ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart57d04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_195054.1| Oryza sativa (japonica cultivar-group) hypothet... 50 0.007
2gb|AC090488.3| Genomic sequence for Oryza sativa, Nipponbare str... 50 0.007
3dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
4dbj|AK107891.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
5gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 50 0.007
6gb|AC126807.4| Mus musculus BAC clone RP23-306D4 from chromosome... 42 1.6
7gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome 42 1.6
8dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 42 1.6
9gb|AF283880.1|AF283880 Raymunida elegantissima REL6 cytochrome o... 42 1.6
10gb|AF283879.1|AF283879 Raymunida elegantissima REL5 cytochrome o... 42 1.6
11gb|AF283878.1|AF283878 Raymunida elegantissima REL4 cytochrome o... 42 1.6
12gb|AF283877.1|AF283877 Raymunida elegantissima REL3 cytochrome o... 42 1.6
13gb|AF283876.1|AF283876 Raymunida elegantissima REL2 cytochrome o... 42 1.6
14gb|AF283875.1|AF283875 Raymunida elegantissima REL1 cytochrome o... 42 1.6
15emb|BX005302.8| Zebrafish DNA sequence from clone DKEY-237I15 in... 42 1.6
16gb|AC131005.3| Homo sapiens 3 BAC RP11-88K11 (Roswell Park Cance... 42 1.6
17emb|AL954193.12| Mouse DNA sequence from clone RP23-130G4 on chr... 42 1.6
18gb|AC099009.2| Drosophila melanogaster clone BACR17M11, complete... 40 6.4
19gb|AC146172.2| Pan troglodytes BAC clone RP43-24M4 from 7, compl... 40 6.4
20gb|AC147050.2| Pan troglodytes BAC clone RP43-138F4 from 7, comp... 40 6.4
21gb|AC124521.2| Mus musculus BAC clone RP23-395M9 from 5, complet... 40 6.4
22gb|AC006455.2| Homo sapiens PAC clone RP5-905H7 from 7, complete... 40 6.4
23gb|AC140951.1| Pan troglodytes BAC clone RP43-60K3 from 7, compl... 40 6.4
24gb|BT025098.1| Drosophila melanogaster IP12358 full insert cDNA 40 6.4
25emb|AL603844.7| Human DNA sequence from clone RP11-541I21 on chr... 40 6.4
26emb|AL158157.8| Human DNA sequence from clone RP11-413D24 on chr... 40 6.4
27emb|AL118512.9|HSG248A21 Human DNA sequence from clone GS1-248A2... 40 6.4
28gb|AC134618.2| Homo sapiens BAC clone RP11-1241A4 from 7, comple... 40 6.4
29emb|AL663001.3|OSJN00197 Oryza sativa genomic DNA, chromosome 4,... 40 6.4
30gb|AC182735.3| Pan troglodytes BAC clone CH251-257K2 from chromo... 40 6.4
31gb|AC148316.3| Pan troglodytes BAC clone CH251-508B1 from chromo... 40 6.4
32gb|AC105314.5| Homo sapiens BAC clone RP11-312H15 from 4, comple... 40 6.4
33ref|NM_136670.2| Drosophila melanogaster CG1776-RA (CG1776), mRNA 40 6.4
34gb|AC091439.5| Homo sapiens BAC clone RP11-497K2 from 7, complet... 40 6.4
35gb|AC006457.4| Homo sapiens PAC clone RP5-1193P9 from 7p11.2-q11... 40 6.4
36gb|AC148300.3| Pan troglodytes BAC clone CH251-64B13 from chromo... 40 6.4
37gb|AY060726.1| Drosophila melanogaster GH17420 full length cDNA 40 6.4
38gb|AC148298.3| Pan troglodytes BAC clone CH251-136E8 from chromo... 40 6.4
39gb|AC087072.2|AC087072 Homo sapiens chromosome 7 clone RP11-609L... 40 6.4
40dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
41gb|AC015973.2|AC015973 Homo sapiens BAC clone RP11-366C6 from Y,... 40 6.4
42gb|AC134619.2| Homo sapiens BAC clone RP11-1367K15 from 7, compl... 40 6.4
43gb|AC122133.4| Homo sapiens BAC clone RP11-220H4 from 7, complet... 40 6.4
44gb|AC104463.3| Homo sapiens chromosome 1 clone RP11-569A11, comp... 40 6.4
45ref|XM_321040.2| Anopheles gambiae str. PEST ENSANGP00000022463 ... 40 6.4
46gb|AE003832.4| Drosophila melanogaster chromosome 2R, section 18... 40 6.4
47gb|AC004067.1|AC004067 Homo sapiens chromosome 4 clone B366O24 m... 40 6.4
48gb|AC005894.1|AC005894 Drosophila melanogaster, chromosome 2R, r... 40 6.4
49gb|AC158984.2| Mus musculus BAC clone RP23-277H1 from chromosome... 40 6.4 
>ref|NM_195054.1| Oryza sativa (japonica cultivar-group) hypothetical protein
           (OSJNBb0081F12.15), mRNA
          Length = 372

