ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbart57a08 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY343330.1| Triticum aestivum ribosomal protein L3 (RPL3) mRNA, RPL3-A1 allele, complete cds Length = 1170 Score = 436 bits (220), Expect = e-119 Identities = 259/272 (95%) Strand = Plus / Minus Query: 148 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 207 ||||||||||||| ||||||||||| |||||||||| || || |||||||| |||||||| Sbjct: 1170 ctaagccttgagcctgccgtagaacttctgcttctcgtcagtggtctggaaccggccatg 1111 Query: 208 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 267 |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1110 cccgaacttggatgaggtgtcgatgaacttgagcttgatctcctcaagggccaaccgcga 1051 Query: 268 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 327 |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 1050 ggtctgcttcaacagggactggcggagggtcaccactctcttcttggggcccacacagca 991 Query: 328 gcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| || Sbjct: 990 gcccttgatcatgaggtagtcacccttcaccacaccatagtgagggaagccacccatcgg 931 Query: 388 ggtgatgtccttctcagtcctgtcaaactcag 419 |||||||||||||||||||||||||||||||| Sbjct: 930 ggtgatgtccttctcagtcctgtcaaactcag 899
>gb|AY343327.1| Triticum aestivum ribosomal protein L3 (RPL3) mRNA, RPL3-A1 allele, complete cds Length = 1170 Score = 436 bits (220), Expect = e-119 Identities = 259/272 (95%) Strand = Plus / Minus Query: 148 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 207 ||||||||||||| ||||||||||| |||||||||| || || |||||||| |||||||| Sbjct: 1170 ctaagccttgagcctgccgtagaacttctgcttctcgtcagtggtctggaaccggccatg 1111 Query: 208 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 267 |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1110 cccgaacttggatgaggtgtcgatgaacttgagcttgatctcctcaagggccaaccgcga 1051 Query: 268 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 327 |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 1050 ggtctgcttcaacagggactggcggagggtcaccactctcttcttggggcccacacagca 991 Query: 328 gcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| || Sbjct: 990 gcccttgatcatgaggtagtcacccttcaccacaccatagtgagggaagccacccatcgg 931 Query: 388 ggtgatgtccttctcagtcctgtcaaactcag 419 |||||||||||||||||||||||||||||||| Sbjct: 930 ggtgatgtccttctcagtcctgtcaaactcag 899
>gb|AY347531.1| Triticum aestivum cultivar Falat ribosomal protein L3 (RPL3) mRNA, RPL3-A2 allele, complete cds Length = 1170 Score = 420 bits (212), Expect = e-114 Identities = 257/272 (94%) Strand = Plus / Minus Query: 148 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 207 ||||||||||||||||||||||||| |||||||||| ||||| |||||||| |||||||| Sbjct: 1170 ctaagccttgagcttgccgtagaacttctgcttctcgtcggtggtctggaaccggccatg 1111 Query: 208 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 267 || ||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1110 cccaaactttgatgaggtgtcgatgaacttgagcttgatctcctcaagggccaaccgcga 1051 Query: 268 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 327 |||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 1050 cgtctgctttaacagggactggcggagggtcaccactctcttcttggggcccacacagca 991 Query: 328 gcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| || Sbjct: 990 gcccttgatcatgaggtagtcacccttcaccacaccatagtgagggaagccacccatcgg 931 Query: 388 ggtgatgtccttctcagtcctgtcaaactcag 419 |||||||||||||||||||||||||||||||| Sbjct: 930 ggtgatgtccttctcagtcctgtcaaactcag 899
>gb|AY343328.1| Triticum aestivum ribosomal protein L3 (RPL3) mRNA, RPL3-A2 allele, complete cds Length = 1170 Score = 420 bits (212), Expect = e-114 Identities = 257/272 (94%) Strand = Plus / Minus Query: 148 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 207 ||||||||||||||||||||||||| |||||||||| ||||| |||||||| |||||||| Sbjct: 1170 ctaagccttgagcttgccgtagaacttctgcttctcgtcggtggtctggaaccggccatg 1111 Query: 208 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 267 || ||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1110 cccaaactttgatgaggtgtcgatgaacttgagcttgatctcctcaagggccaaccgcga 1051 Query: 268 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 327 |||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 1050 cgtctgctttaacagggactggcggagggtcaccactctcttcttggggcccacacagca 991 Query: 328 gcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| || Sbjct: 990 gcccttgatcatgaggtagtcacccttcaccacaccatagtgagggaagccacccatcgg 931 Query: 388 ggtgatgtccttctcagtcctgtcaaactcag 419 |||||||||||||||||||||||||||||||| Sbjct: 930 ggtgatgtccttctcagtcctgtcaaactcag 899
