ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart57c04
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein,... 517 e-144
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 264 2e-67
3dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic D... 264 2e-67
4dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clon... 264 2e-67
5dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clon... 264 2e-67
6dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clon... 256 5e-65
7emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4 200 2e-48
8gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds 196 4e-47
9gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps... 196 4e-47
10gb|BT016261.1| Zea mays clone Contig94 mRNA sequence 192 6e-46
11gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA,... 192 6e-46
12gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence 176 3e-41
13ref|NM_193994.1| Oryza sativa (japonica cultivar-group), predic... 143 5e-31
14dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 143 5e-31
15dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic D... 143 5e-31
16dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 5e-31
17gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4... 125 1e-25
18gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete s... 119 7e-24
19ref|XM_475130.1| Oryza sativa (japonica cultivar-group), predic... 117 3e-23
20gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome... 117 3e-23
21dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 117 3e-23
22dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
23gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, comple... 84 4e-13
24emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal pro... 84 4e-13
25gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal prot... 76 9e-11
26dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, com... 74 4e-10
27ref|NM_125228.3| Arabidopsis thaliana structural constituent of ... 68 2e-08
28gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, comp... 68 2e-08
29gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, comp... 68 2e-08
30gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mR... 68 2e-08
31emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
32emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
33emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
34emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
35emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
36emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
37emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Co... 68 2e-08
38gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete s... 68 2e-08
39dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 68 2e-08
40gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA 62 1e-06
41ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG... 62 1e-06
42ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG... 62 1e-06
43gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell ... 62 1e-06
44gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46... 62 1e-06
45dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribos... 62 1e-06
46ref|NM_001036769.1| Arabidopsis thaliana structural constituent ... 60 6e-06
47ref|NM_120791.2| Arabidopsis thaliana structural constituent of ... 60 6e-06
48gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal prote... 60 6e-06
49gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal prote... 60 6e-06
50emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, B... 60 6e-06
51gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, co... 60 6e-06
52gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, co... 60 6e-06
53emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Co... 60 6e-06
54emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Co... 60 6e-06
55emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Co... 60 6e-06
56emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Co... 60 6e-06
57gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete s... 60 6e-06
58dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 60 6e-06
59gb|AY110862.1| Zea mays CL1882_8 mRNA sequence 60 6e-06
60emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal prote... 58 2e-05
61gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence 54 3e-04
62dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 54 3e-04
63ref|NM_127291.2| Arabidopsis thaliana structural constituent of ... 52 0.001
64gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S... 52 0.001
65gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S... 52 0.001
66gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, comple... 52 0.001
67gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA... 52 0.001
68emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Co... 52 0.001
69emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Co... 52 0.001
70emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Co... 52 0.001
71emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Co... 52 0.001
72gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete s... 52 0.001
73gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II sectio... 52 0.001
74ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predi... 50 0.005
75gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 ... 50 0.005
76emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 50 0.005
77ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothe... 48 0.021
78ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hyp... 48 0.021
79gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putat... 48 0.021
80gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-lik... 48 0.021
81emb|BX067601.1|CNS09OBP Single read from an extremity of a full-... 44 0.33
82emb|BX067600.1|CNS09OBO Single read from an extremity of a full-... 44 0.33
83gb|DQ362415.1| Shigella dysenteriae strain G1274 GcvT (gcvT) gen... 44 0.33
84gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosom... 42 1.3
85ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 1.3
86gb|AC163608.2| Mus musculus chromosome 1, clone RP24-185M14, com... 42 1.3
87gb|AC101994.3| Mus musculus chromosome 1, clone RP24-406F14, com... 42 1.3
88gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete s... 42 1.3
89dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 42 1.3
90emb|BX818793.1|CNS0A8YY Arabidopsis thaliana Full-length cDNA Co... 42 1.3
91gb|BC081584.1| Danio rerio ribosomal protein S4, X-linked, mRNA ... 40 5.1
92ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1... 40 5.1
93gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 5.1
94gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, com... 40 5.1
95gb|AC145590.3| Mus musculus BAC clone RP24-175D4 from chromosome... 40 5.1
96gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence 40 5.1
97gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, com... 40 5.1
98gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome ... 40 5.1
99ref|XM_567206.1| Cryptococcus neoformans var. neoformans JEC21 h... 40 5.1
100gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome... 40 5.1
101ref|NM_001005589.1| Danio rerio ribosomal protein S4, X-linked (... 40 5.1
102gb|AC133904.9| Mus musculus chromosome 19, clone RP24-143J12, co... 40 5.1
103gb|AC158778.4| Mus musculus chromosome 19, clone RP24-90P13, com... 40 5.1
104emb|Z68908.1|HSU227D1 Human DNA sequence from clone LL0XNC01-227... 40 5.1
105ref|XM_505600.1| Yarrowia lipolytica CLIB122, YALI0F18920g predi... 40 5.1
106ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 5.1
107ref|XM_795025.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 40 5.1
108emb|AJ719272.1| Gallus gallus mRNA for hypothetical protein, clo... 40 5.1
109emb|BX293994.28| Zebrafish DNA sequence from clone DKEY-256K14 i... 40 5.1
110gb|AC009806.9| Homo sapiens chromosome 11, clone RP11-51B23, com... 40 5.1
111gb|AC007437.16| Homo sapiens 12q22 BAC RPCI11-541G9 (Roswell Par... 40 5.1
112gb|AC007656.2| Homo sapiens 12q22 BAC RPCI11-534P6 (Rowswell Par... 40 5.1
113gb|AC150660.4| Mus musculus BAC clone RP23-41F9 from chromosome ... 40 5.1
114gb|AC133282.7| Mus musculus chromosome 15, clone RP24-408B1, com... 40 5.1
115dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 5.1
116emb|BX950204.17| Zebrafish DNA sequence from clone DKEY-252P7 in... 40 5.1
117emb|BX927103.12| Zebrafish DNA sequence from clone DKEY-262M23 i... 40 5.1
118gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, com... 40 5.1
119emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1... 40 5.1
120gb|AC151990.6| Mus musculus BAC clone RP23-299K14 from chromosom... 40 5.1
121gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, co... 40 5.1
122gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 40 5.1
123gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, comple... 40 5.1
124gb|AC102003.5| Mus musculus chromosome 7, clone RP24-488I10, com... 40 5.1
125emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 40 5.1
126emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chr... 40 5.1
127emb|AL139193.4|CNS01DXA Human chromosome 14 DNA sequence BAC R-6... 40 5.1 
>dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein, complete cds
          Length = 1053

 Score =  517 bits (261), Expect = e-144
 Identities = 349/377 (92%), Gaps = 1/377 (0%)
 Strand = Plus / Minus

                                                                        
Query: 9    aaacatccacattacatctagcagcatccatgggttcgcaaatcaacaaacatcaggcaa 68
            |||||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||||
Sbjct: 1035 aaacatccacattacatctagcagcaaccatgggttcacaattcaacaaacatcaggcaa 976

                                                                        
Query: 69   aacttaaaaaagatggttccaggaacatagttctatatccttgcaaataactggctatag 128
            || ||||||| ||||||||||| ||||||||||||||||||| || ||||||||||||||
Sbjct: 975  aatttaaaaacgatggttccagaaacatagttctatatcctt-cagataactggctatag 917