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 312 tcatgcaggggaggtccatctcggcgaccttga 344
           ||||||||||||||||||| ||||||| |||||
Sbjct: 292 tcatgcaggggaggtccatgtcggcgatcttga 260
to top
>gb|AC090488.3| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0081F12 from chromosome 10, complete sequence
          Length = 128388

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 312   tcatgcaggggaggtccatctcggcgaccttga 344
             ||||||||||||||||||| ||||||| |||||
Sbjct: 70227 tcatgcaggggaggtccatgtcggcgatcttga 70195
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                                
Query: 312     tcatgcaggggaggtccatctcggcgaccttga 344
               ||||||||||||||||||| ||||||| |||||
Sbjct: 4408619 tcatgcaggggaggtccatgtcggcgatcttga 4408587
to top
>dbj|AK107891.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-134-E07, full
           insert sequence
          Length = 515

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 312 tcatgcaggggaggtccatctcggcgaccttga 344
           ||||||||||||||||||| ||||||| |||||
Sbjct: 272 tcatgcaggggaggtccatgtcggcgatcttga 240
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                                
Query: 312     tcatgcaggggaggtccatctcggcgaccttga 344
               ||||||||||||||||||| ||||||| |||||
Sbjct: 4409440 tcatgcaggggaggtccatgtcggcgatcttga 4409408
to top
>gb|AC126807.4| Mus musculus BAC clone RP23-306D4 from chromosome 18, complete sequence
          Length = 244566

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 390    tctccacctcccgctccacct 410
              |||||||||||||||||||||
Sbjct: 177944 tctccacctcccgctccacct 177964
to top
>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 260     gacgcaggcggccaaggccat 280
               |||||||||||||||||||||
Sbjct: 1331782 gacgcaggcggccaaggccat 1331762
to top
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 388    gatctccacctcccgctccacctcg 412
              |||||||||| ||||||||||||||
Sbjct: 870279 gatctccaccgcccgctccacctcg 870255
to top
>gb|AF283880.1|AF283880 Raymunida elegantissima REL6 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 657

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 384 actggatctccacctcccgct 404
           |||||||||||||||||||||
Sbjct: 638 actggatctccacctcccgct 618
to top
>gb|AF283879.1|AF283879 Raymunida elegantissima REL5 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 657

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 384 actggatctccacctcccgct 404
           |||||||||||||||||||||
Sbjct: 638 actggatctccacctcccgct 618
to top
>gb|AF283878.1|AF283878 Raymunida elegantissima REL4 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 657

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 384 actggatctccacctcccgct 404
           |||||||||||||||||||||
Sbjct: 638 actggatctccacctcccgct 618
to top
>gb|AF283877.1|AF283877 Raymunida elegantissima REL3 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 657

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 384 actggatctccacctcccgct 404
           |||||||||||||||||||||
Sbjct: 638 actggatctccacctcccgct 618
to top
>gb|AF283876.1|AF283876 Raymunida elegantissima REL2 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 657

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 384 actggatctccacctcccgct 404
           |||||||||||||||||||||
Sbjct: 638 actggatctccacctcccgct 618
to top
>gb|AF283875.1|AF283875 Raymunida elegantissima REL1 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial gene for mitochondrial
           product
          Length = 657

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 384 actggatctccacctcccgct 404
           |||||||||||||||||||||
Sbjct: 638 actggatctccacctcccgct 618
to top
>emb|BX005302.8| Zebrafish DNA sequence from clone DKEY-237I15 in linkage group 21,
             complete sequence
          Length = 131139

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 29    ttatatatgatagaaatgtat 49
             |||||||||||||||||||||
Sbjct: 56451 ttatatatgatagaaatgtat 56471
to top
>gb|AC131005.3| Homo sapiens 3 BAC RP11-88K11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 191231

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 88     catcatataggagtagtttacatga 112
              |||||| ||||||||||||||||||
Sbjct: 187652 catcatttaggagtagtttacatga 187676
to top
>emb|AL954193.12| Mouse DNA sequence from clone RP23-130G4 on chromosome X, complete
             sequence
          Length = 52879

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 25    tcttttatatatgatagaaat 45
             |||||||||||||||||||||
Sbjct: 15575 tcttttatatatgatagaaat 15595
to top
>gb|AC099009.2| Drosophila melanogaster clone BACR17M11, complete sequence
          Length = 188872

