ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart58a07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|Z98877.1|CEY69H2 Caenorhabditis elegans YAC Y69H2, complete ... 40 1.1
2ref|NM_102537.2| Arabidopsis thaliana transcription initiation f... 38 4.4
3gb|AY457043.1| Arabidopsis thaliana TATA-binding protein associa... 38 4.4
4gb|AC114827.4| Mus musculus BAC clone RP24-447F21 from 13, compl... 38 4.4
5gb|AC093889.2| Homo sapiens BAC clone RP11-671G14 from 7, comple... 38 4.4
6gb|AC107841.16| Mus musculus chromosome 1, clone RP23-293C19, co... 38 4.4
7gb|AC139355.8| Medicago truncatula clone mth2-36o3, complete seq... 38 4.4
8gb|AC095059.3| Homo sapiens BAC clone RP11-428L21 from 4, comple... 38 4.4
9gb|AC008774.7| Homo sapiens chromosome 5 clone CTD-2018M7, compl... 38 4.4
10gb|AC034245.5| Homo sapiens chromosome 5 clone RP11-155L15, comp... 38 4.4
11gb|AC024259.17| Homo sapiens chromosome 7 clone RP11-105B19, com... 38 4.4
12gb|AC016638.9| Homo sapiens chromosome 5 clone RP11-365H8, compl... 38 4.4
13gb|AC157494.2| Mus musculus BAC clone RP23-2F1 from chromosome 1... 38 4.4
14gb|AC012375.3|AC012375 Genomic sequence for Arabidopsis thaliana... 38 4.4
15emb|CT025577.11| Mouse DNA sequence from clone RP24-172I18 on ch... 38 4.4
16emb|AL645470.20| Mouse DNA sequence from clone RP23-392H19 on ch... 38 4.4
17emb|AL606962.22| Mouse DNA sequence from clone RP23-29H22 on chr... 38 4.4
18gb|AC167975.3| Mus musculus BAC clone RP23-171A14 from chromosom... 38 4.4

>emb|Z98877.1|CEY69H2 Caenorhabditis elegans YAC Y69H2, complete sequence
          Length = 89004

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    ttaacaagtcatatcttggc 46
             ||||||||||||||||||||
Sbjct: 36988 ttaacaagtcatatcttggc 36969



 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    ttaacaagtcatatcttggc 46
             ||||||||||||||||||||
Sbjct: 28716 ttaacaagtcatatcttggc 28697



to top

>ref|NM_102537.2| Arabidopsis thaliana transcription initiation factor AT1G27720
           mRNA, complete cds
          Length = 2049

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 79  atatagaggaaaggatgag 97
           |||||||||||||||||||
Sbjct: 846 atatagaggaaaggatgag 828



to top

>gb|AY457043.1| Arabidopsis thaliana TATA-binding protein associated factor 4
           (TAF4) mRNA, partial cds
          Length = 2160

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 79  atatagaggaaaggatgag 97
           |||||||||||||||||||
Sbjct: 921 atatagaggaaaggatgag 903



to top

>gb|AC114827.4| Mus musculus BAC clone RP24-447F21 from 13, complete sequence
          Length = 157432

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 42     ttggcatcacaaacgcaaa 60
              |||||||||||||||||||
Sbjct: 155782 ttggcatcacaaacgcaaa 155800



to top

>gb|AC093889.2| Homo sapiens BAC clone RP11-671G14 from 7, complete sequence
          Length = 198453

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    atgttcaggtacttattaa 30
             |||||||||||||||||||
Sbjct: 60384 atgttcaggtacttattaa 60366



to top

>gb|AC107841.16| Mus musculus chromosome 1, clone RP23-293C19, complete sequence
          Length = 204096

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 24    ttattaacaagtcatatct 42
             |||||||||||||||||||
Sbjct: 40743 ttattaacaagtcatatct 40725



to top

>gb|AC139355.8| Medicago truncatula clone mth2-36o3, complete sequence
          Length = 108135

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 68    gccaaatttatatatagag 86
             |||||||||||||||||||
Sbjct: 46050 gccaaatttatatatagag 46068



to top

>gb|AC095059.3| Homo sapiens BAC clone RP11-428L21 from 4, complete sequence
          Length = 109586

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 15    ttcaggtacttattaacaa 33
             |||||||||||||||||||
Sbjct: 35914 ttcaggtacttattaacaa 35896



to top

>gb|AC008774.7| Homo sapiens chromosome 5 clone CTD-2018M7, complete sequence
          Length = 128781

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 77    atatatagaggaaaggatg 95
             |||||||||||||||||||
Sbjct: 51477 atatatagaggaaaggatg 51459



to top

>gb|AC034245.5| Homo sapiens chromosome 5 clone RP11-155L15, complete sequence
          Length = 158094

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 77     atatatagaggaaaggatg 95
              |||||||||||||||||||
Sbjct: 150414 atatatagaggaaaggatg 150432



to top

>gb|AC024259.17| Homo sapiens chromosome 7 clone RP11-105B19, complete sequence
          Length = 177303

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    atgttcaggtacttattaa 30
             |||||||||||||||||||
Sbjct: 39777 atgttcaggtacttattaa 39795



to top

>gb|AC016638.9| Homo sapiens chromosome 5 clone RP11-365H8, complete sequence
          Length = 182823

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 77    atatatagaggaaaggatg 95
             |||||||||||||||||||
Sbjct: 30134 atatatagaggaaaggatg 30152



to top

>gb|AC157494.2| Mus musculus BAC clone RP23-2F1 from chromosome 12, complete sequence
          Length = 189996

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 5      ccacacaatgttcaggtac 23
              |||||||||||||||||||
Sbjct: 153720 ccacacaatgttcaggtac 153702



to top

>gb|AC012375.3|AC012375 Genomic sequence for Arabidopsis thaliana BAC T22C5 from chromosome I,
             complete sequence
          Length = 106753

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 79    atatagaggaaaggatgag 97
             |||||||||||||||||||
Sbjct: 57578 atatagaggaaaggatgag 57596



to top

>emb|CT025577.11| Mouse DNA sequence from clone RP24-172I18 on chromosome 12, complete
              sequence
          Length = 143997

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 5      ccacacaatgttcaggtac 23
              |||||||||||||||||||
Sbjct: 142391 ccacacaatgttcaggtac 142409



to top

>emb|AL645470.20| Mouse DNA sequence from clone RP23-392H19 on chromosome 11, complete
             sequence
          Length = 198031

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 73    atttatatatagaggaaaggatg 95
             |||||||| ||||||||||||||
Sbjct: 26023 atttatatttagaggaaaggatg 26001



to top

>emb|AL606962.22| Mouse DNA sequence from clone RP23-29H22 on chromosome 4, complete
              sequence
          Length = 223854

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 27     ttaacaagtcatatcttgg 45
              |||||||||||||||||||
Sbjct: 121466 ttaacaagtcatatcttgg 121484



to top

>gb|AC167975.3| Mus musculus BAC clone RP23-171A14 from chromosome 13, complete
             sequence
          Length = 220418

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 42    ttggcatcacaaacgcaaa 60
             |||||||||||||||||||
Sbjct: 78946 ttggcatcacaaacgcaaa 78964


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,066,569
Number of Sequences: 3902068
Number of extensions: 1066569
Number of successful extensions: 69248
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69219
Number of HSP's gapped (non-prelim): 29
length of query: 100
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 79
effective length of database: 17,151,101,840
effective search space: 1354937045360
effective search space used: 1354937045360
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top