                                                                        
Query: 129  caaaacgactcaatgcctcaaaatcaggccttggcagcagcctgagctgcggcatccctc 188
            |||||||| |||| |||||| ||||||||||||||||| ||||| || ||||||||||||
Sbjct: 916  caaaacgaatcaacgcctcagaatcaggccttggcagctgcctgggcagcggcatccctc 857

                                                                        
Query: 189  ttcctctgctcctcaatgatggggagcttgatacccttgcccttggggaggctcacccaa 248
            ||||||||||||||||||||||  ||||||||||| ||||||||||||||| ||||||| 
Sbjct: 856  ttcctctgctcctcaatgatggtcagcttgatacctttgcccttggggagggtcacccac 797

                                                                        
Query: 249  ggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggcaaactggtgaccc 308
            ||||||||||||||||| ||||||||||| ||||| | ||||||||| ||||||||||||
Sbjct: 796  ggcttggtgcccttgccgatggtgaacacattgcctagacgggtggcgaactggtgaccc 737

                                                                        
Query: 309  tgggcatcctcaacggggatggtctcaaaggttcccttatgcttctccctgttcttgatc 368
            || |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 736  tgagcatcctcaacgtggatggtctcgaaggttcccttatgcttctccctgttcttgatc 677

                             
Query: 369  acaccaacacgcccagt 385
            ||||||||||| |||||
Sbjct: 676  acaccaacacggccagt 660
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score =  264 bits (133), Expect = 2e-67
 Identities = 199/221 (90%)
 Strand = Plus / Plus

                                                                          
Query: 159    ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggggagcttg 218
              |||||||||||||| || || ||||||| |||||| |||||||| ||||||  |||||||
Sbjct: 316967 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 317026

                                                                          
Query: 219    atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 278
              || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 317027 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 317086

                                                                          
Query: 279    ttgcccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaag 338
              ||||||| ||||||||| || ||||| ||| |||||||||||||| |||||||||| |||
Sbjct: 317087 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 317146

                                                       
Query: 339    gttcccttatgcttctccctgttcttgatcacaccaacacg 379
               | || |||||||||||||||||||||||||||||||||||
Sbjct: 317147 ctgcctttatgcttctccctgttcttgatcacaccaacacg 317187



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                      
Query: 95     atagttctatatccttgcaaataactggctatagcaaaac 134
              ||||||||||||||||||||| |||| |||||||||||||
Sbjct: 316896 atagttctatatccttgcaaacaactcgctatagcaaaac 316935
to top
>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1359_D06
          Length = 146805

 Score =  264 bits (133), Expect = 2e-67
 Identities = 199/221 (90%)
 Strand = Plus / Plus

                                                                         
Query: 159   ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggggagcttg 218
             |||||||||||||| || || ||||||| |||||| |||||||| ||||||  |||||||
Sbjct: 45751 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 45810

                                                                         
Query: 219   atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 278
             || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 45811 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 45870

                                                                         
Query: 279   ttgcccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaag 338
             ||||||| ||||||||| || ||||| ||| |||||||||||||| |||||||||| |||
Sbjct: 45871 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 45930

                                                      
Query: 339   gttcccttatgcttctccctgttcttgatcacaccaacacg 379
              | || |||||||||||||||||||||||||||||||||||
Sbjct: 45931 ctgcctttatgcttctccctgttcttgatcacaccaacacg 45971



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                     
Query: 95    atagttctatatccttgcaaataactggctatagcaaaac 134
             ||||||||||||||||||||| |||| |||||||||||||
Sbjct: 45680 atagttctatatccttgcaaacaactcgctatagcaaaac 45719
to top
>dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B09, full
           insert sequence
          Length = 1016

 Score =  264 bits (133), Expect = 2e-67
 Identities = 199/221 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggggagcttg 218
           |||||||||||||| || || ||||||| |||||| |||||||| ||||||  |||||||
Sbjct: 886 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 827

                                                                       
Query: 219 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 278
           || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 826 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 767

                                                                       
Query: 279 ttgcccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaag 338
           ||||||| ||||||||| || ||||| ||| |||||||||||||| |||||||||| |||
Sbjct: 766 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 707

                                                    
Query: 339 gttcccttatgcttctccctgttcttgatcacaccaacacg 379
            | || |||||||||||||||||||||||||||||||||||
Sbjct: 706 ctgcctttatgcttctccctgttcttgatcacaccaacacg 666



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                   
Query: 95  atagttctatatccttgcaaataactggctatagcaaaac 134
           ||||||||||||||||||||| |||| |||||||||||||
Sbjct: 957 atagttctatatccttgcaaacaactcgctatagcaaaac 918
to top
>dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093E13, full
           insert sequence
          Length = 1157

 Score =  264 bits (133), Expect = 2e-67
 Identities = 199/221 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggggagcttg 218
           |||||||||||||| || || ||||||| |||||| |||||||| ||||||  |||||||
Sbjct: 890 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 831

                                                                       
Query: 219 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 278
           || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 830 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 771

                                                                       
Query: 279 ttgcccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaag 338
           ||||||| ||||||||| || ||||| ||| |||||||||||||| |||||||||| |||
Sbjct: 770 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 711

                                                    
Query: 339 gttcccttatgcttctccctgttcttgatcacaccaacacg 379
            | || |||||||||||||||||||||||||||||||||||
Sbjct: 710 ctgcctttatgcttctccctgttcttgatcacaccaacacg 670



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                   
Query: 95  atagttctatatccttgcaaataactggctatagcaaaac 134
           ||||||||||||||||||||| |||| |||||||||||||
Sbjct: 961 atagttctatatccttgcaaacaactcgctatagcaaaac 922
to top
>dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D06, full
           insert sequence
          Length = 1079

 Score =  256 bits (129), Expect = 5e-65
 Identities = 198/221 (89%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggggagcttg 218
           |||||||||||||| || || ||||||| |||||| |||||||| ||||||  |||||||
Sbjct: 882 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 823

                                                                       
Query: 219 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 278
           || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||  
Sbjct: 822 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaaa 763

                                                                       
Query: 279 ttgcccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaag 338
           ||||||| ||||||||| || ||||| ||| |||||||||||||| |||||||||| |||
Sbjct: 762 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 703

                                                    
Query: 339 gttcccttatgcttctccctgttcttgatcacaccaacacg 379
            | || |||||||||||||||||||||||||||||||||||
Sbjct: 702 ctgcctttatgcttctccctgttcttgatcacaccaacacg 662



 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                   
Query: 95  atagttctatatccttgcaaataactggctatagcaaaac 134
           ||||||||||||||||||||| |||| |||||||||||||
Sbjct: 953 atagttctatatccttgcaaacaactcgctatagcaaaac 914
to top
>emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4
          Length = 1148

 Score =  200 bits (101), Expect = 2e-48
 Identities = 191/217 (88%), Gaps = 3/217 (1%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttggcagcagcctgagctgcggcatccctcttcctctgctcct-caatgatggggagctt 217
           |||||||||||||| || || || |||| |||||| ||||||| | ||||||  ||||||
Sbjct: 865 ttggcagcagcctgggcggccgc-tcccgcttcctttgctccttcgatgatgctgagctt 807

