtagat 460



to top

>gb|U22658.1|BMU22658 Bufo marinus urinary bladder aquaporin mRNA, complete cds
          Length = 819

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 326 ccgatcatggggccgacccagaagatccactgat 359
           |||||||| || ||||||||||||||||| ||||
Sbjct: 662 ccgatcatcggaccgacccagaagatccagtgat 629



to top

>gb|AF386739.1|AF386739 Medicago truncatula aquaporin protein PIP1;1 (PIP1;1) mRNA,
           complete cds
          Length = 1244

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 341 acccagaagatccactgatcatccca 366
           |||||||||||||| |||||||||||
Sbjct: 845 acccagaagatccagtgatcatccca 820



to top

>gb|AY714381.1| Aegiceras corniculatum aquaporin 2 mRNA, partial cds
          Length = 740

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagat 387
           ||||||| ||||||||||||||||| | ||| |  |||||||||||
Sbjct: 481 cccagaaaatccactgatcatcccatgtcttttttttgttgtagat 436



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 260 gagccgagggccttgatggcgccggccctgagtatgtactggtggtagaaggccgc 315
           |||||||| ||||| || || || || | ||| ||| |||||||||||||||||||
Sbjct: 563 gagccgagagccttaatcgcccctgctcggaggatgaactggtggtagaaggccgc 508



to top

>emb|AJ605575.1| Ricinus communis mRNA for aquaporin (Pip2-1 gene), clone pP5L
          Length = 1157

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
           |||||||| ||||| || ||||||||  | ||||| ||||||||||||||
Sbjct: 819 acccagaaaatccaatggtcatcccacactttgtcattgttgtagatgac 770



to top

>emb|AJ605568.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-3 gene),
           clone pR450-4
          Length = 452

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 359 tcatcccaggccttgtccttgttgta 384
           ||||||||||||||||||| ||||||
Sbjct: 428 tcatcccaggccttgtcctggttgta 403



to top

>gb|AY107589.1| Zea mays PCO085320 mRNA sequence
          Length = 569

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 335 gggccgacccagaagatccactgatcatcccaggcctt 372
           |||||||||||||| ||||| ||||| ||||| |||||
Sbjct: 194 gggccgacccagaatatccagtgatcctcccacgcctt 157



to top

>gb|U62280.1|NTU62280 Nicotiana tabacum aquaporin (NT2) mRNA, complete cds
          Length = 1049

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 341 acccagaagatccactgatcatccca 366
           |||||||||||||| |||||||||||
Sbjct: 797 acccagaagatccagtgatcatccca 772



to top

>ref|NM_130159.2| Arabidopsis thaliana PIP1B; water channel AT2G45960 (PIP1B) mRNA,
           complete cds
          Length = 1259

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 918 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 870



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 312     ccgcgatcgccgcgccgatcatggg 336
               ||||||||||||||||||| |||||
Sbjct: 2960721 ccgcgatcgccgcgccgatgatggg 2960697



to top

>gb|AY663794.1| Fraxinus excelsior plasma membrane intrinsic protein PIP1-1 mRNA,
           complete cds
          Length = 1174

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||| ||||| || | ||| |||||||||||||
Sbjct: 801 acccagaatatccaatgatcgtcccatgcgtggtctttgttgtagatga 753



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 312   ccgcgatcgccgcgccgatcatggg 336
             ||||||||||||||||||| |||||
Sbjct: 88152 ccgcgatcgccgcgccgatgatggg 88128



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 310     ggccgcgatcgccgcgccgatcatg 334
               |||||||||||| ||||||||||||
Sbjct: 2316707 ggccgcgatcgcggcgccgatcatg 2316731



to top

>emb|Z17424.1|ATORFA Arabidopsis thaliana mRNA for PIP1b protein
          Length = 1064

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 838 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 790



to top

>emb|X95639.1|BOMIPATCP B.oleracea mRNA for transmembrane channel protein (mipA)
          Length = 1104

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgtt 381
           |||||||||| ||| || |||||||| || |||||||||||
Sbjct: 816 acccagaagacccaatggtcatcccaagcgttgtccttgtt 776



to top

>gb|AY091254.1| Arabidopsis thaliana putative aquaporin protein (At2g45960) mRNA,
           complete cds
          Length = 892

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 779 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 731



to top

>emb|X68293.1|ATRNATPR A.thaliana mRNA for transmembrane protein A
          Length = 1105

