ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart57g06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY921641.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR4... 56 5e-05
2emb|BX814348.1|CNS0ABZY Arabidopsis thaliana Full-length cDNA Co... 50 0.003
3ref|NM_202428.1| Arabidopsis thaliana OPR1; 12-oxophytodienoate ... 42 0.69
4ref|NM_106318.3| Arabidopsis thaliana OPR1; 12-oxophytodienoate ... 42 0.69
5gb|BT020365.1| Arabidopsis thaliana At1g76680 gene, complete cds 42 0.69
6emb|Y10617.1|AT12OXOPR A.thaliana mRNA for 12-oxo-phytodienoate ... 42 0.69
7gb|AY074874.1| Arabidopsis thaliana At1g76680/F28O16_5 mRNA, com... 42 0.69
8emb|BX816218.1|CNS0ABRK Arabidopsis thaliana Full-length cDNA Co... 42 0.69
9emb|BX841572.1|CNS09YFC Arabidopsis thaliana Full-length cDNA Co... 42 0.69
10gb|AC010718.5|AC010718 Arabidopsis thaliana chromosome 1 BAC F28... 42 0.69
11gb|AY087801.1| Arabidopsis thaliana clone 38527 mRNA, complete s... 42 0.69
12gb|U92460.1|ATU92460 Arabidopsis thaliana 12-oxophytodienoate re... 42 0.69
13gb|AC116679.9| Mus musculus chromosome 12, clone RP23-391I19, co... 40 2.7
14gb|AC154731.2| Mus musculus BAC clone RP23-121M22 from chromosom... 40 2.7
15gb|AC154361.2| Mus musculus BAC clone RP23-170I24 from chromosom... 40 2.7
16dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.7
17gb|AC017099.11| Homo sapiens BAC clone RP11-542D13 from 2, compl... 40 2.7
18gb|AC013272.5| Homo sapiens BAC clone RP11-401C13 from 2, comple... 40 2.7
19gb|AC018892.8| Homo sapiens BAC clone RP11-499E14 from 2, comple... 40 2.7
20gb|AC160020.1| Homo sapiens BAC clone RP11-540L21 from 2, comple... 40 2.7
21gb|AC148026.2| Homo sapiens BAC clone RP11-625I24 from 2, comple... 40 2.7
22gb|AC013734.4|AC013734 Homo sapiens BAC clone RP11-557B9 from Y,... 40 2.7
23dbj|AP004573.3| Oryza sativa (japonica cultivar-group) genomic D... 40 2.7
24emb|CT030011.5| Mouse DNA sequence from clone RP23-94G6 on chrom... 40 2.7

>gb|AY921641.1| Zea mays 12-oxo-phytodienoic acid reductase (OPR4) mRNA, complete cds
          Length = 1833

 Score = 56.0 bits (28), Expect = 5e-05
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 147  cgaggaaggggtaatcggtgtatccaacgatggggtccgaggtgtagaaggt 198
            |||| |||||||| || |||||||||| || |||||| ||||||||||||||
Sbjct: 1750 cgagaaaggggtagtctgtgtatccaatgacggggtcggaggtgtagaaggt 1699



to top

>emb|BX814348.1|CNS0ABZY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB69ZE10 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1221

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 144  attcgaggaaggggtaatcggtgtatccaacga 176
            |||||||||| |||||||||||||| |||||||
Sbjct: 1167 attcgaggaaagggtaatcggtgtaaccaacga 1135



to top

>ref|NM_202428.1| Arabidopsis thaliana OPR1; 12-oxophytodienoate reductase AT1G76680
            (OPR1) transcript variant AT1G76680.2 mRNA, complete cds
          Length = 1460

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 144  attcgaggaaggggtaatcggtgta 168
            |||||||||| ||||||||||||||
Sbjct: 1253 attcgaggaaagggtaatcggtgta 1229



to top

>ref|NM_106318.3| Arabidopsis thaliana OPR1; 12-oxophytodienoate reductase AT1G76680
            (OPR1) transcript variant AT1G76680.1 mRNA, complete cds
          Length = 1451

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 144  attcgaggaaggggtaatcggtgta 168
            |||||||||| ||||||||||||||
Sbjct: 1244 attcgaggaaagggtaatcggtgta 1220



to top

>gb|BT020365.1| Arabidopsis thaliana At1g76680 gene, complete cds
          Length = 1119

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 144  attcgaggaaggggtaatcggtgta 168
            |||||||||| ||||||||||||||
Sbjct: 1108 attcgaggaaagggtaatcggtgta 1084



to top

>emb|Y10617.1|AT12OXOPR A.thaliana mRNA for 12-oxo-phytodienoate reductase
          Length = 1311

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 144  attcgaggaaggggtaatcggtgta 168
            |||||||||| ||||||||||||||
Sbjct: 1173 attcgaggaaagggtaatcggtgta 1149



to top

>gb|AY074874.1| Arabidopsis thaliana At1g76680/F28O16_5 mRNA, complete cds
          Length = 1252