>dbj|AK101469.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033040J04, full insert sequence Length = 1403 Score = 341 bits (172), Expect = 1e-90 Identities = 247/272 (90%) Strand = Plus / Minus Query: 148 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 207 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 1246 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 1187 Query: 208 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 267 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 1186 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 1127 Query: 268 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 327 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 1126 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 1067 Query: 328 gcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| Sbjct: 1066 acccttgatcatgaggtagtcgcccttcacaacaccgtagtgagggaagccacccatggg 1007 Query: 388 ggtgatgtccttctcagtcctgtcaaactcag 419 |||||||||||||||||||||||||| |||| Sbjct: 1006 agtgatgtccttctcagtcctgtcaaattcag 975
>dbj|AK099225.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094A07, full insert sequence Length = 1433 Score = 341 bits (172), Expect = 1e-90 Identities = 247/272 (90%) Strand = Plus / Minus Query: 148 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 207 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 1224 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 1165 Query: 208 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 267 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 1164 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 1105 Query: 268 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 327 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 1104 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 1045 Query: 328 gcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| Sbjct: 1044 acccttgatcatgaggtagtcgcccttcacaacaccgtagtgagggaagccacccatggg 985 Query: 388 ggtgatgtccttctcagtcctgtcaaactcag 419 |||||||||||||||||||||||||| |||| Sbjct: 984 agtgatgtccttctcagtcctgtcaaattcag 953
>dbj|AK073392.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033041E13, full insert sequence Length = 1486 Score = 341 bits (172), Expect = 1e-90 Identities = 247/272 (90%) Strand = Plus / Minus Query: 148 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 207 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 1263 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 1204 Query: 208 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 267 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 1203 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 1144 Query: 268 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 327 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 1143 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 1084 Query: 328 gcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| Sbjct: 1083 acccttgatcatgaggtagtcgcccttcacaacaccgtagtgagggaagccacccatggg 1024 Query: 388 ggtgatgtccttctcagtcctgtcaaactcag 419 |||||||||||||||||||||||||| |||| Sbjct: 1023 agtgatgtccttctcagtcctgtcaaattcag 992
>gb|AC120527.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0011J22 map R10571S, complete sequence Length = 154441 Score = 329 bits (166), Expect = 4e-87 Identities = 238/262 (90%) Strand = Plus / Plus Query: 148 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 207 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 37785 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 37844 Query: 208 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 267 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 37845 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 37904 Query: 268 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 327 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 37905 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 37964 Query: 328 gcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| Sbjct: 37965 acccttgatcatgaggtagtcgcccttcacaacaccgtagtgagggaagccacccatggg 38024 Query: 388 ggtgatgtccttctcagtcctg 409 ||||||||||||||||||||| Sbjct: 38025 agtgatgtccttctcagtcctg 38046
>gb|AC147812.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0073K23 map near R10571S, complete sequence Length = 161073 Score = 329 bits (166), Expect = 4e-87 Identities = 238/262 (90%) Strand = Plus / Plus Query: 148 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 207 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 137086 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 137145 Query: 208 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 267 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 137146 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 137205 Query: 268 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 327 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 137206 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 137265 Query: 328 gcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| Sbjct: 137266 acccttgatcatgaggtagtcgcccttcacaacaccgtagtgagggaagccacccatggg 137325 Query: 388 ggtgatgtccttctcagtcctg 409 ||||||||||||||||||||| Sbjct: 137326 agtgatgtccttctcagtcctg 137347