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 833 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 785



to top

>gb|AY063931.1| Arabidopsis thaliana putative aquaporin, plasma membrane intrinsic
           protein 1B (At2g45960) mRNA, complete cds
          Length = 1077

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 839 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 791



to top

>ref|NM_001005829.1| Xenopus tropicalis aquaporin 1 (channel-forming integral protein,
           28kDa) (aqp1), mRNA
          Length = 950

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 326 ccgatcatggggccgacccagaagatcca 354
           ||||||||||| |||||||| ||||||||
Sbjct: 704 ccgatcatgggtccgacccaaaagatcca 676



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 312     ccgcgatcgccgcgccgatcatggg 336
               ||||||||||||||||||| |||||
Sbjct: 3933700 ccgcgatcgccgcgccgatgatggg 3933676



to top

>emb|AJ849324.1| Populus tremula x Populus tremuloides mRNA for putative plasma
           membrane intrinsic protein (pip2.1 gene)
          Length = 1295

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 341 acccagaagatccactgatcatcccaggc 369
           |||||||| ||||| ||||||||||||||
Sbjct: 780 acccagaaaatccaatgatcatcccaggc 752



to top

>gb|AC005770.3| Arabidopsis thaliana chromosome 2 clone T7F6 map CIC10A06, complete
             sequence
          Length = 96827

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 355   ctgatcatcccaggccttgtccttgttgtagatgacg 391
             |||||||||||| ||||| |  |||||||||||||||
Sbjct: 65646 ctgatcatcccaagccttttgattgttgtagatgacg 65610



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   ccgacccagaagatccactg 357
             ||||||||||||||||||||
Sbjct: 65741 ccgacccagaagatccactg 65722



to top

>gb|AY049238.1| Arabidopsis thaliana clone RAFL08-10-H13(R13205), mRNA sequence
          Length = 1913

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 839 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 791



to top

>gb|AY671950.1| Aegiceras corniculatum aquaporin 2 (PIP2) mRNA, complete cds
          Length = 855

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 342 cccagaagatccactgatcatccca 366
           ||||||| |||||||||||||||||
Sbjct: 754 cccagaaaatccactgatcatccca 730



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 260 gagccgagggccttgatggcgccggccctgagtatgtactggtggtagaaggccgc 315
           |||||||| ||||| || || || || | ||| ||| |||||||||||||||||||
Sbjct: 836 gagccgagagccttaatcgcccctgctcggaggatgaactggtggtagaaggccgc 781



to top

>gb|AF299051.1|AF299051 Brassica oleracea aquaporin PIP1b2 mRNA, complete cds
          Length = 1101

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 798 acccaaaagacccaatggtcatcccaagcgttgtccttgttgaagatga 750



to top

>emb|BX820173.1|CNS0A8G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS86ZH06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1084

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 819 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 771



to top

>emb|BX819664.1|CNS0A8JV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS13ZG09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 679

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 452 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 404



to top

>emb|BX820969.1|CNS0A7WJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1036

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 824 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 776



to top

>emb|BX819791.1|CNS0A7WA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS2ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1060

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 811 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 763



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 311     gccgcgatcgccgcgccgatc 331
               |||||||||||||||||||||
Sbjct: 1116192 gccgcgatcgccgcgccgatc 1116212



to top

>gb|AF154641.1| Nicotiana tabacum clone PR16 mRNA sequence
          Length = 1100

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 ttgctcctgaaggagccgagggccttgatggcgccggccctgagtatgtactggtggtag 307
           |||||||||||||| || || || |||||||| || || | ||| ||| |||||||||||
Sbjct: 900 ttgctcctgaaggaaccaagagctttgatggcaccagcacggaggatgaactggtggtag 841

            
Query: 308 a 308
           |
Sbjct: 840 a 840



to top

>gb|AY084470.1| Arabidopsis thaliana clone 108944 mRNA, complete sequence
          Length = 1193

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 915 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 867



to top

>gb|AY048294.1| Arabidopsis thaliana At2g45960/F4I18.6 mRNA, complete cds
          Length = 1052

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           ||||| |||| ||| || |||||||| || |||||||||||| ||||||
Sbjct: 839 acccaaaagacccagtggtcatcccaagcgttgtccttgttgaagatga 791



to top

>gb|AY547266.2| Ipomoea nil aquaporin-like protein (AQP1) mRNA, complete cds
          Length = 1189

