Clone Name | rbart57d09 |
---|---|
Clone Library Name | barley_pub |
>gb|AF123608.1|AF123608 Triticum aestivum clone CYP73-TA cytochrome P450 mRNA, complete cds Length = 1506 Score = 430 bits (217), Expect = e-117 Identities = 241/249 (96%) Strand = Plus / Minus Query: 220 aagcctcgagtggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgcc 279 |||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||| Sbjct: 1504 aagcctcgagtggcttgcagacaatggtggcgtgcttgaggatctggttggtaaactgcc 1445 Query: 280 ctggcttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttct 339 | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 1444 cgggcttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctggaagttct 1385 Query: 340 gcaccaggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagc 399 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1384 gcaccaggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagc 1325 Query: 400 tccggcggccgacgccgaagggcacgaaccggaagtcgttgccgagggcctcgacggact 459 |||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| || Sbjct: 1324 tccggcggccgacgccgaagggcacgaaccggaaatcgttgccgtgggcctcgacggcct 1265 Query: 460 tctcctcct 468 ||||||||| Sbjct: 1264 tctcctcct 1256
>gb|AY034143.1| Sorghum bicolor cinnamic acid 4-hydroxylase (C4H) mRNA, complete cds Length = 1762 Score = 323 bits (163), Expect = 3e-85 Identities = 226/247 (91%) Strand = Plus / Minus Query: 222 gcctcgagtggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgccct 281 |||||||| |||||||||||||| ||||| ||||| |||||||||||||||||| || Sbjct: 1568 gcctcgaggggcttgcagacgattgtggcatgcttagcgatctggttgctgaactggccg 1509 Query: 282 ggcttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgc 341 |||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 1508 ggcttctccgtggtgtcgatcttgtcctgccccggcggcggcagcagctggaagttctgc 1449 Query: 342 accaggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctc 401 ||||| | || || |||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 1448 accagcctgcccagggtgatgccgatgataggcagcgcgaggatgatcccggggcagctc 1389 Query: 402 cggcggccgacgccgaagggcacgaaccggaagtcgttgccgagggcctcgacggacttc 461 |||||||||||||||||||||||||| ||||||||||||||| | ||||| |||| |||| Sbjct: 1388 cggcggccgacgccgaagggcacgaagcggaagtcgttgccgtgtgcctccacggtcttc 1329 Query: 462 tcctcct 468 ||||||| Sbjct: 1328 tcctcct 1322
>gb|AY104175.1| Zea mays PCO098406 mRNA sequence Length = 1755 Score = 323 bits (163), Expect = 3e-85 Identities = 226/247 (91%) Strand = Plus / Minus Query: 222 gcctcgagtggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgccct 281 |||||||| |||||||| ||||||||||| |||||| |||||||||||||||||| || Sbjct: 1566 gcctcgaggggcttgcaaacgatggtggcatgcttggcgatctggttgctgaactggccg 1507 Query: 282 ggcttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgc 341 |||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||| Sbjct: 1506 ggcttctccgtggtgtcgatcttgtccagccccggcggcggcagcagctggaagttctgc 1447 Query: 342 accaggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctc 401 ||||| || || || |||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 1446 accagccggcccagggtgatgccgatgataggcagcgcgaggatgatcccagggcagctc 1387 Query: 402 cggcggccgacgccgaagggcacgaaccggaagtcgttgccgagggcctcgacggacttc 461 ||||||||||| || ||||||||||| ||||||||||||||| ||||||| ||||||||| Sbjct: 1386 cggcggccgaccccaaagggcacgaatcggaagtcgttgccgtgggcctccacggacttc 1327 Query: 462 tcctcct 468 ||||||| Sbjct: 1326 tcctcct 1320
>gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0006B22, complete sequence Length = 166052 Score = 313 bits (158), Expect = 3e-82 Identities = 218/238 (91%) Strand = Plus / Plus Query: 231 ggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgccctggcttctcg 290 ||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||||| Sbjct: 102219 ggcttgcagacgacggtggcgtgcttgaggatctggttgctgaactggccgggcttctcg 102278 Query: 291 gtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgt 350 |||||||| | ||||||| ||| |||||||||||||| |||||| |||| || ||||| Sbjct: 102279 gtggtgtccaccttgtccatcccgggcggcggcagcaggtcgaagctctggacgaggcgg 102338 Query: 351 ccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccggcggccg 410 ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 102339 ccgagcgtgatcccgatgatgggcagcgcgaggatgatcccggggcagctgcggcggccg 102398 Query: 411 acgccgaagggcacgaaccggaagtcgttgccgagggcctcgacggacttctcctcct 468 ||||||||||||||||| ||||||||||||||| | ||||| |||| ||||||||||| Sbjct: 102399 acgccgaagggcacgaagcggaagtcgttgccgtgcgcctccacggccttctcctcct 102456