>gb|AY257863.1| Oryza sativa (japonica cultivar-group) chromosome 11 genomic sequence Length = 42748 Score = 329 bits (166), Expect = 4e-87 Identities = 238/262 (90%) Strand = Plus / Minus Query: 148 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 207 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 31415 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 31356 Query: 208 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 267 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 31355 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 31296 Query: 268 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 327 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 31295 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 31236 Query: 328 gcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| Sbjct: 31235 acccttgatcatgaggtagtcgcccttcacaacaccgtagtgagggaagccacccatggg 31176 Query: 388 ggtgatgtccttctcagtcctg 409 ||||||||||||||||||||| Sbjct: 31175 agtgatgtccttctcagtcctg 31154
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 329 bits (166), Expect = 4e-87 Identities = 238/262 (90%) Strand = Plus / Minus Query: 148 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 207 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 3277200 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 3277141 Query: 208 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 267 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 3277140 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 3277081 Query: 268 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 327 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 3277080 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 3277021 Query: 328 gcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| Sbjct: 3277020 acccttgatcatgaggtagtcgcccttcacaacaccgtagtgagggaagccacccatggg 3276961 Query: 388 ggtgatgtccttctcagtcctg 409 ||||||||||||||||||||| Sbjct: 3276960 agtgatgtccttctcagtcctg 3276939
>gb|AF346004.1|AF346004 Lolium perenne L3 ribosomal protein mRNA, partial cds Length = 855 Score = 329 bits (166), Expect = 4e-87 Identities = 265/298 (88%) Strand = Plus / Minus Query: 120 aacactatgggataagatctgtcgcaacctaagccttgagcttgccgtagaacctctgct 179 ||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||||| Sbjct: 691 aacactatgggataagatctgcagcagtctaagccttgagcttgccgtagaacttctgct 632 Query: 180 tctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttga 239 |||| ||||| |||||||| || ||||| || ||||||||||||| ||| | ||||| | Sbjct: 631 tctcgtcggtggtctggaatcgaccatgcccaaacttggatgaggggtcaacaaacttaa 572 Query: 240 gcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtca 299 ||||||| ||||| || ||||| || || |||||||||| ||||||||||||||||| | Sbjct: 571 gcttgatctcctcgagagccaagcgggaagtctgcttcaggagggactggcggagggtaa 512 Query: 300 ccaccctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcacca 359 |||||||||||||||| ||||| || || ||||||||||||||||||||||||||||| | Sbjct: 511 ccaccctcttcttgggccccacacaacaacccttgatcatgaggtagtcacccttcacta 452 Query: 360 caccgtagtgagggaacccacccatgggggtgatgtccttctcagtcctgtcaaactc 417 |||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| Sbjct: 451 caccgtagtgggggaagccacccatgggagtgatgtccttctcagtcctgtcaaactc 394 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 28 gcagcagcagctcagagttgcaattgcaatgcataaaccggtacccaatcaatctgccac 87 |||| ||||||||||||| |||||||||||||||||||| |||| || ||||||||||| Sbjct: 775 gcagtagcagctcagagtggcaattgcaatgcataaaccagtacaaaaacaatctgccac 716 Query: 88 aaa 90 ||| Sbjct: 715 aaa 713
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 329 bits (166), Expect = 4e-87 Identities = 238/262 (90%) Strand = Plus / Minus Query: 148 ctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatg 207 ||||||||||||||||||| |||||||||| ||||| ||||| ||||||||||| || || Sbjct: 3285913 ctaagccttgagcttgccgaagaacctctgtttctcgtcggtggtctggaagcgaccgtg 3285854 Query: 208 tccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcga 267 ||||||||||| |||||||||||||||||||||||||| ||||| || ||||| || || Sbjct: 3285853 cccgaacttggacgaggtgtcgatgaacttgagcttgatctcctcgagcgccaaacgaga 3285794 Query: 268 ggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagca 327 ||||||||| | |||||||||||||||||| || ||||||||||||||||| || ||||| Sbjct: 3285793 ggtctgcttgagcagggactggcggagggtgacgaccctcttcttggggccaacacagca 3285734 Query: 328 gcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| Sbjct: 3285733 acccttgatcatgaggtagtcgcccttcacaacaccgtagtgagggaagccacccatggg 3285674 Query: 388 ggtgatgtccttctcagtcctg 409 ||||||||||||||||||||| Sbjct: 3285673 agtgatgtccttctcagtcctg 3285652