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||||||||| ||||||| ||| || |  || |||||||||||||
Sbjct: 867 acccagaagatccaatgatcattccatgcgtgttcattgttgtagatga 819



to top

>emb|AJ605569.1| Ricinus communis partial mRNA for putative aquaporin (Pip2-1 gene),
           clone pR450-8
          Length = 452

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 342 cccagaagatccactgatcatcccaggccttgtccttgttgtagatgac 390
           ||||| ||||||| || ||||||||  | ||||| ||||||||||||||
Sbjct: 445 cccagtagatccaatggtcatcccacactttgtcattgttgtagatgac 397



to top

>dbj|AB100869.1| Malus x domestica MdPIP1a mRNA for plasma membrane intrinsic
           protein, complete cds
          Length = 1260

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| || ||||||||||| |  | ||||||||||||||
Sbjct: 878 acccagaatatccagtggtcatcccaggcatgcttcttgttgtagatga 830



to top

>gb|BC075384.1| Xenopus tropicalis aquaporin 1 (channel-forming integral protein,
           28kDa), mRNA (cDNA clone MGC:89110 IMAGE:7006583),
           complete cds
          Length = 950

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 326 ccgatcatggggccgacccagaagatcca 354
           ||||||||||| |||||||| ||||||||
Sbjct: 704 ccgatcatgggtccgacccaaaagatcca 676



to top

>gb|BC084131.1| Xenopus laevis hypothetical LOC495037, mRNA (cDNA clone MGC:86220
           IMAGE:6958087), complete cds
          Length = 1283

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 326 ccgatcatggggccgacccagaagatcca 354
           ||||||||||| || ||||||||||||||
Sbjct: 810 ccgatcatgggtccaacccagaagatcca 782



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 312     ccgcgatcgccgcgccgatcatggg 336
               ||||||||||||||||||| |||||
Sbjct: 3637218 ccgcgatcgccgcgccgatgatggg 3637194



to top

>gb|AF067185.1|AF067185 Samanea saman aquaporin 2 (Aqp2) mRNA, complete cds
          Length = 1201

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 341 acccagaagatccactgatcatcccaggc 369
           |||||||||||||| || |||||||||||
Sbjct: 814 acccagaagatccaatggtcatcccaggc 786



to top

>gb|U87981.1|SBU87981 Sorghum bicolor membrane intrinsic protein (Mip1) mRNA, partial cds
          Length = 539

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 334 ggggccgacccagaagatcca 354
           |||||||||||||||||||||
Sbjct: 280 ggggccgacccagaagatcca 260



to top

>gb|U26537.1|MCU26537 Mesembryanthemum crystallinum major intrinsic protein homolog
           (mipD) mRNA, complete cds
          Length = 1135

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| || |||||||| || | | |||||||||||||||
Sbjct: 840 acccagaaaatccaatggtcatcccatgcatgggccttgttgtagatga 792



to top

>gb|L36097.1|CIPMIPB Mesembryanthemum crystallinum aquaporin (mipB) mRNA, complete cds
          Length = 1217

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgtagatga 389
           |||||||| ||||| ||||||||||| || | | |||||||| ||||||
Sbjct: 805 acccagaaaatccagtgatcatcccaagcgtggcccttgttgaagatga 757



to top

>ref|NM_197034.1| Oryza sativa (japonica cultivar-group) putative aquaporin
           (OSJNBa0093B11.9), mRNA
          Length = 729

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 341 acccagaagatccactgatc 360
           ||||||||||||||||||||
Sbjct: 626 acccagaagatccactgatc 607



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 310     ggccgcgatcgccgcgccga 329
               ||||||||||||||||||||
Sbjct: 1911596 ggccgcgatcgccgcgccga 1911615



to top

>gb|AY494191.1| Physcomitrella patens plasma membrane aquaporin (PIP2;1) gene,
            complete cds
          Length = 1486

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 338  ccgacccagaagatccactg 357
            ||||||||||||||||||||
Sbjct: 1380 ccgacccagaagatccactg 1361



to top

>gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, complete sequence
          Length = 1471779

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 310    ggccgcgatcgccgcgccga 329
              ||||||||||||||||||||
Sbjct: 748148 ggccgcgatcgccgcgccga 748129



to top

>emb|AL606687.3|OSJN00087 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K11,
             complete sequence
          Length = 147806

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 334   ggggccgacccagaagatccactg 357
             |||||| |||||||||||||||||
Sbjct: 28605 ggggccaacccagaagatccactg 28582



to top

>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59
          Length = 199199