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 389    atctccacctcccgctccac 408
              ||||||||||||||||||||
Sbjct: 119114 atctccacctcccgctccac 119133
to top
>gb|AC146172.2| Pan troglodytes BAC clone RP43-24M4 from 7, complete sequence
          Length = 223283

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    ttttatatatgatagaaatg 46
             ||||||||||||||||||||
Sbjct: 43843 ttttatatatgatagaaatg 43824
to top
>gb|AC147050.2| Pan troglodytes BAC clone RP43-138F4 from 7, complete sequence
          Length = 190626

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 27     ttttatatatgatagaaatg 46
              ||||||||||||||||||||
Sbjct: 156078 ttttatatatgatagaaatg 156059
to top
>gb|AC124521.2| Mus musculus BAC clone RP23-395M9 from 5, complete sequence
          Length = 184380

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 17     attcaagatcttttatatatgata 40
              |||||| |||||||||||||||||
Sbjct: 143446 attcaacatcttttatatatgata 143423
to top
>gb|AC006455.2| Homo sapiens PAC clone RP5-905H7 from 7, complete sequence
          Length = 139384

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    ttttatatatgatagaaatg 46
             ||||||||||||||||||||
Sbjct: 18081 ttttatatatgatagaaatg 18062
to top
>gb|AC140951.1| Pan troglodytes BAC clone RP43-60K3 from 7, complete sequence
          Length = 165269

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 27     ttttatatatgatagaaatg 46
              ||||||||||||||||||||
Sbjct: 101994 ttttatatatgatagaaatg 101975
to top
>gb|BT025098.1| Drosophila melanogaster IP12358 full insert cDNA
          Length = 2067

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 389 atctccacctcccgctccac 408
           ||||||||||||||||||||
Sbjct: 80  atctccacctcccgctccac 61
to top
>emb|AL603844.7| Human DNA sequence from clone RP11-541I21 on chromosome 1, complete
              sequence
          Length = 220185

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 216    cttgtagtagtaggaagcag 235
              ||||||||||||||||||||
Sbjct: 136627 cttgtagtagtaggaagcag 136646
to top
>emb|AL158157.8| Human DNA sequence from clone RP11-413D24 on chromosome 9, complete
             sequence
          Length = 183410

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 28    tttatatatgatagaaatgt 47
             ||||||||||||||||||||
Sbjct: 15808 tttatatatgatagaaatgt 15789
to top
>emb|AL118512.9|HSG248A21 Human DNA sequence from clone GS1-248A21 on chromosome 1q31.1-31.3
             Contains part of the gene for hemicentin (FIBL-6),
             complete sequence
          Length = 83063

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    aagatcttttatatatgata 40
             ||||||||||||||||||||
Sbjct: 76903 aagatcttttatatatgata 76922
to top
>gb|AC134618.2| Homo sapiens BAC clone RP11-1241A4 from 7, complete sequence
          Length = 213481

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 27     ttttatatatgatagaaatg 46
              ||||||||||||||||||||
Sbjct: 170159 ttttatatatgatagaaatg 170178
to top
>emb|AL663001.3|OSJN00197 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0022P19,
             complete sequence
          Length = 135836

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 394   cacctcccgctccacctcgc 413
             ||||||||||||||||||||
Sbjct: 54501 cacctcccgctccacctcgc 54482
to top
>gb|AC182735.3| Pan troglodytes BAC clone CH251-257K2 from chromosome 7, complete
             sequence
          Length = 156146

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    ttttatatatgatagaaatg 46
             ||||||||||||||||||||
Sbjct: 99763 ttttatatatgatagaaatg 99782
to top
>gb|AC148316.3| Pan troglodytes BAC clone CH251-508B1 from chromosome 7, complete
             sequence
          Length = 162525

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    ttttatatatgatagaaatg 46
             ||||||||||||||||||||
Sbjct: 43563 ttttatatatgatagaaatg 43544
to top
>gb|AC105314.5| Homo sapiens BAC clone RP11-312H15 from 4, complete sequence
          Length = 193665

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 5      aaaaacaaattcattcaagatcttttat 32
              |||||| | |||||||||||||||||||
Sbjct: 151097 aaaaacgacttcattcaagatcttttat 151124
to top
>ref|NM_136670.2| Drosophila melanogaster CG1776-RA (CG1776), mRNA
          Length = 2075

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 389 atctccacctcccgctccac 408
           ||||||||||||||||||||
Sbjct: 621 atctccacctcccgctccac 602
to top
>gb|AC091439.5| Homo sapiens BAC clone RP11-497K2 from 7, complete sequence
          Length = 103775

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 27    ttttatatatgatagaaatg 46
             ||||||||||||||||||||
Sbjct: 91597 ttttatatatgatagaaatg 91578
to top
>gb|AC006457.4| Homo sapiens PAC clone RP5-1193P9 from 7p11.2-q11.2, complete sequence
          Length = 134187