>dbj|AK060925.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-H11, full insert sequence Length = 1468 Score = 323 bits (163), Expect = 3e-85 Identities = 244/271 (90%) Strand = Plus / Minus Query: 147 cctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccat 206 |||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| || | Sbjct: 1234 cctaggccttgagcttgccgaagaacctctgcttctcgtcggtggtctggaagcgaccgt 1175 Query: 207 gtccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcg 266 | ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | ||||| Sbjct: 1174 gcccgaacttggacgaggtgtcgatgaacttgagcttgatctcctccagggcgagccgcg 1115 Query: 267 aggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagc 326 |||||||||||| ||| |||||||||||||| || || |||||||| || || ||||||| Sbjct: 1114 aggtctgcttcagcagcgactggcggagggtgacgactctcttcttcggaccgacgcagc 1055 Query: 327 agcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatgg 386 | |||||||||||||||||||| |||||||||||||||||||| ||||| || ||||| | Sbjct: 1054 aacccttgatcatgaggtagtcgcccttcaccacaccgtagtgcgggaagccgcccatcg 995 Query: 387 gggtgatgtccttctcagtcctgtcaaactc 417 ||||||||||||||||||||||||| ||||| Sbjct: 994 gggtgatgtccttctcagtcctgtcgaactc 964
>dbj|D12630.1|RICRPL3A Oryza sativa (japonica cultivar-group) mRNA for ribosomal protein L3, complete cds Length = 1368 Score = 323 bits (163), Expect = 3e-85 Identities = 244/271 (90%) Strand = Plus / Minus Query: 147 cctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccat 206 |||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| || | Sbjct: 1192 cctaggccttgagcttgccgaagaacctctgcttctcgtcggtggtctggaagcgaccgt 1133 Query: 207 gtccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcg 266 | ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | ||||| Sbjct: 1132 gcccgaacttggacgaggtgtcgatgaacttgagcttgatctcctccagggcgagccgcg 1073 Query: 267 aggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagc 326 |||||||||||| ||| |||||||||||||| || || |||||||| || || ||||||| Sbjct: 1072 aggtctgcttcagcagcgactggcggagggtgacgactctcttcttcggaccgacgcagc 1013 Query: 327 agcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatgg 386 | |||||||||||||||||||| |||||||||||||||||||| ||||| || ||||| | Sbjct: 1012 aacccttgatcatgaggtagtcgcccttcaccacaccgtagtgcgggaagccgcccatcg 953 Query: 387 gggtgatgtccttctcagtcctgtcaaactc 417 ||||||||||||||||||||||||| ||||| Sbjct: 952 gggtgatgtccttctcagtcctgtcgaactc 922
>gb|AY347533.1| Triticum aestivum cultivar LI ribosomal protein L3 (RPL3) mRNA, RPL3-B3 allele, complete cds Length = 1170 Score = 317 bits (160), Expect = 2e-83 Identities = 241/268 (89%) Strand = Plus / Minus Query: 150 aagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtc 209 |||||||||||||||||||||||||||||||||| || || ||||||||||| || || | Sbjct: 1168 aagccttgagcttgccgtagaacctctgcttctcgtccgtggtctggaagcgaccgtgcc 1109 Query: 210 cgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgagg 269 |||||||||| |||||||||| ||||||||||||||| ||||| ||||| | || |||| Sbjct: 1108 cgaacttggaagaggtgtcgacgaacttgagcttgatctcctccagggcaagacgagagg 1049 Query: 270 tctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagc 329 ||||||||| |||||||||||||||||||||||| | |||||||||||| || ||||| | Sbjct: 1048 tctgcttcagcagggactggcggagggtcaccacacgcttcttggggccaacacagcatc 989 Query: 330 ccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggggg 389 |||||||||| ||||||||| ||||||||||||| ||||||||||| ||||||||||| | Sbjct: 988 ccttgatcatcaggtagtcagccttcaccacaccatagtgagggaagccacccatgggag 929 Query: 390 tgatgtccttctcagtcctgtcaaactc 417 ||||||||||||| |||||||| ||||| Sbjct: 928 tgatgtccttctcggtcctgtcgaactc 901
>gb|AY347532.1| Triticum aestivum cultivar Falat ribosomal protein L3 (RPL3) mRNA, RPL3-B3 allele, complete cds Length = 1170 Score = 317 bits (160), Expect = 2e-83 Identities = 241/268 (89%) Strand = Plus / Minus Query: 150 aagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtc 209 |||||||||||||||||||||||||||||||||| || || ||||||||||| || || | Sbjct: 1168 aagccttgagcttgccgtagaacctctgcttctcgtccgtggtctggaagcgaccgtgcc 1109 Query: 210 cgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgagg 269 |||||||||| |||||||||| ||||||||||||||| ||||| ||||| | || |||| Sbjct: 1108 cgaacttggaagaggtgtcgacgaacttgagcttgatctcctccagggcaagacgagagg 1049 Query: 270 tctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagc 329 ||||||||| |||||||||||||||||||||||| | |||||||||||| || ||||| | Sbjct: 1048 tctgcttcagcagggactggcggagggtcaccacacgcttcttggggccaacacagcatc 989 Query: 330 ccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggggg 389 |||||||||| ||||||||| ||||||||||||| ||||||||||| ||||||||||| | Sbjct: 988 ccttgatcatcaggtagtcagccttcaccacaccatagtgagggaagccacccatgggag 929 Query: 390 tgatgtccttctcagtcctgtcaaactc 417 ||||||||||||| |||||||| ||||| Sbjct: 928 tgatgtccttctcggtcctgtcgaactc 901