                                                                       
Query: 218 gatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacac 277
           ||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||
Sbjct: 806 gatgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacac 747

                                                                       
Query: 278 gttgcccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaa 337
            ||||||| ||||||||| || ||||| ||| |||||||||||||| |||||||||| ||
Sbjct: 746 attgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaa 687

                                                
Query: 338 ggttcccttatgcttctccctgttcttgatcacacca 374
            | | |||| |||||||||||||| ||||||||||||
Sbjct: 686 -gctgccttttgcttctccctgttgttgatcacacca 651



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 38/41 (92%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 95  atagttctatatcctt-gcaaataactggctatagcaaaac 134
           |||||||||||||||| ||||| |||| |||||||||||||
Sbjct: 937 atagttctatatcctttgcaaacaactcgctatagcaaaac 897
to top
>gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds
          Length = 1037

 Score =  196 bits (99), Expect = 4e-47
 Identities = 195/227 (85%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggggagcttg 218
           |||||||||||||| || |||||||||| |||||| ||||| || ||||||   ||||||
Sbjct: 862 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 803

                                                                       
Query: 219 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 278
           || |||||||||||||| ||||||||||| |||||  | |||||||| ||||||||||||
Sbjct: 802 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 743

                                                                       
Query: 279 ttgcccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaag 338
           ||||||| ||||||||| |||||||| ||| |||  ||||| ||| | |||||||||| |
Sbjct: 742 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaagg 683

                                                          
Query: 339 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagt 385
            | ||||| |||||||||||||||||||| ||||| ||||| |||||
Sbjct: 682 ctgcccttgtgcttctccctgttcttgataacacccacacggccagt 636
to top
>gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps4) mRNA, complete cds
          Length = 1013

 Score =  196 bits (99), Expect = 4e-47
 Identities = 186/215 (86%)
 Strand = Plus / Minus

                                                                       
Query: 159 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggggagcttg 218
           |||||||||||||| || |||||||||| |||||| ||||| || ||||||   ||||||
Sbjct: 864 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 805

                                                                       
Query: 219 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 278
           || |||||||||||||| ||||||||||| |||||  | |||||||| ||||||||||||
Sbjct: 804 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 745

                                                                       
Query: 279 ttgcccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaag 338
           ||||||| ||||||||| |||||||| ||| |||  ||||| ||| | ||||||||||||
Sbjct: 744 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaaag 685

                                              
Query: 339 gttcccttatgcttctccctgttcttgatcacacc 373
            | ||||| |||||||||||||||||||| |||||
Sbjct: 684 ctgcccttgtgcttctccctgttcttgataacacc 650
to top
>gb|BT016261.1| Zea mays clone Contig94 mRNA sequence
          Length = 1116

 Score =  192 bits (97), Expect = 6e-46
 Identities = 169/193 (87%)
 Strand = Plus / Minus

                                                                       
Query: 190 tcctctgctcctcaatgatggggagcttgatacccttgcccttggggaggctcacccaag 249
           ||||||||||||| ||||||  |||||||||||||||||||||||| ||||||||||| |
Sbjct: 865 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 806

                                                                       
Query: 250 gcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggcaaactggtgaccct 309
           ||||| |||||||||| |||||||||||||||||||  |||||||| |||||||| ||| 
Sbjct: 805 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 746

                                                                       
Query: 310 gggcatcctcaacggggatggtctcaaaggttcccttatgcttctccctgttcttgatca 369
            ||  ||||| ||| ||||||| || |||   ||||| ||||||||||||||||||||||
Sbjct: 745 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 686

                        
Query: 370 caccaacacgccc 382
           |||| ||||||||
Sbjct: 685 cacctacacgccc 673
to top
>gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA, complete cds
          Length = 1090

 Score =  192 bits (97), Expect = 6e-46
 Identities = 169/193 (87%)
 Strand = Plus / Minus

                                                                       
Query: 190 tcctctgctcctcaatgatggggagcttgatacccttgcccttggggaggctcacccaag 249
           ||||||||||||| ||||||  |||||||||||||||||||||||| ||||||||||| |
Sbjct: 844 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 785

                                                                       
Query: 250 gcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggcaaactggtgaccct 309
           ||||| |||||||||| |||||||||||||||||||  |||||||| |||||||| ||| 
Sbjct: 784 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 725

                                                                       
Query: 310 gggcatcctcaacggggatggtctcaaaggttcccttatgcttctccctgttcttgatca 369
            ||  ||||| ||| ||||||| || |||   ||||| ||||||||||||||||||||||
Sbjct: 724 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 665

                        
Query: 370 caccaacacgccc 382
           |||| ||||||||
Sbjct: 664 cacctacacgccc 652
to top
>gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence
          Length = 1145

 Score =  176 bits (89), Expect = 3e-41
 Identities = 188/221 (85%)
 Strand = Plus / Plus

                                                                       
Query: 159 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggggagcttg 218
           |||||||||||||| || || ||||||| |||||| ||||| || ||||||   ||||||
Sbjct: 178 ttggcagcagcctgggcagcagcatcccgcttcctttgctcttctatgatgctcagcttg 237

                                                                       
Query: 219 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 278
           || ||||| |||||||| ||||||||||| |||||  | |||||||| ||||||||||||
Sbjct: 238 attcccttacccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 297

                                                                       
Query: 279 ttgcccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaag 338
           ||||||| ||||||||| |||||||| ||| |||  ||||| ||| | || |||||||||
Sbjct: 298 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatagtctcaaag 357

                                                    
Query: 339 gttcccttatgcttctccctgttcttgatcacaccaacacg 379
            | ||||| |||||||||||||||||||| ||||| |||||
Sbjct: 358 ctgcccttgtgcttctccctgttcttgataacacccacacg 398



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 90  ggaacatagttctatatccttgca 113
           ||||||| ||||||||||||||||
Sbjct: 105 ggaacattgttctatatccttgca 128
to top
>ref|NM_193994.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 768

 Score =  143 bits (72), Expect = 5e-31
 Identities = 186/224 (83%)
 Strand = Plus / Minus

                                                                       
Query: 162 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggggagcttgata 221
           |||||||||||||| || ||||| | ||||||||| ||||| ||||||  ||||||||||
Sbjct: 758 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 699

                                                                       
Query: 222 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 281
           ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 698 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 639

                                                                       
Query: 282 cccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaaggtt 341
           |||| ||||||||| ||    || |||   || ||||| ||  |||||||||||||  | 
Sbjct: 638 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 579

                                                       
Query: 342 cccttatgcttctccctgttcttgatcacaccaacacgcccagt 385
           ||||| ||||||||||||||||| || || |||||||| |||||
Sbjct: 578 cccttgtgcttctccctgttcttaattactccaacacgaccagt 535
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  143 bits (72), Expect = 5e-31
 Identities = 186/224 (83%)
 Strand = Plus / Minus

                                                                            
Query: 162      gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggggagcttgata 221
                |||||||||||||| || ||||| | ||||||||| ||||| ||||||  ||||||||||
Sbjct: 14497969 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 14497910

                                                                            
Query: 222      cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 281
                ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 14497909 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 14497850

                                                                            
Query: 282      cccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaaggtt 341
                |||| ||||||||| ||    || |||   || ||||| ||  |||||||||||||  | 
Sbjct: 14497849 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 14497790

