Clone Name | rbart58b09 |
---|---|
Clone Library Name | barley_pub |
>gb|AC064814.10| Homo sapiens BAC clone CTD-2100B3 from 2, complete sequence Length = 134167 Score = 44.1 bits (22), Expect = 0.17 Identities = 25/26 (96%) Strand = Plus / Plus Query: 181 acttttaaaccagtcctccaaaagaa 206 |||||||||||||||| ||||||||| Sbjct: 19853 acttttaaaccagtcccccaaaagaa 19878
>gb|AC122864.3| Mus musculus BAC clone RP23-142M19 from 6, complete sequence Length = 210148 Score = 42.1 bits (21), Expect = 0.68 Identities = 21/21 (100%) Strand = Plus / Minus Query: 66 tttgccttgctacaaagtctc 86 ||||||||||||||||||||| Sbjct: 27299 tttgccttgctacaaagtctc 27279
>emb|BX322533.5| Mouse DNA sequence from clone RP23-252N4 on chromosome X, complete sequence Length = 105412 Score = 42.1 bits (21), Expect = 0.68 Identities = 21/21 (100%) Strand = Plus / Minus Query: 117 attatttctgaaacagaattg 137 ||||||||||||||||||||| Sbjct: 3963 attatttctgaaacagaattg 3943
>gb|AC127244.3| Mus musculus BAC clone RP24-416M6 from 6, complete sequence Length = 165720 Score = 42.1 bits (21), Expect = 0.68 Identities = 21/21 (100%) Strand = Plus / Minus Query: 66 tttgccttgctacaaagtctc 86 ||||||||||||||||||||| Sbjct: 105740 tttgccttgctacaaagtctc 105720
>dbj|BA000021.3| Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis DNA, complete genome Length = 697724 Score = 42.1 bits (21), Expect = 0.68 Identities = 21/21 (100%) Strand = Plus / Plus Query: 116 aattatttctgaaacagaatt 136 ||||||||||||||||||||| Sbjct: 19341 aattatttctgaaacagaatt 19361
>gb|AC117570.11| Mus musculus chromosome 9, clone RP23-18M12, complete sequence Length = 238598 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 106 tggattcctcaattatttct 125 |||||||||||||||||||| Sbjct: 37646 tggattcctcaattatttct 37665
>ref|XM_425887.1| PREDICTED: Gallus gallus similar to transcription elongation factor B polypeptide 3 binding protein 1; elongin A binding protein 1 (LOC428327), mRNA Length = 3186 Score = 40.1 bits (20), Expect = 2.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 108 gattcctcaattatttctgaaaca 131 ||||||||| |||||||||||||| Sbjct: 463 gattcctcacttatttctgaaaca 486
>emb|AL669931.9| Mouse DNA sequence from clone RP23-31D18 on chromosome 11 Contains the Stc2 gene for stanniocalcin 2 and three CpG islands, complete sequence Length = 252980 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 ctctgcaacacaaggcggtt 67 |||||||||||||||||||| Sbjct: 33662 ctctgcaacacaaggcggtt 33681
>gb|AC011328.11| Homo sapiens chromosome 10 clone RP11-295O23, complete sequence Length = 216031 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 163 taacactcagaagttgggac 182 |||||||||||||||||||| Sbjct: 134795 taacactcagaagttgggac 134814
>gb|AC151769.3| Mus musculus BAC clone RP24-375O19 from chromosome 9, complete sequence Length = 186410 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 106 tggattcctcaattatttct 125 |||||||||||||||||||| Sbjct: 70575 tggattcctcaattatttct 70556
>emb|BX935818.2| Gallus gallus finished cDNA, clone ChEST165b17 Length = 1288 Score = 40.1 bits (20), Expect = 2.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 108 gattcctcaattatttctgaaaca 131 ||||||||| |||||||||||||| Sbjct: 433 gattcctcacttatttctgaaaca 456
>emb|AL732467.8| Mouse DNA sequence from clone RP23-147L14 on chromosome 2, complete sequence Length = 229048 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 171 agaagttgggacttttaaac 190 |||||||||||||||||||| Sbjct: 111711 agaagttgggacttttaaac 111692
>gb|AC145916.3| Gallus gallus BAC clone CH261-82F15 from chromosome unknown, complete sequence Length = 209299 Score = 40.1 bits (20), Expect = 2.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 109 attcctcaattatttctgaa 128 |||||||||||||||||||| Sbjct: 14094 attcctcaattatttctgaa 14113 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,951,961 Number of Sequences: 3902068 Number of extensions: 1951961 Number of successful extensions: 128606 Number of sequences better than 10.0: 13 Number of HSP's better than 10.0 without gapping: 13 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 128559 Number of HSP's gapped (non-prelim): 47 length of query: 211 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 189 effective length of database: 17,147,199,772 effective search space: 3240820756908 effective search space used: 3240820756908 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)