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 144  attcgaggaaggggtaatcggtgta 168
            |||||||||| ||||||||||||||
Sbjct: 1178 attcgaggaaagggtaatcggtgta 1154



to top

>emb|BX816218.1|CNS0ABRK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH34ZH11 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1237

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 144  attcgaggaaggggtaatcggtgta 168
            |||||||||| ||||||||||||||
Sbjct: 1162 attcgaggaaagggtaatcggtgta 1138



to top

>emb|BX841572.1|CNS09YFC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH92ZF02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1165

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 144 attcgaggaaggggtaatcggtgta 168
           |||||||||| ||||||||||||||
Sbjct: 61  attcgaggaaagggtaatcggtgta 85



to top

>gb|AC010718.5|AC010718 Arabidopsis thaliana chromosome 1 BAC F28O16 genomic sequence, complete
             sequence
          Length = 87684

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 144   attcgaggaaggggtaatcggtgta 168
             |||||||||| ||||||||||||||
Sbjct: 15032 attcgaggaaagggtaatcggtgta 15008



to top

>gb|AY087801.1| Arabidopsis thaliana clone 38527 mRNA, complete sequence
          Length = 1280

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 144  attcgaggaaggggtaatcggtgta 168
            |||||||||| ||||||||||||||
Sbjct: 1178 attcgaggaaagggtaatcggtgta 1154



to top

>gb|U92460.1|ATU92460 Arabidopsis thaliana 12-oxophytodienoate reductase OPR1 and
            12-oxophytodienoate reductase OPR2 genes, complete cds
          Length = 7079

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 144  attcgaggaaggggtaatcggtgta 168
            |||||||||| ||||||||||||||
Sbjct: 4626 attcgaggaaagggtaatcggtgta 4602



to top

>gb|AC116679.9| Mus musculus chromosome 12, clone RP23-391I19, complete sequence
          Length = 261992

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 32     cctcttttctttttactgaa 51
              ||||||||||||||||||||
Sbjct: 253168 cctcttttctttttactgaa 253187



to top

>gb|AC154731.2| Mus musculus BAC clone RP23-121M22 from chromosome 14, complete
             sequence
          Length = 215346

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 120   aaggaagaatctacatatat 139
             ||||||||||||||||||||
Sbjct: 54911 aaggaagaatctacatatat 54892



to top

>gb|AC154361.2| Mus musculus BAC clone RP23-170I24 from chromosome 14, complete sequence
          Length = 202760

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 120    aaggaagaatctacatatat 139
              ||||||||||||||||||||
Sbjct: 195527 aaggaagaatctacatatat 195508



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 31       acctcttttctttttactga 50
                ||||||||||||||||||||
Sbjct: 20398265 acctcttttctttttactga 20398246



to top

>gb|AC017099.11| Homo sapiens BAC clone RP11-542D13 from 2, complete sequence
          Length = 230426

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     attttttcttataaactgga 28
             ||||||||||||||||||||
Sbjct: 98404 attttttcttataaactgga 98423



to top

>gb|AC013272.5| Homo sapiens BAC clone RP11-401C13 from 2, complete sequence
          Length = 172705

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      attttttcttataaactgga 28
              ||||||||||||||||||||
Sbjct: 112776 attttttcttataaactgga 112757



to top

>gb|AC018892.8| Homo sapiens BAC clone RP11-499E14 from 2, complete sequence
          Length = 191055

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     attttttcttataaactgga 28
             ||||||||||||||||||||
Sbjct: 90137 attttttcttataaactgga 90118



to top

>gb|AC160020.1| Homo sapiens BAC clone RP11-540L21 from 2, complete sequence
          Length = 202084

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     attttttcttataaactgga 28
             ||||||||||||||||||||
Sbjct: 33613 attttttcttataaactgga 33594



to top

>gb|AC148026.2| Homo sapiens BAC clone RP11-625I24 from 2, complete sequence
          Length = 159856

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     attttttcttataaactgga 28
             ||||||||||||||||||||
Sbjct: 60619 attttttcttataaactgga 60600



to top

>gb|AC013734.4|AC013734 Homo sapiens BAC clone RP11-557B9 from Y, complete sequence
          Length = 180019

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     attttttcttataaactgga 28
             ||||||||||||||||||||
Sbjct: 60586 attttttcttataaactgga 60567



to top

>dbj|AP004573.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0678G09
          Length = 139220

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 31     acctcttttctttttactga 50
              ||||||||||||||||||||
Sbjct: 107165 acctcttttctttttactga 107146



to top

>emb|CT030011.5| Mouse DNA sequence from clone RP23-94G6 on chromosome 12, complete
              sequence
          Length = 198572

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 32     cctcttttctttttactgaa 51
              ||||||||||||||||||||
Sbjct: 191881 cctcttttctttttactgaa 191862


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,390,838
Number of Sequences: 3902068
Number of extensions: 2390838
Number of successful extensions: 175741
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 175647
Number of HSP's gapped (non-prelim): 94
length of query: 215
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 193
effective length of database: 17,147,199,772
effective search space: 3309409555996
effective search space used: 3309409555996
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top