                                                            
Query: 342      cccttatgcttctccctgttcttgatcacaccaacacgcccagt 385
                ||||| ||||||||||||||||| || || |||||||| |||||
Sbjct: 14497789 cccttgtgcttctccctgttcttaattactccaacacgaccagt 14497746
to top
>dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0514H03
          Length = 167230

 Score =  143 bits (72), Expect = 5e-31
 Identities = 186/224 (83%)
 Strand = Plus / Minus

                                                                         
Query: 162   gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggggagcttgata 221
             |||||||||||||| || ||||| | ||||||||| ||||| ||||||  ||||||||||
Sbjct: 57282 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 57223

                                                                         
Query: 222   cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 281
             ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 57222 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 57163

                                                                         
Query: 282   cccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaaggtt 341
             |||| ||||||||| ||    || |||   || ||||| ||  |||||||||||||  | 
Sbjct: 57162 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 57103

                                                         
Query: 342   cccttatgcttctccctgttcttgatcacaccaacacgcccagt 385
             ||||| ||||||||||||||||| || || |||||||| |||||
Sbjct: 57102 cccttgtgcttctccctgttcttaattactccaacacgaccagt 57059
to top
>dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C06, full
           insert sequence
          Length = 1035

 Score =  143 bits (72), Expect = 5e-31
 Identities = 186/224 (83%)
 Strand = Plus / Minus

                                                                       
Query: 162 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggggagcttgata 221
           |||||||||||||| || ||||| | ||||||||| ||||| ||||||  ||||||||||
Sbjct: 875 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 816

                                                                       
Query: 222 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 281
           ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 815 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 756

                                                                       
Query: 282 cccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtctcaaaggtt 341
           |||| ||||||||| ||    || |||   || ||||| ||  |||||||||||||  | 
Sbjct: 755 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 696

                                                       
Query: 342 cccttatgcttctccctgttcttgatcacaccaacacgcccagt 385
           ||||| ||||||||||||||||| || || |||||||| |||||
Sbjct: 695 cccttgtgcttctccctgttcttaattactccaacacgaccagt 652
to top
>gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4 (RPS4) mRNA, complete cds
          Length = 1086

 Score =  125 bits (63), Expect = 1e-25
 Identities = 141/167 (84%)
 Strand = Plus / Minus

                                                                       
Query: 213 agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
           ||||||||||| || |||||||| ||   ||||||||| || || |||||||||||||||
Sbjct: 771 agcttgatacctttccccttgggaagagacacccaaggttttgtacccttgccaatggtg 712

                                                                       
Query: 273 aacacgttgcccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatggtc 332
           ||||| || || |  || || ||||||| ||||||   |||||||| |||| ||||||||
Sbjct: 711 aacacattaccaagccgagtagcaaactcgtgaccagtggcatcctgaacgtggatggtc 652

                                                          
Query: 333 tcaaaggttcccttatgcttctccctgttcttgatcacaccaacacg 379
           |||||| ||||||||||||||||||||||||| || || ||||||||
Sbjct: 651 tcaaagcttcccttatgcttctccctgttcttaatgactccaacacg 605
to top
>gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete sequence
          Length = 128856

 Score =  119 bits (60), Expect = 7e-24
 Identities = 120/140 (85%)
 Strand = Plus / Minus

                                                                         
Query: 243   acccaaggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggcaaactgg 302
             ||||| ||||| || ||||||||||| |||||||| ||| ||| ||| || |||||||  
Sbjct: 83652 acccatggctttgtccccttgccaatagtgaacacattgaccagacgagttgcaaactca 83593

                                                                         
Query: 303   tgaccctgggcatcctcaacggggatggtctcaaaggttcccttatgcttctccctgttc 362
             |||||   |||||||| |||| |||| ||||||||||||||||||||||| || ||||||
Sbjct: 83592 tgaccagtggcatcctgaacgtggattgtctcaaaggttcccttatgcttttctctgttc 83533

                                 
Query: 363   ttgatcacaccaacacgccc 382
             |||||||| |||||||||||
Sbjct: 83532 ttgatcactccaacacgccc 83513
to top
>ref|XM_475130.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 738

 Score =  117 bits (59), Expect = 3e-23
 Identities = 152/183 (83%)
 Strand = Plus / Minus

                                                                       
Query: 188 cttcctctgctcctcaatgatggggagcttgatacccttgcccttggggaggctcaccca 247
           |||||||  |||||||||||||  ||||||||| |||||||||||||||||    |||||
Sbjct: 708 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 649

                                                                       
Query: 248 aggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggcaaactggtgacc 307
            |||||  |  ||||||| |||||||| ||||||||||  || || || |||||||| ||
Sbjct: 648 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 589

                                                                       
Query: 308 ctgggcatcctcaacggggatggtctcaaaggttcccttatgcttctccctgttcttgat 367
             |||||||||| ||  |||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 588 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 529

              
Query: 368 cac 370
           |||
Sbjct: 528 cac 526
to top
>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07,
             complete sequence
          Length = 159932

 Score =  117 bits (59), Expect = 3e-23
 Identities = 152/183 (83%)
 Strand = Plus / Minus

                                                                         
Query: 188   cttcctctgctcctcaatgatggggagcttgatacccttgcccttggggaggctcaccca 247
             |||||||  |||||||||||||  ||||||||| |||||||||||||||||    |||||
Sbjct: 81033 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 80974

                                                                         
Query: 248   aggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggcaaactggtgacc 307
              |||||  |  ||||||| |||||||| ||||||||||  || || || |||||||| ||
Sbjct: 80973 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 80914

                                                                         
Query: 308   ctgggcatcctcaacggggatggtctcaaaggttcccttatgcttctccctgttcttgat 367
               |||||||||| ||  |||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 80913 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 80854

                
Query: 368   cac 370
             |||
Sbjct: 80853 cac 80851
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  117 bits (59), Expect = 3e-23
 Identities = 152/183 (83%)
 Strand = Plus / Minus

                                                                            
Query: 188      cttcctctgctcctcaatgatggggagcttgatacccttgcccttggggaggctcaccca 247
                |||||||  |||||||||||||  ||||||||| |||||||||||||||||    |||||
Sbjct: 17551228 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 17551169

                                                                            
Query: 248      aggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggcaaactggtgacc 307
                 |||||  |  ||||||| |||||||| ||||||||||  || || || |||||||| ||
Sbjct: 17551168 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 17551109

                                                                            
Query: 308      ctgggcatcctcaacggggatggtctcaaaggttcccttatgcttctccctgttcttgat 367
                  |||||||||| ||  |||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 17551108 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 17551049

                   
Query: 368      cac 370
                |||
Sbjct: 17551048 cac 17551046
to top
>dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023123J20, full
           insert sequence
          Length = 1162

 Score =  117 bits (59), Expect = 3e-23
 Identities = 152/183 (83%)
 Strand = Plus / Minus

                                                                       
Query: 188 cttcctctgctcctcaatgatggggagcttgatacccttgcccttggggaggctcaccca 247
           |||||||  |||||||||||||  ||||||||| |||||||||||||||||    |||||
Sbjct: 860 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 801

                                                                       
Query: 248 aggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggcaaactggtgacc 307
            |||||  |  ||||||| |||||||| ||||||||||  || || || |||||||| ||
Sbjct: 800 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 741