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 315 bits (159), Expect = 6e-83 Identities = 237/263 (90%) Strand = Plus / Minus Query: 147 cctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccat 206 |||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| || | Sbjct: 3430582 cctaggccttgagcttgccgaagaacctctgcttctcgtcggtggtctggaagcgaccgt 3430523 Query: 207 gtccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcg 266 | ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | ||||| Sbjct: 3430522 gcccgaacttggacgaggtgtcgatgaacttgagcttgatctcctccagggcgagccgcg 3430463 Query: 267 aggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagc 326 |||||||||||| ||| |||||||||||||| || || |||||||| || || ||||||| Sbjct: 3430462 aggtctgcttcagcagcgactggcggagggtgacgactctcttcttcggaccgacgcagc 3430403 Query: 327 agcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatgg 386 | |||||||||||||||||||| |||||||||||||||||||| ||||| || ||||| | Sbjct: 3430402 aacccttgatcatgaggtagtcgcccttcaccacaccgtagtgcgggaagccgcccatcg 3430343 Query: 387 gggtgatgtccttctcagtcctg 409 ||||||||||||||||||||||| Sbjct: 3430342 gggtgatgtccttctcagtcctg 3430320
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 315 bits (159), Expect = 6e-83 Identities = 237/263 (90%) Strand = Plus / Minus Query: 147 cctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccat 206 |||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| || | Sbjct: 3430523 cctaggccttgagcttgccgaagaacctctgcttctcgtcggtggtctggaagcgaccgt 3430464 Query: 207 gtccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcg 266 | ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | ||||| Sbjct: 3430463 gcccgaacttggacgaggtgtcgatgaacttgagcttgatctcctccagggcgagccgcg 3430404 Query: 267 aggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagc 326 |||||||||||| ||| |||||||||||||| || || |||||||| || || ||||||| Sbjct: 3430403 aggtctgcttcagcagcgactggcggagggtgacgactctcttcttcggaccgacgcagc 3430344 Query: 327 agcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatgg 386 | |||||||||||||||||||| |||||||||||||||||||| ||||| || ||||| | Sbjct: 3430343 aacccttgatcatgaggtagtcgcccttcaccacaccgtagtgcgggaagccgcccatcg 3430284 Query: 387 gggtgatgtccttctcagtcctg 409 ||||||||||||||||||||||| Sbjct: 3430283 gggtgatgtccttctcagtcctg 3430261
>emb|AL713902.2|CNS07YQ2 Oryza sativa chromosome 12, . BAC OJ1494_F10 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 116371 Score = 315 bits (159), Expect = 6e-83 Identities = 237/263 (90%) Strand = Plus / Plus Query: 147 cctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccat 206 |||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| || | Sbjct: 101337 cctaggccttgagcttgccgaagaacctctgcttctcgtcggtggtctggaagcgaccgt 101396 Query: 207 gtccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcg 266 | ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | ||||| Sbjct: 101397 gcccgaacttggacgaggtgtcgatgaacttgagcttgatctcctccagggcgagccgcg 101456 Query: 267 aggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagc 326 |||||||||||| ||| |||||||||||||| || || |||||||| || || ||||||| Sbjct: 101457 aggtctgcttcagcagcgactggcggagggtgacgactctcttcttcggaccgacgcagc 101516 Query: 327 agcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatgg 386 | |||||||||||||||||||| |||||||||||||||||||| ||||| || ||||| | Sbjct: 101517 aacccttgatcatgaggtagtcgcccttcaccacaccgtagtgcgggaagccgcccatcg 101576 Query: 387 gggtgatgtccttctcagtcctg 409 ||||||||||||||||||||||| Sbjct: 101577 gggtgatgtccttctcagtcctg 101599
>emb|AL844874.1|CNS08CAX Oryza sativa chromosome 12, . BAC OSJNBa0041K23 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 137936 Score = 315 bits (159), Expect = 6e-83 Identities = 237/263 (90%) Strand = Plus / Minus Query: 147 cctaagccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccat 206 |||| ||||||||||||||| |||||||||||||||| ||||| ||||||||||| || | Sbjct: 109635 cctaggccttgagcttgccgaagaacctctgcttctcgtcggtggtctggaagcgaccgt 109576 Query: 207 gtccgaacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcg 266 | ||||||||||| |||||||||||||||||||||||||| ||||| ||||| | ||||| Sbjct: 109575 gcccgaacttggacgaggtgtcgatgaacttgagcttgatctcctccagggcgagccgcg 109516 Query: 267 aggtctgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagc 326 |||||||||||| ||| |||||||||||||| || || |||||||| || || ||||||| Sbjct: 109515 aggtctgcttcagcagcgactggcggagggtgacgactctcttcttcggaccgacgcagc 109456 Query: 327 agcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatgg 386 | |||||||||||||||||||| |||||||||||||||||||| ||||| || ||||| | Sbjct: 109455 aacccttgatcatgaggtagtcgcccttcaccacaccgtagtgcgggaagccgcccatcg 109396 Query: 387 gggtgatgtccttctcagtcctg 409 ||||||||||||||||||||||| Sbjct: 109395 gggtgatgtccttctcagtcctg 109373
>gb|AY103608.1| Zea mays PCO139614 mRNA sequence Length = 1714 Score = 289 bits (146), Expect = 4e-75 Identities = 236/266 (88%) Strand = Plus / Minus Query: 152 gccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtccg 211 ||||||||||| || |||||||||||||||| ||||| ||||||||||| ||||| || Sbjct: 1291 gccttgagcttaccaaagaacctctgcttctcatcggtagtctggaagcgaccatgccca 1232 Query: 212 aacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtc 271 || ||||| || ||||||||||||||||||||||| ||||| || |||| ||| || ||| Sbjct: 1231 aatttggacgatgtgtcgatgaacttgagcttgatctcctccagcgccagccgggaagtc 1172 Query: 272 tgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagccc 331 ||||||| |||||||||||||||||||||||||||||||| || ||||| ||||||||| Sbjct: 1171 tgcttcaggagggactggcggagggtcaccaccctcttctttggacccacacagcagccc 1112 Query: 332 ttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatgggggtg 391 |||||||| ||||||||||||||||| | ||| || || ||||| ||||||||||| ||| Sbjct: 1111 ttgatcatcaggtagtcacccttcacgataccataatgggggaagccacccatgggagtg 1052 Query: 392 atgtccttctcagtcctgtcaaactc 417 |||||||||||||||||||||||||| Sbjct: 1051 atgtccttctcagtcctgtcaaactc 1026