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 313 bits (158), Expect = 3e-82 Identities = 218/238 (91%) Strand = Plus / Plus Query: 231 ggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgccctggcttctcg 290 ||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||||| Sbjct: 14766805 ggcttgcagacgacggtggcgtgcttgaggatctggttgctgaactggccgggcttctcg 14766864 Query: 291 gtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgt 350 |||||||| | ||||||| ||| |||||||||||||| |||||| |||| || ||||| Sbjct: 14766865 gtggtgtccaccttgtccatcccgggcggcggcagcaggtcgaagctctggacgaggcgg 14766924 Query: 351 ccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccggcggccg 410 ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 14766925 ccgagcgtgatcccgatgatgggcagcgcgaggatgatcccggggcagctgcggcggccg 14766984 Query: 411 acgccgaagggcacgaaccggaagtcgttgccgagggcctcgacggacttctcctcct 468 ||||||||||||||||| ||||||||||||||| | ||||| |||| ||||||||||| Sbjct: 14766985 acgccgaagggcacgaagcggaagtcgttgccgtgcgcctccacggccttctcctcct 14767042 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 407 gccgacgccgaagggcacgaaccggaagtcg 437 |||| ||||||| |||||||||||||||||| Sbjct: 25344429 gccggcgccgaacggcacgaaccggaagtcg 25344399
>dbj|AK104994.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-H11, full insert sequence Length = 1796 Score = 313 bits (158), Expect = 3e-82 Identities = 218/238 (91%) Strand = Plus / Minus Query: 231 ggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgccctggcttctcg 290 ||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||||| Sbjct: 1569 ggcttgcagacgacggtggcgtgcttgaggatctggttgctgaactggccgggcttctcg 1510 Query: 291 gtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgt 350 |||||||| | ||||||| ||| |||||||||||||| |||||| |||| || ||||| Sbjct: 1509 gtggtgtccaccttgtccatcccgggcggcggcagcaggtcgaagctctggacgaggcgg 1450 Query: 351 ccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccggcggccg 410 ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 1449 ccgagcgtgatcccgatgatgggcagcgcgaggatgatcccggggcagctgcggcggccg 1390 Query: 411 acgccgaagggcacgaaccggaagtcgttgccgagggcctcgacggacttctcctcct 468 ||||||||||||||||| ||||||||||||||| | ||||| |||| ||||||||||| Sbjct: 1389 acgccgaagggcacgaagcggaagtcgttgccgtgcgcctccacggccttctcctcct 1332
>dbj|AK100598.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023107C01, full insert sequence Length = 1838 Score = 313 bits (158), Expect = 3e-82 Identities = 218/238 (91%) Strand = Plus / Minus Query: 231 ggcttgcagacgatggtggcgtgcttgaggatctggttgctgaactgccctggcttctcg 290 ||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||||| Sbjct: 1567 ggcttgcagacgacggtggcgtgcttgaggatctggttgctgaactggccgggcttctcg 1508 Query: 291 gtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgt 350 |||||||| | ||||||| ||| |||||||||||||| |||||| |||| || ||||| Sbjct: 1507 gtggtgtccaccttgtccatcccgggcggcggcagcaggtcgaagctctggacgaggcgg 1448 Query: 351 ccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccggcggccg 410 ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 1447 ccgagcgtgatcccgatgatgggcagcgcgaggatgatcccggggcagctgcggcggccg 1388 Query: 411 acgccgaagggcacgaaccggaagtcgttgccgagggcctcgacggacttctcctcct 468 ||||||||||||||||| ||||||||||||||| | ||||| |||| ||||||||||| Sbjct: 1387 acgccgaagggcacgaagcggaagtcgttgccgtgcgcctccacggccttctcctcct 1330