                                                                       
Query: 308 ctgggcatcctcaacggggatggtctcaaaggttcccttatgcttctccctgttcttgat 367
             |||||||||| ||  |||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 740 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 681

              
Query: 368 cac 370
           |||
Sbjct: 680 cac 678
to top
>gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, complete cds
          Length = 1054

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 249 ggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggcaaactggtgaccc 308
           ||||| |||||||||||||| |||||||| |||||||  || || ||||| |  || || 
Sbjct: 798 ggctttgtgcccttgccaatagtgaacacattgcccatgcgagtagcaaattcatgtcca 739

                                                                       
Query: 309 tgggcatcctcaacggggatggtctcaaaggttcccttatgcttctccctgttcttgatc 368
             || |||||  ||| | || ||||||||| | |||||||||||||||||||||||||||
Sbjct: 738 gtggaatcctgcacgtgaattgtctcaaagctacccttatgcttctccctgttcttgatc 679

                         
Query: 369 acaccaacacgccc 382
           || |||||||||||
Sbjct: 678 actccaacacgccc 665
to top
>emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal protein S4
          Length = 966

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 243 acccaaggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggcaaactgg 302
           ||||| ||||| || ||||| ||||  |||||||| || |||||||| || ||||| |  
Sbjct: 756 acccacggcttagtacccttaccaagagtgaacacatttcccaaacgtgtagcaaattca 697

                                                                       
Query: 303 tgaccctgggcatcctcaacggggatggtctcaaaggttcccttatgcttctccctgttc 362
           |||||||| | ||||| || | ||| |||||||||| | |||||||||||||||||||||
Sbjct: 696 tgaccctgtgaatcctgaatgtggagggtctcaaagctacccttatgcttctccctgttc 637

                         
Query: 363 ttgatcacaccaac 376
           || || ||||||||
Sbjct: 636 ttaataacaccaac 623
to top
>gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal protein S4-like
           protein mRNA, complete cds
          Length = 1052

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 243 acccaaggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggcaaactgg 302
           ||||| ||||| || ||||| ||||  |||||||| || |||||||| || ||||| |  
Sbjct: 739 acccacggcttagtacccttaccaagagtgaacacatttcccaaacgtgtagcaaattca 680

                                                                       
Query: 303 tgaccctgggcatcctcaacggggatggtctcaaaggttcccttatgcttctccctgttc 362
           |||||||| | ||| | || | ||| |||||||||| | |||||||||||||||||||||
Sbjct: 679 tgaccctgtgaatcttgaatgtggagggtctcaaagctacccttatgcttctccctgttc 620

                         
Query: 363 ttgatcacaccaac 376
           || || ||||||||
Sbjct: 619 ttaataacaccaac 606
to top
>dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, complete cds
          Length = 1105

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 151/189 (79%)
 Strand = Plus / Minus

                                                                       
Query: 197 ctcctcaatgatggggagcttgatacccttgcccttggggaggctcacccaaggcttggt 256
           ||||||||||||||  |  |||||||||||||||||||| ||   |||||| ||||| ||
Sbjct: 840 ctcctcaatgatggttaatttgatacccttgcccttgggaagagacacccatggctttgt 781

                                                                       
Query: 257 gcccttgccaatggtgaacacgttgcccaaacgggtggcaaactggtgaccctgggcatc 316
            || || || ||||| || || ||||| | ||| || ||||||| ||||||  ||| |||
Sbjct: 780 accttttccgatggtaaaaacattgcctagacgagtagcaaactcgtgaccaagggaatc 721

                                                                       
Query: 317 ctcaacggggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaac 376
           || || | | |  ||||| ||| | |||||||| ||||||||||||||||| || |||||
Sbjct: 720 ctgaatgtgaacagtctcgaagctccccttatgtttctccctgttcttgataactccaac 661

                    
Query: 377 acgcccagt 385
            ||||||||
Sbjct: 660 tcgcccagt 652
to top
>ref|NM_125228.3| Arabidopsis thaliana structural constituent of ribosome AT5G58420
           mRNA, complete cds
          Length = 1080

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 718 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 661



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 213 agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
           ||||||||||| ||||||||||| ||   |||||| ||||| || || ||||||||||||
Sbjct: 830 agcttgatacctttgcccttgggaagagacacccatggctttgttcctttgccaatggtg 771

                         
Query: 273 aacacgttgcccaa 286
            |||| || |||||
Sbjct: 770 tacacattacccaa 757
to top
>gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, complete cds
          Length = 789

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 625 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 568



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 213 agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
           ||||||||||| ||||||||||| ||   |||||| ||||| || || ||||||||||||
Sbjct: 737 agcttgatacctttgcccttgggaagagacacccatggctttgttcctttgccaatggtg 678

                         
Query: 273 aacacgttgcccaa 286
            |||| || |||||
Sbjct: 677 tacacattacccaa 664
to top
>gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds
          Length = 995

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 698 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 641



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 213 agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
           ||||||||||| ||||||||||| ||   |||||| ||||| || || ||||||||||||
Sbjct: 810 agcttgatacctttgcccttgggaagagacacccatggctttgttcctttgccaatggtg 751

                         
Query: 273 aacacgttgcccaa 286
            |||| || |||||
Sbjct: 750 tacacattacccaa 737
to top
>gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds
          Length = 1005

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 709 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 652



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 213 agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
           ||||||||||| ||||||||||| ||   |||||| ||||| || || ||||||||||||
Sbjct: 821 agcttgatacctttgcccttgggaagagacacccatggctttgttcctttgccaatggtg 762

                         
Query: 273 aacacgttgcccaa 286
            |||| || |||||
Sbjct: 761 tacacattacccaa 748
to top
>emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 978

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 719 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 662



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 213 agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
           ||||||||||| ||||||||||| ||   |||||| ||||| || || ||||||||||||
Sbjct: 831 agcttgatacctttgcccttgggaagagacacccatggctttgttcctttgccaatggtg 772

                         
Query: 273 aacacgttgcccaa 286
            |||| || |||||
Sbjct: 771 tacacattacccaa 758
to top
>emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZB04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||||||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 623 ggattgtctcaaaggttcccttatgcttttcacggttcttaatcacacccacacgccc 566
to top
>emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZH10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 537

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 238 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 181



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 213 agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
           ||||||||||| ||||||||||| ||   |||||| ||||| || || ||||||||||||
Sbjct: 350 agcttgatacctttgcccttgggaagagacacccatggctttgttcctttgccaatggtg 291

                         
Query: 273 aacacgttgcccaa 286
            |||| || |||||
Sbjct: 290 tacacattacccaa 277
to top
>emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZD03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 988

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 689 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 632



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 213 agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
           ||||||||||| ||||||||||| ||   |||||| ||||| || || ||||||||||||
Sbjct: 801 agcttgatacctttgcccttgggaagagacacccatggctttgttcctttgccaatggtg 742

                         
Query: 273 aacacgttgcccaa 286
            |||| || |||||
Sbjct: 741 tacacattacccaa 728
to top
>emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB61ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 737

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 438 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 381