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    ttttatatatgatagaaatg 46
             ||||||||||||||||||||
Sbjct: 69943 ttttatatatgatagaaatg 69962
to top
>gb|AC148300.3| Pan troglodytes BAC clone CH251-64B13 from chromosome 7, complete
              sequence
          Length = 173568

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 27     ttttatatatgatagaaatg 46
              ||||||||||||||||||||
Sbjct: 156365 ttttatatatgatagaaatg 156346
to top
>gb|AY060726.1| Drosophila melanogaster GH17420 full length cDNA
          Length = 2057

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 389 atctccacctcccgctccac 408
           ||||||||||||||||||||
Sbjct: 603 atctccacctcccgctccac 584
to top
>gb|AC148298.3| Pan troglodytes BAC clone CH251-136E8 from chromosome 7, complete
              sequence
          Length = 168496

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 27     ttttatatatgatagaaatg 46
              ||||||||||||||||||||
Sbjct: 128343 ttttatatatgatagaaatg 128362
to top
>gb|AC087072.2|AC087072 Homo sapiens chromosome 7 clone RP11-609L3, complete sequence
          Length = 150856

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    ttttatatatgatagaaatg 46
             ||||||||||||||||||||
Sbjct: 54440 ttttatatatgatagaaatg 54459
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 394     cacctcccgctccacctcgc 413
               ||||||||||||||||||||
Sbjct: 7327131 cacctcccgctccacctcgc 7327112
to top
>gb|AC015973.2|AC015973 Homo sapiens BAC clone RP11-366C6 from Y, complete sequence
          Length = 171834

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 294    gcttgcacttgaggtccttc 313
              ||||||||||||||||||||
Sbjct: 159872 gcttgcacttgaggtccttc 159891
to top
>gb|AC134619.2| Homo sapiens BAC clone RP11-1367K15 from 7, complete sequence
          Length = 225116

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 27     ttttatatatgatagaaatg 46
              ||||||||||||||||||||
Sbjct: 204218 ttttatatatgatagaaatg 204237
to top
>gb|AC122133.4| Homo sapiens BAC clone RP11-220H4 from 7, complete sequence
          Length = 191103

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 27     ttttatatatgatagaaatg 46
              ||||||||||||||||||||
Sbjct: 138467 ttttatatatgatagaaatg 138448
to top
>gb|AC104463.3| Homo sapiens chromosome 1 clone RP11-569A11, complete sequence
          Length = 156818

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 294   gcttgcacttgaggtccttc 313
             ||||||||||||||||||||
Sbjct: 18503 gcttgcacttgaggtccttc 18522
to top
>ref|XM_321040.2| Anopheles gambiae str. PEST ENSANGP00000022463 (ENSANGG00000021069),
            partial mRNA
          Length = 13977

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 427  gtccgccaccacgccggagc 446
            ||||||||||||||||||||
Sbjct: 7866 gtccgccaccacgccggagc 7885
to top
>gb|AE003832.4| Drosophila melanogaster chromosome 2R, section 18 of 73 of the complete
              sequence
          Length = 242171

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 389    atctccacctcccgctccac 408
              ||||||||||||||||||||
Sbjct: 117871 atctccacctcccgctccac 117890
to top
>gb|AC004067.1|AC004067 Homo sapiens chromosome 4 clone B366O24 map 4q25, complete sequence
          Length = 161326

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 5     aaaaacaaattcattcaagatcttttat 32
             |||||| | |||||||||||||||||||
Sbjct: 51353 aaaaacgacttcattcaagatcttttat 51380
to top
>gb|AC005894.1|AC005894 Drosophila melanogaster, chromosome 2R, region 46A1-46B2, P1 clones
              DS00050, DS00191, and DS05369, complete sequence
          Length = 196337

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 389    atctccacctcccgctccac 408
              ||||||||||||||||||||
Sbjct: 114536 atctccacctcccgctccac 114555
to top
>gb|AC158984.2| Mus musculus BAC clone RP23-277H1 from chromosome 5, complete sequence
          Length = 215887

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 17     attcaagatcttttatatatgata 40
              |||||| |||||||||||||||||
Sbjct: 212972 attcaacatcttttatatatgata 212995


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,216,813
Number of Sequences: 3902068
Number of extensions: 4216813
Number of successful extensions: 79196
Number of sequences better than 10.0: 50
Number of HSP's better than 10.0 without gapping: 50
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78946
Number of HSP's gapped (non-prelim): 250
length of query: 475
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 453
effective length of database: 17,147,199,772
effective search space: 7767681496716
effective search space used: 7767681496716
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top