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 178 bits (90), Expect = 1e-41 Identities = 192/226 (84%) Strand = Plus / Plus Query: 243 atggtggcgtgcttgaggatctggttgctgaactgccctggcttctcggtggtgtcgatc 302 ||||||| |||||| ||||| ||| |||||||||||| ||||||||||||||||| | Sbjct: 34955260 atggtggagtgcttcaggatgtggaggctgaactgcccacccttctcggtggtgtcgacc 34955319 Query: 303 ttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgtccgagcgtgatg 362 |||||| ||| |||||||||||||||||||||||||| || ||||| |||| |||| | Sbjct: 34955320 ctgtccttcccgggcggcggcagcagctcgaagttctggacgaggcggccgatggtgacg 34955379 Query: 363 ccgatgatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggc 422 |||| ||||||||||||||||| ||| |||||||||||||| || ||| ||||| | ||| Sbjct: 34955380 ccgaggatgggcagcgcgaggacgatgccggggcagctccgccgcccggcgccggacggc 34955439 Query: 423 acgaaccggaagtcgttgccgagggcctcgacggacttctcctcct 468 | | ||| ||||||||||||| |||||||||| | ||||||||| Sbjct: 34955440 aggtacctgaagtcgttgccgttggcctcgacgttcctctcctcct 34955485
>dbj|AP003446.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ1529_G03 Length = 100635 Score = 178 bits (90), Expect = 1e-41 Identities = 192/226 (84%) Strand = Plus / Plus Query: 243 atggtggcgtgcttgaggatctggttgctgaactgccctggcttctcggtggtgtcgatc 302 ||||||| |||||| ||||| ||| |||||||||||| ||||||||||||||||| | Sbjct: 84624 atggtggagtgcttcaggatgtggaggctgaactgcccacccttctcggtggtgtcgacc 84683 Query: 303 ttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgtccgagcgtgatg 362 |||||| ||| |||||||||||||||||||||||||| || ||||| |||| |||| | Sbjct: 84684 ctgtccttcccgggcggcggcagcagctcgaagttctggacgaggcggccgatggtgacg 84743 Query: 363 ccgatgatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggc 422 |||| ||||||||||||||||| ||| |||||||||||||| || ||| ||||| | ||| Sbjct: 84744 ccgaggatgggcagcgcgaggacgatgccggggcagctccgccgcccggcgccggacggc 84803 Query: 423 acgaaccggaagtcgttgccgagggcctcgacggacttctcctcct 468 | | ||| ||||||||||||| |||||||||| | ||||||||| Sbjct: 84804 aggtacctgaagtcgttgccgttggcctcgacgttcctctcctcct 84849
>gb|AY616436.1| Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.~~ Length = 1676 Score = 115 bits (58), Expect = 1e-22 Identities = 133/158 (84%) Strand = Plus / Minus Query: 285 ttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcacc 344 ||||| |||||||||||||| || |||||| || ||||||||||| |||||||||||| Sbjct: 1507 ttctctgtggtgtcgatcttcgacttccccggaggaggcagcagctcaaagttctgcacc 1448 Query: 345 aggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccgg 404 |||||||| | ||||||||| | || |||| |||||| ||||||||||||||||||| Sbjct: 1447 aggcgtcccaacgtgatgccaagaataggcaacgcgagaatgatcccggggcagctcctc 1388 Query: 405 cggccgacgccgaagggcacgaaccggaagtcgttgcc 442 | ||| || ||||| |||| | ||| |||||||||||| Sbjct: 1387 ctgccaacaccgaatggcaggtacctgaagtcgttgcc 1350
>ref|XM_465542.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1910 Score = 89.7 bits (45), Expect = 8e-15 Identities = 63/69 (91%) Strand = Plus / Minus Query: 368 gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 427 |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| ||| Sbjct: 1557 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 1498 Query: 428 ccggaagtc 436 || |||||| Sbjct: 1497 cctgaagtc 1489
>ref|XM_465538.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1602 Score = 89.7 bits (45), Expect = 8e-15 Identities = 63/69 (91%) Strand = Plus / Minus Query: 368 gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 427 |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| ||| Sbjct: 1452 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 1393 Query: 428 ccggaagtc 436 || |||||| Sbjct: 1392 cctgaagtc 1384
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 89.7 bits (45), Expect = 8e-15 Identities = 63/69 (91%) Strand = Plus / Minus Query: 368 gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 427 |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| ||| Sbjct: 15836284 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 15836225 Query: 428 ccggaagtc 436 || |||||| Sbjct: 15836224 cctgaagtc 15836216 Score = 89.7 bits (45), Expect = 8e-15 Identities = 63/69 (91%) Strand = Plus / Plus Query: 368 gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 427 |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| ||| Sbjct: 15816982 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 15817041 Query: 428 ccggaagtc 436 || |||||| Sbjct: 15817042 cctgaagtc 15817050