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 213 agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
           ||||||||||| ||||||||||| ||   |||||| ||||| || || ||||||||||||
Sbjct: 550 agcttgatacctttgcccttgggaagagacacccatggctttgttcctttgccaatggtg 491

                         
Query: 273 aacacgttgcccaa 286
            |||| || |||||
Sbjct: 490 tacacattacccaa 477
to top
>emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB12ZD07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 566

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 267 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 210



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 213 agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
           ||||||||||| ||||||||||| ||   |||||| ||||| || || ||||||||||||
Sbjct: 379 agcttgatacctttgcccttgggaagagacacccatggctttgttcctttgccaatggtg 320

                         
Query: 273 aacacgttgcccaa 286
            |||| || |||||
Sbjct: 319 tacacattacccaa 306
to top
>emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZG11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 997

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 698 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 641



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 213 agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
           ||||||||||| ||||||||||| ||   |||||| ||||| || || ||||||||||||
Sbjct: 810 agcttgatacctttgcccttgggaagagacacccatggctttgttcctttgccaatggtg 751

                         
Query: 273 aacacgttgcccaa 286
            |||| || |||||
Sbjct: 750 tacacattacccaa 737
to top
>gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete sequence
          Length = 1010

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 713 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 656



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                       
Query: 213 agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
           ||||||||||| ||||||||||| ||   |||||| ||||| || || ||||||||||||
Sbjct: 825 agcttgatacctttgcccttgggaagagacacccatggctttgttcctttgccaatggtg 766

                         
Query: 273 aacacgttgcccaa 286
            |||| || |||||
Sbjct: 765 tacacattacccaa 752
to top
>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2
          Length = 51440

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 325  ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
            |||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 6770 ggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 6713



 Score = 52.0 bits (26), Expect = 0.001
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                        
Query: 213  agcttgatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtg 272
            ||||||||||| ||||||||||| ||   |||||| ||||| || || ||||||||||||
Sbjct: 6882 agcttgatacctttgcccttgggaagagacacccatggctttgttcctttgccaatggtg 6823

                          
Query: 273  aacacgttgcccaa 286
             |||| || |||||
Sbjct: 6822 tacacattacccaa 6809
to top
>gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA
          Length = 992

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 249 ggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggc 295
           |||||| |||||||||||||| |||||||||||  ||||||||||||
Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 767
to top
>ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG11276-RA, transcript
           variant A (RpS4), mRNA
          Length = 983

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 249 ggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggc 295
           |||||| |||||||||||||| |||||||||||  ||||||||||||
Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 767
to top
>ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG11276-RB, transcript
           variant B (RpS4), mRNA
          Length = 969

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 249 ggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggc 295
           |||||| |||||||||||||| |||||||||||  ||||||||||||
Sbjct: 799 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 753
to top
>gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 207761

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                             
Query: 249    ggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggc 295
              |||||| |||||||||||||| |||||||||||  ||||||||||||
Sbjct: 141932 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 141886
to top
>gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46 of 83 of the complete
              sequence
          Length = 272016

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                             
Query: 249    ggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggc 295
              |||||| |||||||||||||| |||||||||||  ||||||||||||
Sbjct: 169866 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 169820
to top
>dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribosomal protein S4,
           complete cds
          Length = 870

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                          
Query: 249 ggcttggtgcccttgccaatggtgaacacgttgcccaaacgggtggc 295
           |||||| |||||||||||||| |||||||||||  ||||||||||||
Sbjct: 713 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 667
to top
>ref|NM_001036769.1| Arabidopsis thaliana structural constituent of ribosome AT5G07090
           transcript variant AT5G07090.2 mRNA, complete cds
          Length = 1174

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 737 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 680
to top
>ref|NM_120791.2| Arabidopsis thaliana structural constituent of ribosome AT5G07090
           transcript variant AT5G07090.1 mRNA, complete cds
          Length = 1088

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 652 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595
to top
>gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090)
           mRNA, complete cds
          Length = 820

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 625 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568
to top
>gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090)
           mRNA, complete cds
          Length = 1059

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 649 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592
to top
>emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, BAC clone T28J14 (ESSA
            project)
          Length = 104607

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                      
Query: 325  ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
            |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 7894 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 7837
to top
>gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds
          Length = 789

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 625 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568
to top
>gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds
          Length = 1008

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 649 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592
to top
>emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH32ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1168

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 356 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 413
to top
>emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZG07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 976

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 619 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 562
to top
>emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZD04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 942

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 623 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 566
to top
>emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZC05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 952

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 612 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 555
to top
>gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete sequence
          Length = 1011

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 652 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595
to top
>dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9
          Length = 86380

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                       
Query: 325   ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
             |||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 82617 ggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 82560
to top
>gb|AY110862.1| Zea mays CL1882_8 mRNA sequence
          Length = 728

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcac 370
           |||||||||| ||| | ||||| |||||||||||||||||||||||
Sbjct: 487 ggatggtctcgaagctgcccttgtgcttctccctgttcttgatcac 442



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 350 cttctccctgttcttgatcacaccaacacgccc 382
           ||||||||||||||||||||| || ||||||||
Sbjct: 429 cttctccctgttcttgatcactcctacacgccc 397
to top
>emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal protein small subunit 4e
          Length = 1090

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 327 atggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacg 379
           |||||||||||| | |||||||||||||||||||| || || || ||||||||
Sbjct: 678 atggtctcaaagctacccttatgcttctccctgtttttaattactccaacacg 626
to top
>gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence
          Length = 1292

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 gtgaacacgttgcccaaacgggtggcaaactggtgaccctgggcatcctcaacggggatg 329
           |||||||| || ||||||||||| |||||||  || ||| ||| ||||| || | | |  
Sbjct: 760 gtgaacacatttcccaaacgggtagcaaactcatgccccagggaatcctgaatgtgaact 701

                                              
Query: 330 gtctcaaaggttcccttatgcttctccctgttctt 364
           ||||||||| | ||||| |||||||||||||||||
Sbjct: 700 gtctcaaagctacccttgtgcttctccctgttctt 666
to top
>dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJG14
          Length = 86121

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 52/59 (88%), Gaps = 1/59 (1%)
 Strand = Plus / Plus

                                                                        
Query: 325   ggatggtctcaaaggttcccttatgcttctcc-ctgttcttgatcacaccaacacgccc 382
             |||||||||||||| ||||||| || || | | | ||||||||||||||||||||||||
Sbjct: 15625 ggatggtctcaaagcttcccttttgttttttcacggttcttgatcacaccaacacgccc 15683
to top
>ref|NM_127291.2| Arabidopsis thaliana structural constituent of ribosome AT2G17360
           mRNA, complete cds
          Length = 1074

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 738 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 681
to top
>gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360)
           mRNA, complete cds
          Length = 817

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 625 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 568
to top
>gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360)
           mRNA, complete cds
          Length = 1032

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 697 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 640
to top
>gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 813

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 625 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 568
to top
>gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 1034

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 698 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 641
to top
>emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH41ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1000

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 683 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 626
to top
>emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZB04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1007

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 690 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 633
to top
>emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL68ZB07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 984

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||| | ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 623 ggattgtctcaaggcttcccttatgcttttcacggttcttaatcacacccacacgccc 566
to top
>emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 934