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   ccgacccagaagatccactg 357
             ||||||||||||||||||||
Sbjct: 75658 ccgacccagaagatccactg 75639



to top

>emb|AL138650.1|ATT5N23 Arabidopsis thaliana DNA chromosome 3, BAC clone T5N23
          Length = 90335

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 362   tcccaggccttgtccttgttgtagatga 389
             ||||| || |||||||||||||||||||
Sbjct: 77345 tcccaagctttgtccttgttgtagatga 77318



to top

>emb|AL049655.2|ATF28P10 Arabidopsis thaliana DNA chromosome 3, BAC clone F28P10
          Length = 90736

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 362   tcccaggccttgtccttgttgtagatga 389
             ||||| || |||||||||||||||||||
Sbjct: 83757 tcccaagctttgtccttgttgtagatga 83784



to top

>emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, BAC clone F16G20 (ESSAII
             project)
          Length = 97006

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   ccgacccagaagatccactg 357
             ||||||||||||||||||||
Sbjct: 34126 ccgacccagaagatccactg 34107



to top

>emb|AL596209.13| Mouse DNA sequence from clone RP23-278F12 on chromosome 11 Contains the
             3' end of the Ulk2 gene for Unc-51 like kinase 2 (C.
             elegans), the Prpsap2 gene for phosphoribosyl
             pyrophosphate synthetase-associated protein 2, the gene
             for a novel sodium/glucose cotransporter protein, the gene
             for a novel protein (2310040C09Rik), the Grap gene for
             GRB2-related adaptor protein and a CpG island, complete
             sequence
          Length = 186359

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 166   tttctctttggatggatgga 185
             ||||||||||||||||||||
Sbjct: 79799 tttctctttggatggatgga 79818



to top

>gb|AC083943.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0044A10, from chromosome 10, complete sequence
          Length = 169270

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 306   agaaggccgcgatcgccgcg 325
             ||||||||||||||||||||
Sbjct: 92267 agaaggccgcgatcgccgcg 92286



to top

>gb|AF452013.1|AF452013 Petunia x hybrida aquaporin-like protein (PIP2;2) mRNA, complete
           cds
          Length = 1165

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 341 acccagaagatccactgatcatcccaggccttgtccttgttgta 384
           |||||||| ||||| || ||||||||||| ||||| | ||||||
Sbjct: 827 acccagaaaatccattggtcatcccaggctttgtcttggttgta 784



to top

>gb|AY059380.1| Medicago truncatula aquaporin (PIP2-1) mRNA, complete cds
          Length = 973

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 atccactgatcatcccaggc 369
           ||||||||||||||||||||
Sbjct: 775 atccactgatcatcccaggc 756



to top

>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA,
           partial cds
          Length = 411

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 359 tcatcccaggccttgtccttgttgtagatgac 390
           |||| ||||||| |||| ||||||||||||||
Sbjct: 407 tcattccaggccctgtctttgttgtagatgac 376



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 306      agaaggccgcgatcgccgcg 325
                ||||||||||||||||||||
Sbjct: 13136748 agaaggccgcgatcgccgcg 13136767



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 310     ggccgcgatcgccgcgccga 329
               ||||||||||||||||||||
Sbjct: 5135849 ggccgcgatcgccgcgccga 5135868



to top

>dbj|AK106746.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-C02, full
           insert sequence
          Length = 1232

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 341 acccagaagatccactgatc 360
           ||||||||||||||||||||
Sbjct: 808 acccagaagatccactgatc 789



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 322     cgcgccgatcatggggccga 341
               ||||||||||||||||||||
Sbjct: 1377402 cgcgccgatcatggggccga 1377383



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 306      agaaggccgcgatcgccgcg 325
                ||||||||||||||||||||
Sbjct: 13144088 agaaggccgcgatcgccgcg 13144107



to top

>gb|U27347.1|GMU27347 Glycine max putative water channel protein (Pip1) mRNA, complete
           cds
          Length = 1255

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 341 acccagaagatccactgatcatcccaggcctt 372
           ||||| |||||||| || ||||||||||||||
Sbjct: 848 acccaaaagatccaatggtcatcccaggcctt 817


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,257,192
Number of Sequences: 3902068
Number of extensions: 3257192
Number of successful extensions: 55885
Number of sequences better than 10.0: 228
Number of HSP's better than 10.0 without gapping: 229
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54685
Number of HSP's gapped (non-prelim): 1187
length of query: 391
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 369
effective length of database: 17,147,199,772
effective search space: 6327316715868
effective search space used: 6327316715868
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top