>emb|AL929015.3| Mouse DNA sequence from clone RP23-412F11 on chromosome 2, complete
              sequence
          Length = 142296

 Score = 42.1 bits (21), Expect = 0.057
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 10     acacagatgggaaattaagca 30
              |||||||||||||||||||||
Sbjct: 126999 acacagatgggaaattaagca 127019

>gb|AC098936.2| Homo sapiens chromosome 1 clone RP11-576D8, complete sequence
          Length = 151324

 Score = 38.2 bits (19), Expect = 0.90
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 8      acacacagatgggaaattaagca 30
              |||||||||||||||| ||||||
Sbjct: 135709 acacacagatgggaaaataagca 135687

>gb|AC163610.4| Mus musculus BAC clone RP23-59P17 from chromosome 13, complete sequence
          Length = 237111

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 8      acacacagatgggaaatt 25
              ||||||||||||||||||
Sbjct: 169199 acacacagatgggaaatt 169182

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 14      agatgggaaattaagcat 31
               ||||||||||||||||||
Sbjct: 1253199 agatgggaaattaagcat 1253182

>emb|AL034422.24|HS1141E15 Human DNA sequence from clone RP5-1141E15 on chromosome 20q11.23-12
             Contains the 5' end of GHRH gene for growth hormone
             releasing hormone, the MANBAL gene for mannosidase beta A
             lysosomal-like, the 5' end of the SRC gene for v-src avian
             sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog and a
             CpG island, complete sequence
          Length = 113681

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 11    cacagatgggaaattaag 28
             ||||||||||||||||||
Sbjct: 84495 cacagatgggaaattaag 84478

>emb|AL022345.2|HSY738F9 Human DNA sequence from clone XX-Y738F9 on chromosome 10 Contains the
             ZNF37B pseudogene for zinc finger protein 37b (KOX 21), a
             eukaryotic translation initiation factor 3 subunit 6
             interacting protein (EIF3S6IP) pseudogene, the 3' end of
             the ZNF11B gene for zinc finger protein 11b (KOX 2), a
             novel gene (FLJ23327) and two CpG Islands, complete
             sequence
          Length = 146328

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 7     aacacacagatgggaaat 24
             ||||||||||||||||||
Sbjct: 16761 aacacacagatgggaaat 16744

>emb|CR860730.1| Pongo pygmaeus mRNA; cDNA DKFZp459J0627 (from clone DKFZp459J0627)
          Length = 4473

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 7    aacacacagatgggaaat 24
            ||||||||||||||||||
Sbjct: 2197 aacacacagatgggaaat 2214

>gb|AF272983.1|AF272983 Homo sapiens SRC tyrosine kinase gene, exons 1alpha and 1a,
            alternatively spliced
          Length = 4688

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 11   cacagatgggaaattaag 28
            ||||||||||||||||||
Sbjct: 3274 cacagatgggaaattaag 3257

>emb|BX842663.3| Mouse DNA sequence from clone RP23-176P20 on chromosome 2, complete
              sequence
          Length = 195115

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 6      taacacacagatgggaaa 23
              ||||||||||||||||||
Sbjct: 119930 taacacacagatgggaaa 119913

>dbj|AK026980.1| Homo sapiens cDNA: FLJ23327 fis, clone HEP12630, highly similar to
            HSZNF37 Homo sapiens ZNF37A mRNA for zinc finger protein
          Length = 2536

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 7    aacacacagatgggaaat 24
            ||||||||||||||||||
Sbjct: 2064 aacacacagatgggaaat 2081

>gb|AC115289.6| Mus musculus BAC clone RP23-57G16 from 13, complete sequence
          Length = 210109

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                       
Query: 5     gtaacacacagatgggaaattaagca 30
             ||||||||||||||| |||| |||||
Sbjct: 84672 gtaacacacagatggtaaatgaagca 84697

>gb|AC154695.3| Mus musculus BAC clone RP24-341I23 from 13, complete sequence
          Length = 149545

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                        
Query: 5      gtaacacacagatgggaaattaagca 30
              ||||||||||||||| |||| |||||
Sbjct: 148636 gtaacacacagatggtaaatgaagca 148661

>emb|AL844890.6| Mouse DNA sequence from clone RP23-380E2 on chromosome 2, complete
             sequence
          Length = 53045

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 6     taacacacagatgggaaattaa 27
             |||| |||||||||||||||||
Sbjct: 16849 taacccacagatgggaaattaa 16870

>emb|AL772239.8| Mouse DNA sequence from clone RP23-179O4 on chromosome 2, complete
              sequence
          Length = 233097

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 7      aacacacagatgggaaat 24
              ||||||||||||||||||
Sbjct: 222176 aacacacagatgggaaat 222193


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 275,836
Number of Sequences: 3902068
Number of extensions: 275836
Number of successful extensions: 74700
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 74678
Number of HSP's gapped (non-prelim): 22
length of query: 36
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 16
effective length of database: 17,155,003,908
effective search space: 274480062528
effective search space used: 274480062528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)