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||| ||||||| | |||||||||||||||| | |||||  |||||||| ||||||||
Sbjct: 623 ggattgtctcaacgcttcccttatgcttctcacggttctgaatcacacccacacgccc 566
to top
>gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete sequence
          Length = 1023

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                     
Query: 325 ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 738 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 681
to top
>gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II section 100 of 255 of the complete
             sequence. Sequence from clones T23A1, F5J6, MJB20
          Length = 76170

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                       
Query: 325   ggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
             ||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 48794 ggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 48737
to top
>ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predicted mRNA
          Length = 783

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 207 atggggagcttgatacccttgcccttggg 235
           |||| ||||||||||||||||||||||||
Sbjct: 743 atggagagcttgatacccttgcccttggg 715
to top
>gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 (RPS7) mRNA, complete cds
          Length = 852

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 207 atggggagcttgatacccttgcccttggg 235
           |||| ||||||||||||||||||||||||
Sbjct: 745 atggagagcttgatacccttgcccttggg 717
to top
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 207     atggggagcttgatacccttgcccttggg 235
               |||| ||||||||||||||||||||||||
Sbjct: 1601891 atggagagcttgatacccttgcccttggg 1601919
to top
>ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein
           (MG02747.4) partial mRNA
          Length = 735

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 196 gctcctcaatgatggggagcttgatacccttgcccttggg 235
           ||||||||  ||||| |||||||| |||||||||||||||
Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658
to top
>ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein
           (FG08714.1) partial mRNA
          Length = 732

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 196 gctcctcaatgatggggagcttgatacccttgcccttggg 235
           ||||||||  ||||| |||||||| |||||||||||||||
Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658
to top
>gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putative ribosomal
           protein S4e mRNA, complete cds
          Length = 792

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 249 ggcttggtgcccttgccaatggtgaacacgtt 280
           ||||||||||||||||||||| |||| |||||
Sbjct: 701 ggcttggtgcccttgccaatgatgaagacgtt 670
to top
>gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-like protein mRNA,
           complete cds
          Length = 1024

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 196 gctcctcaatgatggggagcttgatacccttgcccttggg 235
           ||||||||  ||||| |||||||| |||||||||||||||
Sbjct: 766 gctcctcagcgatggtgagcttgacacccttgcccttggg 727
to top
>emb|BX067601.1|CNS09OBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 251 cttggtgcccttgccaatggtgaacacgtt 280
           |||||||| |||||| ||||||||||||||
Sbjct: 282 cttggtgctcttgccgatggtgaacacgtt 311
to top
>emb|BX067600.1|CNS09OBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 251 cttggtgcccttgccaatggtgaacacgtt 280
           |||||||| |||||| ||||||||||||||
Sbjct: 712 cttggtgctcttgccgatggtgaacacgtt 683
to top
>gb|DQ362415.1| Shigella dysenteriae strain G1274 GcvT (gcvT) gene, partial cds
          Length = 416

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 41  ggttcgcaaatcaacaaacatcaggc 66
           |||||||||||| |||||||||||||
Sbjct: 88  ggttcgcaaatcgacaaacatcaggc 113
to top
>gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosome 13, complete sequence
          Length = 149455

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 229    ccttggggaggctcacccaag 249
              |||||||||||||||||||||
Sbjct: 134897 ccttggggaggctcacccaag 134877
to top
>ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4794.2), mRNA
          Length = 720

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 207 atggggagcttgatacccttgcccttggg 235
           |||| |||||||| |||||||||||||||
Sbjct: 674 atggagagcttgacacccttgcccttggg 646
to top
>gb|AC163608.2| Mus musculus chromosome 1, clone RP24-185M14, complete sequence
          Length = 161555

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 92    aacatagttctatatccttgcaaat 116
             |||||||||||||| ||||||||||
Sbjct: 67573 aacatagttctatacccttgcaaat 67549
to top
>gb|AC101994.3| Mus musculus chromosome 1, clone RP24-406F14, complete sequence
          Length = 164170

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 92     aacatagttctatatccttgcaaat 116
              |||||||||||||| ||||||||||
Sbjct: 104588 aacatagttctatacccttgcaaat 104564
to top
>gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete sequence
          Length = 124792

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 351    ttctccctgttcttgatcaca 371
              |||||||||||||||||||||
Sbjct: 120862 ttctccctgttcttgatcaca 120842
to top
>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020
          Length = 1824958

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 215    cttgatacccttgcccttggggagg 239
              ||||| |||||||||||||||||||
Sbjct: 775952 cttgacacccttgcccttggggagg 775976
to top
>emb|BX818793.1|CNS0A8YY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 966

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 326 gatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 382
           |||||| |||||| | ||||| |  ||||| | |||||| |||||||||||||||||
Sbjct: 689 gatggtttcaaagctacccttgtttttctcacggttcttaatcacaccaacacgccc 633
to top
>gb|BC081584.1| Danio rerio ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:92076 IMAGE:7046733), complete cds
          Length = 888

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 242 cacccaaggcttggtgcccttgccaatg 269
           |||||| |||||| ||||||||||||||
Sbjct: 715 cacccatggcttgttgcccttgccaatg 688
to top
>ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1), mRNA
          Length = 2945

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 263  gccaatggtgaacacgttgc 282
            ||||||||||||||||||||
Sbjct: 1770 gccaatggtgaacacgttgc 1789
to top
>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
               sequence
          Length = 2300533

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 212     gagcttgatacccttgcccttggg 235
               |||||||| |||||||||||||||
Sbjct: 1677741 gagcttgacacccttgcccttggg 1677718
to top
>gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, complete sequence
          Length = 197827

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 188   cttcctctgctcctcaatga 207
             ||||||||||||||||||||
Sbjct: 23788 cttcctctgctcctcaatga 23769
to top
>gb|AC145590.3| Mus musculus BAC clone RP24-175D4 from chromosome 19, complete sequence
          Length = 179063

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 192    ctctgctcctcaatgatggg 211
              ||||||||||||||||||||
Sbjct: 127740 ctctgctcctcaatgatggg 127721
to top
>gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence
          Length = 160031

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 183   tccctcttcctctgctcctc 202
             ||||||||||||||||||||
Sbjct: 75373 tccctcttcctctgctcctc 75392
to top
>gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, complete sequence
          Length = 184893

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     aaacatccacattacatcta 28
             ||||||||||||||||||||
Sbjct: 87241 aaacatccacattacatcta 87260
to top
>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence
          Length = 243671

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 83     ggttccaggaacatagttct 102
              ||||||||||||||||||||
Sbjct: 192051 ggttccaggaacatagttct 192032
to top
>ref|XM_567206.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNA06200) partial mRNA
          Length = 840

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 212 gagcttgatacccttgcccttggg 235
           |||||||| |||||||||||||||
Sbjct: 738 gagcttgacacccttgcccttggg 715
to top
>gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome 18, complete sequence
          Length = 156239

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 186   ctcttcctctgctcctcaat 205
             ||||||||||||||||||||
Sbjct: 47354 ctcttcctctgctcctcaat 47335
to top
>ref|NM_001005589.1| Danio rerio ribosomal protein S4, X-linked (rps4x), mRNA
          Length = 888

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 242 cacccaaggcttggtgcccttgccaatg 269
           |||||| |||||| ||||||||||||||
Sbjct: 715 cacccatggcttgttgcccttgccaatg 688
to top
>gb|AC133904.9| Mus musculus chromosome 19, clone RP24-143J12, complete sequence
          Length = 163882