>dbj|AP004850.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1342_D02 Length = 125460 Score = 89.7 bits (45), Expect = 8e-15 Identities = 63/69 (91%) Strand = Plus / Minus Query: 368 gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 427 |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| ||| Sbjct: 94224 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 94165 Query: 428 ccggaagtc 436 || |||||| Sbjct: 94164 cctgaagtc 94156 Score = 89.7 bits (45), Expect = 8e-15 Identities = 63/69 (91%) Strand = Plus / Plus Query: 368 gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 427 |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| ||| Sbjct: 74922 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 74981 Query: 428 ccggaagtc 436 || |||||| Sbjct: 74982 cctgaagtc 74990
>dbj|AK072588.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132G16, full insert sequence Length = 1910 Score = 89.7 bits (45), Expect = 8e-15 Identities = 63/69 (91%) Strand = Plus / Minus Query: 368 gatgggcagcgcgaggatgatcccggggcagctccggcggccgacgccgaagggcacgaa 427 |||||||||||| ||||||||||| |||||||| |||||||| ||||||||||||| ||| Sbjct: 1558 gatgggcagcgccaggatgatccccgggcagctgcggcggcccacgccgaagggcaggaa 1499 Query: 428 ccggaagtc 436 || |||||| Sbjct: 1498 cctgaagtc 1490
>gb|U19922.1|ZEU19922 Zinnia elegans cinnamic acid 4-hydroxylase mRNA, complete cds Length = 1648 Score = 63.9 bits (32), Expect = 4e-07 Identities = 53/60 (88%) Strand = Plus / Minus Query: 302 cttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgtccgagcgtgat 361 ||||||||| || |||||||||| ||||||||| ||||||||||| || |||| |||||| Sbjct: 1453 cttgtcctgtccgggcggcggcaacagctcgaaattctgcaccagccgcccgatcgtgat 1394
>gb|AC132485.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0022D06, complete sequence Length = 142068 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 407 gccgacgccgaagggcacgaaccggaagtcg 437 |||| ||||||| |||||||||||||||||| Sbjct: 79033 gccggcgccgaacggcacgaaccggaagtcg 79003
>gb|AC158158.6| Mus musculus chromosome 1, clone RP23-10D8, complete sequence Length = 193479 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 99 caacaccaaagaaaaattaaacttact 125 |||||||||||||| |||||||||||| Sbjct: 97110 caacaccaaagaaatattaaacttact 97136
>gb|AC110266.15| Mus musculus chromosome 1, clone RP23-319C1, complete sequence Length = 177482 Score = 46.1 bits (23), Expect = 0.10 Identities = 26/27 (96%) Strand = Plus / Plus Query: 99 caacaccaaagaaaaattaaacttact 125 |||||||||||||| |||||||||||| Sbjct: 4472 caacaccaaagaaatattaaacttact 4498
>dbj|AK062293.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-F01, full insert sequence Length = 2395 Score = 46.1 bits (23), Expect = 0.10 Identities = 29/31 (93%) Strand = Plus / Minus Query: 407 gccgacgccgaagggcacgaaccggaagtcg 437 |||| ||||||| |||||||||||||||||| Sbjct: 1435 gccggcgccgaacggcacgaaccggaagtcg 1405
>gb|AY670393.1| Pinus taeda isolate 27 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670388.1| Pinus taeda isolate 28 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670384.1| Pinus taeda isolate 10 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670382.1| Pinus taeda isolate 30 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670380.1| Pinus taeda isolate 25 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670377.1| Pinus taeda isolate 24 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670376.1| Pinus taeda isolate 20 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670375.1| Pinus taeda isolate 15 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670372.1| Pinus taeda isolate 21 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670371.1| Pinus taeda isolate 18 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670370.1| Pinus taeda isolate 12 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670367.1| Pinus taeda isolate 23 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670363.1| Pinus taeda isolate 6 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AY670362.1| Pinus taeda isolate 16 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene, partial cds Length = 522 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