>gb|AY111327.1| Zea mays CL1488_-4 mRNA sequence Length = 615 Score = 280 bits (141), Expect = 3e-72 Identities = 235/268 (87%) Strand = Plus / Minus Query: 152 gccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtccg 211 |||||||||||||| |||||||||||||||| || || | ||||||||| |||||||| Sbjct: 435 gccttgagcttgccaaagaacctctgcttctcgtctgtggactggaagcgcccatgtcca 376 Query: 212 aacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtc 271 |||||||| |||||||||||||||||||||||||| ||||| ||||||||||| || ||| Sbjct: 375 aacttggacgaggtgtcgatgaacttgagcttgatctcctccagggccaaccgagacgtc 316 Query: 272 tgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagccc 331 ||||||| ||| ||||||||||| ||||||||||| ||||||||||| |||||||| ||| Sbjct: 315 tgcttcagcagagactggcggagagtcaccacccttttcttggggccgacgcagcaaccc 256 Query: 332 ttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatgggggtg 391 |||||||| |||||||| ||||| | | |||||||| || ||||||||||| ||| Sbjct: 255 ttgatcatcaggtagtcgcccttgatgataccgtagtnnnnnaaaccacccatgggagtg 196 Query: 392 atgtccttctcagtcctgtcaaactcag 419 ||||||||||| |||||||||||||||| Sbjct: 195 atgtccttctcggtcctgtcaaactcag 168
>gb|BT016630.1| Zea mays clone Contig463 mRNA sequence Length = 1432 Score = 274 bits (138), Expect = 2e-70 Identities = 234/266 (87%) Strand = Plus / Minus Query: 152 gccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtccg 211 ||||||||||| || |||||||||||||||| ||||| ||||||||||| || || || Sbjct: 1227 gccttgagcttaccaaagaacctctgcttctcatcggtagtctggaagcgaccgtgccca 1168 Query: 212 aacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtc 271 || ||||| || ||||||||||||||||||||||| ||||| || |||| ||| || ||| Sbjct: 1167 aatttggacgatgtgtcgatgaacttgagcttgatctcctccagcgccagccgggaagtc 1108 Query: 272 tgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagccc 331 ||||||| |||||||||||||||||||||||||||||||| || ||||| ||||| ||| Sbjct: 1107 tgcttcaggagggactggcggagggtcaccaccctcttctttggacccacacagcatccc 1048 Query: 332 ttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatgggggtg 391 |||||||| ||||||||||||||||| | ||| ||||| ||||| ||||||||||| ||| Sbjct: 1047 ttgatcatcaggtagtcacccttcacgataccatagtgggggaagccacccatgggagtg 988 Query: 392 atgtccttctcagtcctgtcaaactc 417 ||||||||||| |||||||||||||| Sbjct: 987 atgtccttctcggtcctgtcaaactc 962
>gb|BT017815.1| Zea mays clone EL01N0507E03.c mRNA sequence Length = 1343 Score = 226 bits (114), Expect = 5e-56 Identities = 228/266 (85%) Strand = Plus / Minus Query: 152 gccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtccg 211 |||||| ||||||| | |||||||||||||| ||||| ||||||||||| || || || Sbjct: 1134 gccttgggcttgccaaaaaacctctgcttctcatcggtagtctggaagcgaccgtgccca 1075 Query: 212 aacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtc 271 || ||||| || ||||||||||||||||||||||| ||||| | |||| ||| || ||| Sbjct: 1074 aatttggacgatgtgtcgatgaacttgagcttgatctcctccaacgccagccgggaagtc 1015 Query: 272 tgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagccc 331 ||||||| ||||||||| |||||||||||||||| || || || ||||| ||||||||| Sbjct: 1014 tgcttcaggagggactgggggagggtcaccacccttttttttggacccacacagcagccc 955 Query: 332 ttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatgggggtg 391 |||||||| ||| ||||||||||||| | ||| || || ||||| ||||||||||| | | Sbjct: 954 ttgatcatcagggagtcacccttcacgataccataatgggggaagccacccatgggaggg 895 Query: 392 atgtccttctcagtcctgtcaaactc 417 |||||||||||||||||||||||||| Sbjct: 894 atgtccttctcagtcctgtcaaactc 869
>gb|BT016883.1| Zea mays clone Contig716 mRNA sequence Length = 569 Score = 226 bits (114), Expect = 5e-56 Identities = 228/266 (85%) Strand = Plus / Plus Query: 152 gccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtccg 211 ||||||||||| || | |||||||||||||| ||||| ||||||||||| || || || Sbjct: 243 gccttgagcttaccaaaaaacctctgcttctcatcggtagtctggaagcgaccgtgccca 302 Query: 212 aacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtc 271 || ||||| || ||||||||||||||||||||||| ||||| || |||| ||| || ||| Sbjct: 303 aatttggacgatgtgtcgatgaacttgagcttgatctcctccagcgccagccgggaagtc 362 Query: 272 tgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagccc 331 ||||||| |||||||||||||||||||||||||||||||| || ||||| || || ||| Sbjct: 363 tgcttcaggagggactggcggagggtcaccaccctcttctttggacccacacaacatccc 422 Query: 332 ttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatgggggtg 391 |||||||| ||| ||||||||||||| | ||| ||| | ||||| ||||||||||| | | Sbjct: 423 ttgatcatcagggagtcacccttcacgataccatagggggggaagccacccatgggaggg 482 Query: 392 atgtccttctcagtcctgtcaaactc 417 ||||||||||| | |||||||||||| Sbjct: 483 atgtccttctcgggcctgtcaaactc 508