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    ctctgctcctcaatgatggg 211
              ||||||||||||||||||||
Sbjct: 101453 ctctgctcctcaatgatggg 101472
to top
>gb|AC158778.4| Mus musculus chromosome 19, clone RP24-90P13, complete sequence
          Length = 167819

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 192  ctctgctcctcaatgatggg 211
            ||||||||||||||||||||
Sbjct: 2741 ctctgctcctcaatgatggg 2722
to top
>emb|Z68908.1|HSU227D1 Human DNA sequence from clone LL0XNC01-227D1 on chromosome X Contains
             part of the IL1RAPL2 gene for interleukin 1 receptor
             accessory protein-like 2, complete sequence
          Length = 33667

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 335   aaaggttcccttatgcttct 354
             ||||||||||||||||||||
Sbjct: 13597 aaaggttcccttatgcttct 13578
to top
>ref|XM_505600.1| Yarrowia lipolytica CLIB122, YALI0F18920g predicted mRNA
          Length = 1485

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 188  cttcctctgctcctcaatga 207
            ||||||||||||||||||||
Sbjct: 1026 cttcctctgctcctcaatga 1007
to top
>ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus similar to CG11276-PA,
           isoform A (LOC583495), partial mRNA
          Length = 285

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 273 aacacgttgcccaaacgggtggca 296
           ||||||||||||| ||||||||||
Sbjct: 179 aacacgttgcccagacgggtggca 156
to top
>ref|XM_795025.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC581083 (LOC581083), mRNA
          Length = 1197

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 183 tccctcttcctctgctcctc 202
           ||||||||||||||||||||
Sbjct: 764 tccctcttcctctgctcctc 745
to top
>emb|AJ719272.1| Gallus gallus mRNA for hypothetical protein, clone 1a13
          Length = 2945

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 263  gccaatggtgaacacgttgc 282
            ||||||||||||||||||||
Sbjct: 1770 gccaatggtgaacacgttgc 1789
to top
>emb|BX293994.28| Zebrafish DNA sequence from clone DKEY-256K14 in linkage group 10,
             complete sequence
          Length = 210640

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 187   tcttcctctgctcctcaatg 206
             ||||||||||||||||||||
Sbjct: 25208 tcttcctctgctcctcaatg 25189
to top
>gb|AC009806.9| Homo sapiens chromosome 11, clone RP11-51B23, complete sequence
          Length = 175223

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     cttaaaaaagatggttccag 90
              ||||||||||||||||||||
Sbjct: 158366 cttaaaaaagatggttccag 158385
to top
>gb|AC007437.16| Homo sapiens 12q22 BAC RPCI11-541G9 (Roswell Park Cancer Institute
             Human BAC Library) complete sequence
          Length = 179854

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 234   gggaggctcacccaaggcttggtg 257
             |||||||||||||||| |||||||
Sbjct: 12827 gggaggctcacccaagccttggtg 12850
to top
>gb|AC007656.2| Homo sapiens 12q22 BAC RPCI11-534P6 (Rowswell Park Cancer Institute Human
              BAC Library) complete sequence
          Length = 171236

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 234    gggaggctcacccaaggcttggtg 257
              |||||||||||||||| |||||||
Sbjct: 157441 gggaggctcacccaagccttggtg 157464
to top
>gb|AC150660.4| Mus musculus BAC clone RP23-41F9 from chromosome 15, complete sequence
          Length = 229655

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 299   ctggtgaccctgggcatcct 318
             ||||||||||||||||||||
Sbjct: 49823 ctggtgaccctgggcatcct 49842
to top
>gb|AC133282.7| Mus musculus chromosome 15, clone RP24-408B1, complete sequence
          Length = 183129

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 299   ctggtgaccctgggcatcct 318
             ||||||||||||||||||||
Sbjct: 12843 ctggtgaccctgggcatcct 12824
to top
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 315     tcctcaacggggatggtctc 334
               ||||||||||||||||||||
Sbjct: 6619133 tcctcaacggggatggtctc 6619152
to top
>emb|BX950204.17| Zebrafish DNA sequence from clone DKEY-252P7 in linkage group 18,
             complete sequence
          Length = 133263

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 99    ttctatatccttgcaaataa 118
             ||||||||||||||||||||
Sbjct: 58177 ttctatatccttgcaaataa 58196
to top
>emb|BX927103.12| Zebrafish DNA sequence from clone DKEY-262M23 in linkage group 18,
              complete sequence
          Length = 185008

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 99     ttctatatccttgcaaataa 118
              ||||||||||||||||||||
Sbjct: 130673 ttctatatccttgcaaataa 130692
to top
>gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, complete sequence
          Length = 260404

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 9    aaacatccacattacatcta 28
            ||||||||||||||||||||
Sbjct: 1569 aaacatccacattacatcta 1550
to top
>emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1078H9 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 228097

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 186   ctcttcctctgctcctcaat 205
             ||||||||||||||||||||
Sbjct: 63018 ctcttcctctgctcctcaat 62999
to top
>gb|AC151990.6| Mus musculus BAC clone RP23-299K14 from chromosome 18, complete
             sequence
          Length = 205253

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 186   ctcttcctctgctcctcaat 205
             ||||||||||||||||||||
Sbjct: 62232 ctcttcctctgctcctcaat 62251
to top
>gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, complete sequence
          Length = 188713

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     aaacatccacattacatcta 28
             ||||||||||||||||||||
Sbjct: 16088 aaacatccacattacatcta 16069
to top
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 275     cacgttgcccaaacgggtgg 294
               ||||||||||||||||||||
Sbjct: 2097360 cacgttgcccaaacgggtgg 2097341
to top
>gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, complete sequence
          Length = 113482

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 83    ggttccaggaacatagttct 102
             ||||||||||||||||||||
Sbjct: 64196 ggttccaggaacatagttct 64177
to top
>gb|AC102003.5| Mus musculus chromosome 7, clone RP24-488I10, complete sequence
          Length = 150428

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 188    cttcctctgctcctcaatga 207
              ||||||||||||||||||||
Sbjct: 147440 cttcctctgctcctcaatga 147421
to top
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 188     cttcctctgctcctcaatga 207
               ||||||||||||||||||||
Sbjct: 2525910 cttcctctgctcctcaatga 2525929
to top
>emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chromosome 7, complete
              sequence
          Length = 215366

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 226    tgcccttggggaggctcacc 245
              ||||||||||||||||||||
Sbjct: 213316 tgcccttggggaggctcacc 213297
to top
>emb|AL139193.4|CNS01DXA Human chromosome 14 DNA sequence BAC R-661G16 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 162691

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 186   ctcttcctctgctcctcaat 205
             ||||||||||||||||||||
Sbjct: 27574 ctcttcctctgctcctcaat 27593


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,733,655
Number of Sequences: 3902068
Number of extensions: 3733655
Number of successful extensions: 90046
Number of sequences better than 10.0: 127
Number of HSP's better than 10.0 without gapping: 127
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 89670
Number of HSP's gapped (non-prelim): 368
length of query: 385
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 363
effective length of database: 17,147,199,772
effective search space: 6224433517236
effective search space used: 6224433517236
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top