>gb|AC124764.3| Mus musculus BAC clone RP23-166K1 from chromosome 18, complete sequence Length = 209579 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 49 aactatttggaaatttacaaca 70 |||||||||||||||||||||| Sbjct: 60597 aactatttggaaatttacaaca 60576
>ref|XM_543150.2| PREDICTED: Canis familiaris similar to PABP1-dependent poly A-specific ribonuclease subunit PAN3 (LOC486024), mRNA Length = 5767 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Minus Query: 389 cccggggcagctccggcggccg 410 |||||||||||||||||||||| Sbjct: 533 cccggggcagctccggcggccg 512
>gb|AF096998.1| Pinus taeda trans-cinnamate 4-hydroxylase (TC4H) mRNA, complete cds Length = 1996 Score = 44.1 bits (22), Expect = 0.40 Identities = 34/38 (89%) Strand = Plus / Minus Query: 309 tgccccggcggcggcagcagctcgaagttctgcaccag 346 ||||| ||||| ||||||||||| |||||||| ||||| Sbjct: 1504 tgcccaggcggaggcagcagctcaaagttctgaaccag 1467
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 44.1 bits (22), Expect = 0.40 Identities = 22/22 (100%) Strand = Plus / Plus Query: 374 cagcgcgaggatgatcccgggg 395 |||||||||||||||||||||| Sbjct: 2623598 cagcgcgaggatgatcccgggg 2623619
>dbj|AB088224.1| Streptomyces rochei plasmid pSLA2-L DNA, complete sequence Length = 210614 Score = 44.1 bits (22), Expect = 0.40 Identities = 25/26 (96%) Strand = Plus / Minus Query: 307 cctgccccggcggcggcagcagctcg 332 ||||| |||||||||||||||||||| Sbjct: 187673 cctgcaccggcggcggcagcagctcg 187648
>gb|U55006.1|PEU55006 Pinus elliottii PEC18 mRNA, partial sequence Length = 404 Score = 44.1 bits (22), Expect = 0.40 Identities = 28/30 (93%) Strand = Plus / Minus Query: 311 ccccggcggcggcagcagctcgaagttctg 340 ||||||||| ||||| |||||||||||||| Sbjct: 53 ccccggcggaggcagaagctcgaagttctg 24
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome Length = 3345170 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 352 cgagcgtgatgccgatgatgggcag 376 |||||||| |||||||||||||||| Sbjct: 674771 cgagcgtgttgccgatgatgggcag 674747
>dbj|BA000011.4| Thermoplasma volcanium GSS1 DNA, complete genome Length = 1584804 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 43 attgccaactatttggaaatttaca 67 |||||||||||| |||||||||||| Sbjct: 588797 attgccaactatatggaaatttaca 588773
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 315 ggcggcggcagcagctcgaag 335 ||||||||||||||||||||| Sbjct: 694404 ggcggcggcagcagctcgaag 694384 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 313 ccggcggcggcagcagctcg 332 |||||||||||||||||||| Sbjct: 5809939 ccggcggcggcagcagctcg 5809958
>emb|BX294118.4| Zebrafish DNA sequence from clone DKEYP-38B6, complete sequence Length = 184616 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 126 actgtgaaacaccaaaatgca 146 ||||||||||||||||||||| Sbjct: 165388 actgtgaaacaccaaaatgca 165408
>ref|NM_198321.2| Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10) (GALNT10), transcript variant 1, mRNA Length = 5222 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 312 cccggcggcggcagcagctc 331 |||||||||||||||||||| Sbjct: 59 cccggcggcggcagcagctc 40
>gb|AY528720.1| Danio rerio activation-induced cytidine deaminase (aicda) mRNA, complete cds Length = 889 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 196 catgaccgagatctgaactc 215 |||||||||||||||||||| Sbjct: 500 catgaccgagatctgaactc 481
>gb|BC050333.1| Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10), mRNA (cDNA clone IMAGE:4838534), with apparent retained intron Length = 4359 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 312 cccggcggcggcagcagctc 331 |||||||||||||||||||| Sbjct: 59 cccggcggcggcagcagctc 40
>ref|XM_976546.1| PREDICTED: Mus musculus membrane-associated ring finger (C3HC4) 9 (March9), mRNA Length = 2563 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 309 tgccccggcggcggcagcag 328 |||||||||||||||||||| Sbjct: 798 tgccccggcggcggcagcag 817