>gb|BT016900.1| Zea mays clone Contig733 mRNA sequence Length = 707 Score = 222 bits (112), Expect = 7e-55 Identities = 205/236 (86%) Strand = Plus / Plus Query: 152 gccttgagcttgccgtagaacctctgcttctcttcggttgtctggaagcggccatgtccg 211 ||||||||||| || |||||||||||||||| ||||| ||||||||||| || || || Sbjct: 471 gccttgagcttaccaaagaacctctgcttctcatcggtagtctggaagcgaccgtgccca 530 Query: 212 aacttggatgaggtgtcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtc 271 || ||||| || ||||||||||||||||||||||| ||||| || |||| ||| || ||| Sbjct: 531 aatttggacgatgtgtcgatgaacttgagcttgatctcctccagcgccagccgggaagtc 590 Query: 272 tgcttcaacagggactggcggagggtcaccaccctcttcttggggcccacgcagcagccc 331 ||||||| |||||||||||||||||||||||||||||||| || ||||| ||||| ||| Sbjct: 591 tgcttcaggagggactggcggagggtcaccaccctcttctttggacccacacagcatccc 650 Query: 332 ttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatggg 387 |||||||| ||| ||||||||||||| | ||| ||||| ||||| ||||||||||| Sbjct: 651 ttgatcatcagggagtcacccttcacgataccatagtgggggaagccacccatggg 706
>gb|AY236158.1| Oryza sativa (indica cultivar-group) ribosomal protein L3B mRNA, partial cds Length = 1035 Score = 212 bits (107), Expect = 7e-52 Identities = 149/163 (91%) Strand = Plus / Minus Query: 257 gccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttcttgggg 316 ||||| || ||||||||||| | |||||||||||||||||| || ||||||||||||||| Sbjct: 1028 gccaaacgagaggtctgcttgagcagggactggcggagggtgacgaccctcttcttgggg 969 Query: 317 cccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaac 376 || || ||||| |||||||||||||||||||| |||||||| ||||||||||||||||| Sbjct: 968 ccaacacagcaacccttgatcatgaggtagtcgcccttcacaacaccgtagtgagggaag 909 Query: 377 ccacccatgggggtgatgtccttctcagtcctgtcaaactcag 419 ||||||||||| |||||||||||||||||||||||||| |||| Sbjct: 908 ccacccatgggagtgatgtccttctcagtcctgtcaaattcag 866
>gb|AY389725.1| Hyacinthus orientalis ribosomal protein L3 mRNA, partial cds Length = 875 Score = 208 bits (105), Expect = 1e-50 Identities = 199/229 (86%), Gaps = 1/229 (0%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 250 ||||||||||||||||| || || |||||||| ||||||||||||||||||||||| ||| Sbjct: 753 gtctggaagcggccatgacc-aagttggatgatgtgtcgatgaacttgagcttgatttcc 695 Query: 251 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 310 || || ||||| || ||||||||||||| |||||||||||| || || |||||||||||| Sbjct: 694 tccagagccaagcgggaggtctgcttcagcagggactggcgaagcgtgaccaccctcttc 635 Query: 311 ttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgtagtga 370 |||||||| || ||||| || ||||||| | ||||||| | ||||||||||| || || Sbjct: 634 ttggggccaacacagcaaccgttgatcagaatgtagtcatcgttcaccacaccataatgc 575 Query: 371 gggaacccacccatgggggtgatgtccttctcagtcctgtcaaactcag 419 |||||||| ||||| || ||||| |||||||||||||| |||||||||| Sbjct: 574 gggaaccctcccatcggagtgatatccttctcagtcctatcaaactcag 526
>gb|AY395738.1| Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds Length = 1416 Score = 147 bits (74), Expect = 3e-32 Identities = 203/246 (82%) Strand = Plus / Minus Query: 174 tctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatga 233 |||||||||||| || ||||||||||| |||||||| ||||| || || || ||||||| Sbjct: 1197 tctgcttctcttgagtggtctggaagcgaccatgtccaaactttgaggatgtatcgatga 1138 Query: 234 acttgagcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggactggcgga 293 |||| ||||| || |||||||| || | || |||||||| || | ||||||||| || | Sbjct: 1137 acttcagcttaatctcctcaagagcgacacgagaggtctggttgagcagggactgacgaa 1078 Query: 294 gggtcaccaccctcttcttggggcccacgcagcagcccttgatcatgaggtagtcaccct 353 |||| || ||||||||||| || || || ||||| |||||||||| ||||| ||| ||| Sbjct: 1077 gggttacaaccctcttcttaggaccaacacagcatcccttgatcaacaggtaatcatcct 1018 Query: 354 tcaccacaccgtagtgagggaacccacccatgggggtgatgtccttctcagtcctgtcaa 413 |||||||||| || || || || ||||||||||| || ||||| ||||| |||||||||| Sbjct: 1017 tcaccacaccataatggggaaatccacccatgggagtaatgtctttctcggtcctgtcaa 958 Query: 414 actcag 419 | |||| Sbjct: 957 aatcag 952
>gb|DQ241849.1| Solanum tuberosum clone 187E04 ribosomal protein L3-like mRNA, complete cds Length = 1434 Score = 139 bits (70), Expect = 8e-30 Identities = 202/246 (82%) Strand = Plus / Minus Query: 174 tctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatga 233 |||||||||||| ||| ||||||||||| |||||||| ||||| || || |||||||||| Sbjct: 1195 tctgcttctcttgggtggtctggaagcgaccatgtccaaactttgaggatgtgtcgatga 1136 Query: 234 acttgagcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggactggcgga 293 |||| ||||| || |||||||| || | || |||||||| || | |||||| || || | Sbjct: 1135 acttcagcttaatctcctcaagagcaacacgagaggtctggttgagcagggattgacgca 1076 Query: 294 gggtcaccaccctcttcttggggcccacgcagcagcccttgatcatgaggtagtcaccct 353 |||| || ||||||||||| || || || ||||| |||||||||| ||||| ||| ||| Sbjct: 1075 gggttacaaccctcttcttaggaccaacacagcatcccttgatcaacaggtaatcatcct 1016 Query: 354 tcaccacaccgtagtgagggaacccacccatgggggtgatgtccttctcagtcctgtcaa 413 |||||||||| || || | || ||||| || || || || || |||||||||||||||| Sbjct: 1015 tcaccacaccataatgggcaaatccaccaataggagtaatctctttctcagtcctgtcaa 956 Query: 414 actcag 419 |||||| Sbjct: 955 actcag 950
