>emb|AL117340.3|HSBA192P3 Human DNA sequence from clone RP11-192P3 on chromosome 10 Contains a
              novel gene, the 5' end of the TCF8 gene for transcription
              factor 8 (represses interleukin 2 expression)
              (BZP,ZEB,ZEB1,AREB6,ZFHEP,NIL-2A,ZFHX1A,NIL-2-A), a
              pseudogene similar to part of serine palmitoyltransferase,
              long chain base subunit 1 (SPTLC1) (HSAN, HSN1, LBC1, LCB1,
              SPT1, SPTI) and two CpG islands, complete sequence
          Length = 187517

 Score = 46.1 bits (23), Expect = 0.067
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 166    cacacacagtttaccctgaattc 188
              |||||||||||||||||||||||
Sbjct: 184855 cacacacagtttaccctgaattc 184833

>gb|AF225898.1|AF225898 Homo sapiens BAC clone 13d21, complete sequence
          Length = 198084

 Score = 46.1 bits (23), Expect = 0.067
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 166   cacacacagtttaccctgaattc 188
             |||||||||||||||||||||||
Sbjct: 67269 cacacacagtttaccctgaattc 67247

>gb|CP000254.1| Methanospirillum hungatei JF-1, complete genome
          Length = 3544738

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 280     gcatggatgatcagaagagat 300
               |||||||||||||||||||||
Sbjct: 1664674 gcatggatgatcagaagagat 1664654

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 256     ttctcaatctctcatggcgat 276
               |||||||||||||||||||||
Sbjct: 3810439 ttctcaatctctcatggcgat 3810419

>dbj|AP003215.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0089K24
          Length = 154137

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 256   ttctcaatctctcatggcgat 276
             |||||||||||||||||||||
Sbjct: 83981 ttctcaatctctcatggcgat 83961

>gb|AC168309.2| Mus musculus chromosome 1, clone wi1-2866I16, complete sequence
          Length = 40737

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 231  gatgacacgatgacacttgcttgatttc 258
            ||||||| ||||||| ||||||||||||
Sbjct: 2691 gatgacatgatgacaattgcttgatttc 2664

>gb|AC145376.3| Pan troglodytes BAC clone RP43-59A12 from 7, complete sequence
          Length = 221727

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 231    gatgacacgatgacacttgc 250
              ||||||||||||||||||||
Sbjct: 108005 gatgacacgatgacacttgc 107986

>gb|AC102374.7| Mus musculus chromosome 1, clone RP23-278G2, complete sequence
          Length = 170448

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 231   gatgacacgatgacacttgcttgatttc 258
             ||||||| ||||||| ||||||||||||
Sbjct: 25899 gatgacatgatgacaattgcttgatttc 25926

>ref|XM_386515.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG06339.1)
           partial mRNA
          Length = 1497

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 280 gcatggatgatcagaagaga 299
           ||||||||||||||||||||
Sbjct: 773 gcatggatgatcagaagaga 792

>emb|AL355472.19| Human DNA sequence from clone RP5-827C21 on chromosome 1 Contains a
             ribosomal protein S15 (RPS15) pseudogene, three novel
             genes (LOC388753), the 3' end of the TARBP1 gene for TAR
             (HIV) RNA binding protein 1 and a CpG island, complete
             sequence
          Length = 92628

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 142   acaagagattattcctgactgact 165
             ||||||| ||||||||||||||||
Sbjct: 68131 acaagagcttattcctgactgact 68108

>gb|AC090498.4| Homo sapiens chromosome 7 clone RP11-84E17, complete sequence
          Length = 188036

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 231   gatgacacgatgacacttgc 250
             ||||||||||||||||||||
Sbjct: 67930 gatgacacgatgacacttgc 67911

>gb|AC083905.20| Homo sapiens 3 BAC RP11-124N24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 109471

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   actgatgacacgatgacact 247
             ||||||||||||||||||||
Sbjct: 67496 actgatgacacgatgacact 67515

>emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces
               hansenii
          Length = 2037969

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 282     atggatgatcagaagagatt 301
               ||||||||||||||||||||
Sbjct: 1044394 atggatgatcagaagagatt 1044413

>emb|AL954726.31| Zebrafish DNA sequence from clone CH211-274A9 in linkage group 23,
              complete sequence
          Length = 164507

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 79     tttgtacaaacattaatctt 98
              ||||||||||||||||||||
Sbjct: 115044 tttgtacaaacattaatctt 115063

>emb|AL669825.10| Mouse DNA sequence from clone RP23-327K3 on chromosome 11 Contains a
              cyclic AMP phosphoprotein (Arpp19) pseudogene, a heat shock
              protein (Hsp) pseudogene and a ribosomal protein S6 (Rps6)
              pseudogene, complete sequence
          Length = 199649

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 179    ccctgaattcctcaaagaca 198
              ||||||||||||||||||||
Sbjct: 175286 ccctgaattcctcaaagaca 175267

>gb|AC160030.4| Mus musculus 10 BAC RP24-311K18 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 162351

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    attgctaggacagacagcag 77
             ||||||||||||||||||||
Sbjct: 21479 attgctaggacagacagcag 21460

>gb|AC009999.2|T20M3 Sequence of BAC T20M3 from Arabidopsis thaliana chromosome 1,
            complete sequence
          Length = 79554

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 82   gtacaaacattaatcttgac 101
            ||||||||||||||||||||
Sbjct: 5058 gtacaaacattaatcttgac 5039


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,985,662
Number of Sequences: 3902068
Number of extensions: 2985662
Number of successful extensions: 51302
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51238
Number of HSP's gapped (non-prelim): 64
length of query: 312
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 290
effective length of database: 17,147,199,772
effective search space: 4972687933880
effective search space used: 4972687933880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)