>ref|XM_816528.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053508461.290) partial mRNA Length = 1707 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 306 tcctgccccggcggcggcagcagc 329 |||||||||||||||||| ||||| Sbjct: 864 tcctgccccggcggcggcggcagc 887
>ref|XM_546283.2| PREDICTED: Canis familiaris similar to GalNAc transferase 10 isoform a (LOC489165), mRNA Length = 2637 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 312 cccggcggcggcagcagctc 331 |||||||||||||||||||| Sbjct: 752 cccggcggcggcagcagctc 733
>gb|AC079804.5| Homo sapiens BAC clone RP11-740N7 from 7, complete sequence Length = 184512 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 98 ccaacaccaaagaaaaatta 117 |||||||||||||||||||| Sbjct: 99068 ccaacaccaaagaaaaatta 99049
>gb|AC010295.7| Homo sapiens chromosome 5 clone CTB-143H13, complete sequence Length = 108051 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 312 cccggcggcggcagcagctc 331 |||||||||||||||||||| Sbjct: 7435 cccggcggcggcagcagctc 7454
>ref|NM_001008403.1| Danio rerio activation-induced cytidine deaminase (aicda), mRNA Length = 889 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 196 catgaccgagatctgaactc 215 |||||||||||||||||||| Sbjct: 500 catgaccgagatctgaactc 481
>ref|XM_775811.1| PREDICTED: Strongylocentrotus purpuratus similar to CG5262-PA (LOC575408), mRNA Length = 1284 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 354 agcgtgatgccgatgatggg 373 |||||||||||||||||||| Sbjct: 917 agcgtgatgccgatgatggg 898
>emb|Y00624.1|ACMHC Acanthamoeba castellanii nonmuscle myosin heavy chain gene Length = 5894 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 446 ggcctcgacggacttctcct 465 |||||||||||||||||||| Sbjct: 5463 ggcctcgacggacttctcct 5444
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome Length = 4296230 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 350 tccgagcgtgatgccgatga 369 |||||||||||||||||||| Sbjct: 407531 tccgagcgtgatgccgatga 407550
>gb|AC164627.4| Mus musculus 10 BAC RP23-382A18 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 192275 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tctttggagccaagaagttttaca 38 |||||||||||| ||||||||||| Sbjct: 55053 tctttggagccaggaagttttaca 55076
>gb|AC148832.5| Pan troglodytes BAC clone CH251-48K6 from chromosome 7, complete sequence Length = 186606 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 ccaacaccaaagaaaaatta 117 |||||||||||||||||||| Sbjct: 46922 ccaacaccaaagaaaaatta 46941
>dbj|AK127135.1| Homo sapiens cDNA FLJ45192 fis, clone BRAWH3049544, weakly similar to Polypeptide N-acetylgalactosaminyltransferase (EC 2.4.1.41) Length = 3938 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 312 cccggcggcggcagcagctc 331 |||||||||||||||||||| Sbjct: 20 cccggcggcggcagcagctc 1
>dbj|AB234902.1| Verbena x hybrida mRNA for Cinnamic acid 4-hydroxylase, complete cds, cultivar: Tapien Pink Length = 1768 Score = 40.1 bits (20), Expect = 6.3 Identities = 38/44 (86%) Strand = Plus / Minus Query: 357 gtgatgccgatgatgggcagcgcgaggatgatcccggggcagct 400 |||||||| | |||||||||||| || || || ||||||||||| Sbjct: 1434 gtgatgcccaggatgggcagcgcaagaataattccggggcagct 1391
>gb|AF368379.1| Nicotiana tabacum elicitor-inducible cytochrome P450 (CYP73A28) mRNA, complete cds Length = 1693 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Minus Query: 372 ggcagcgcgaggatgatcccggggcagctccg 403 ||||| || |||||||| |||||||||||||| Sbjct: 1470 ggcagtgcaaggatgattccggggcagctccg 1439
>gb|AF368378.1| Nicotiana tabacum elicitor-inducible cytochrome P450 (CYP73A27) mRNA, complete cds Length = 1745 Score = 40.1 bits (20), Expect = 6.3 Identities = 29/32 (90%) Strand = Plus / Minus Query: 372 ggcagcgcgaggatgatcccggggcagctccg 403 ||||| || |||||||| |||||||||||||| Sbjct: 1470 ggcagtgcaaggatgattccggggcagctccg 1439
>dbj|AK158026.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched library, clone:F930017K03 product:LOC92979 protein (Fragment) homolog [Homo sapiens], full insert sequence Length = 2001 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 309 tgccccggcggcggcagcag 328 |||||||||||||||||||| Sbjct: 271 tgccccggcggcggcagcag 290
>gb|AC157950.2| Mus musculus BAC clone RP23-128A23 from chromosome 9, complete sequence Length = 202301 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tctttggagccaagaagttt 34 |||||||||||||||||||| Sbjct: 44374 tctttggagccaagaagttt 44355
>gb|AC148692.1| Macaca mulatta Major Histocompatibility Complex BAC MMU235E11, complete sequence Length = 159875 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 269 gctgaactgccctggcttct 288 |||||||||||||||||||| Sbjct: 47514 gctgaactgccctggcttct 47495
>gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex BAC MMU009PO6, complete sequence Length = 191271 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 269 gctgaactgccctggcttct 288 |||||||||||||||||||| Sbjct: 177899 gctgaactgccctggcttct 177880
>gb|AC148660.1| Macaca mulatta Major Histocompatibility Complex BAC MMU007F01, complete sequence Length = 176267 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 269 gctgaactgccctggcttct 288 |||||||||||||||||||| Sbjct: 2794 gctgaactgccctggcttct 2775
>gb|DQ075002.1| Malus x domestica cinnamic acid hydroxylase (C4H1) mRNA, complete cds Length = 1946 Score = 40.1 bits (20), Expect = 6.3 Identities = 41/48 (85%) Strand = Plus / Minus Query: 293 ggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctg 340 |||||||| |||| ||| || ||||| ||||| |||||||||||||| Sbjct: 1737 ggtgtcgagcttggactgtcctggcggaggcagaagctcgaagttctg 1690
>gb|BC059615.1| Danio rerio flavoprotein oxidoreductase MICAL3, mRNA (cDNA clone IMAGE:4786938), partial cds Length = 2318 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 ttggagccaagaagttttac 37 |||||||||||||||||||| Sbjct: 710 ttggagccaagaagttttac 729
>ref|NM_001033262.1| Mus musculus membrane-associated ring finger (C3HC4) 9 (March9), mRNA Length = 2001 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 309 tgccccggcggcggcagcag 328 |||||||||||||||||||| Sbjct: 271 tgccccggcggcggcagcag 290
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 310 gccccggcggcggcagcagc 329 |||||||||||||||||||| Sbjct: 2637 gccccggcggcggcagcagc 2656
>gb|AC131760.4| Mus musculus BAC clone RP24-220M2 from 10, complete sequence Length = 173472 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 309 tgccccggcggcggcagcag 328 |||||||||||||||||||| Sbjct: 102945 tgccccggcggcggcagcag 102964
>gb|AC134329.3| Mus musculus BAC clone RP24-310D17 from 10, complete sequence Length = 159173 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 309 tgccccggcggcggcagcag 328 |||||||||||||||||||| Sbjct: 25079 tgccccggcggcggcagcag 25098
>emb|CR848818.10| Zebrafish DNA sequence from clone DKEY-38O19 in linkage group 16, complete sequence Length = 208738 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 196 catgaccgagatctgaactc 215 |||||||||||||||||||| Sbjct: 273 catgaccgagatctgaactc 254
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 355 gcgtgatgccgatgatgggc 374 |||||||||||||||||||| Sbjct: 2513672 gcgtgatgccgatgatgggc 2513653
>gb|AC164629.14| Mus musculus 10 BAC RP23-16N3 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 221874 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tctttggagccaagaagttttaca 38 |||||||||||| ||||||||||| Sbjct: 44132 tctttggagccaggaagttttaca 44109 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,401,473 Number of Sequences: 3902068 Number of extensions: 4401473 Number of successful extensions: 106322 Number of sequences better than 10.0: 76 Number of HSP's better than 10.0 without gapping: 78 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 105488 Number of HSP's gapped (non-prelim): 834 length of query: 468 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 446 effective length of database: 17,147,199,772 effective search space: 7647651098312 effective search space used: 7647651098312 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)