>dbj|AB008848.1| Cucumis sativus Csf-3 mRNA, complete cds Length = 911 Score = 127 bits (64), Expect = 3e-26 Identities = 184/224 (82%) Strand = Plus / Minus Query: 188 gttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgata 247 |||||||||||||| ||||| || |||||||| || || ||||||||||| || ||||| Sbjct: 707 gttgtctggaagcgtccatggccaaacttggaggatgtatcgatgaacttaagtttgatc 648 Query: 248 tcctcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctc 307 |||||||| |||| || || || || || | || ||||| || ||||| | |||||| Sbjct: 647 tcctcaagagccacacgagaagtttgtttgagaagagactgacgaagggtgatgaccctc 588 Query: 308 ttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgtag 367 |||||||| || || || | ||||| ||||| | |||||||| |||||| | ||||||| Sbjct: 587 ttcttgggtccaacacaacctcccttaatcatcaagtagtcactcttcacgataccgtag 528 Query: 368 tgagggaacccacccatgggggtgatgtccttctcagtcctgtc 411 |||||||| ||||||||||| || |||||||||||||||||||| Sbjct: 527 tgagggaaaccacccatgggagtaatgtccttctcagtcctgtc 484
>gb|AY456411.1| Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds Length = 1387 Score = 123 bits (62), Expect = 5e-25 Identities = 200/246 (81%) Strand = Plus / Minus Query: 174 tctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatga 233 |||||||||||| ||| ||||||||||| |||||||| |||||||| || |||||||||| Sbjct: 1178 tctgcttctcttgggtggtctggaagcgaccatgtccaaacttggaggatgtgtcgatga 1119 Query: 234 acttgagcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggactggcgga 293 |||| ||||| || |||||||| || | || || ||||| || | ||||| || || | Sbjct: 1118 acttcagcttaatctcctcaagagcaacacgagaagtctggttgagaagggattgacgca 1059 Query: 294 gggtcaccaccctcttcttggggcccacgcagcagcccttgatcatgaggtagtcaccct 353 | || || ||||||||||| | || || ||||| |||||||||| ||||| || ||| Sbjct: 1058 gagttacaaccctcttcttagtaccaacacagcatcccttgatcaacaggtaatcctcct 999 Query: 354 tcaccacaccgtagtgagggaacccacccatgggggtgatgtccttctcagtcctgtcaa 413 |||||||||| || || || || ||||| || || || ||||| |||||||||||||||| Sbjct: 998 tcaccacaccataatggggaaatccaccaataggtgtaatgtctttctcagtcctgtcaa 939 Query: 414 actcag 419 |||||| Sbjct: 938 actcag 933
>emb|Y14339.1|LEY14339 Lycopersicon esculentum mRNA for proteasome, alpha subunit Length = 1686 Score = 123 bits (62), Expect = 5e-25 Identities = 200/246 (81%) Strand = Plus / Minus Query: 174 tctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatga 233 |||||||||||| ||| ||||||||||| |||||||| |||||||| || |||||||||| Sbjct: 1453 tctgcttctcttgggtggtctggaagcgaccatgtccaaacttggaggatgtgtcgatga 1394 Query: 234 acttgagcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggactggcgga 293 |||| ||||| || |||||||| || | || || ||||| || | ||||| || || | Sbjct: 1393 acttcagcttaatctcctcaagagcaacacgagaagtctggttgagaagggattgacgca 1334 Query: 294 gggtcaccaccctcttcttggggcccacgcagcagcccttgatcatgaggtagtcaccct 353 | || || ||||||||||| | || || ||||| |||||||||| ||||| || ||| Sbjct: 1333 gagttacaaccctcttcttagtaccaacacagcatcccttgatcaacaggtaatcctcct 1274 Query: 354 tcaccacaccgtagtgagggaacccacccatgggggtgatgtccttctcagtcctgtcaa 413 |||||||||| || || || || ||||| || || || ||||| |||||||||||||||| Sbjct: 1273 tcaccacaccataatggggaaatccaccaataggtgtaatgtctttctcagtcctgtcaa 1214 Query: 414 actcag 419 |||||| Sbjct: 1213 actcag 1208
>gb|AC150978.15| Medicago truncatula clone mth2-66m17, complete sequence Length = 125121 Score = 119 bits (60), Expect = 8e-24 Identities = 198/244 (81%) Strand = Plus / Minus Query: 167 tagaacctctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtg 226 |||||| | ||||||||| ||||||||||| || |||||||| |||||||| ||||| Sbjct: 9347 tagaacttttgcttctctgatgttgtctggaaacgaccatgtccaaacttggaagaggta 9288 Query: 227 tcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggac 286 ||||| |||||||| |||||||||||||| || | || || |||||||| | |||||| Sbjct: 9287 tcgataaacttgagtttgatatcctcaagagcaagacgagaagtctgcttaagaagggac 9228 Query: 287 tggcggagggtcaccaccctcttcttggggcccacgcagcagcccttgatcatgaggtag 346 ||||| || || | |||||||||||||| || || |||| ||||||||||| || | Sbjct: 9227 tggcgcagagtaataaccctcttcttgggaccaacacagcctcccttgatcatcagaaaa 9168 Query: 347 tcacccttcaccacaccgtagtgagggaacccacccatgggggtgatgtccttctcagtc 406 || |||| || | ||||||||| ||||| |||||||| || || ||||| ||||||||| Sbjct: 9167 tcctccttgacaataccgtagtgtgggaaaccacccataggtgtaatgtctttctcagtc 9108 Query: 407 ctgt 410 |||| Sbjct: 9107 ctgt 9104
>gb|AC125473.12| Medicago truncatula clone mth2-8j13, complete sequence Length = 103966 Score = 119 bits (60), Expect = 8e-24 Identities = 198/244 (81%) Strand = Plus / Plus Query: 167 tagaacctctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtg 226 |||||| | ||||||||| ||||||||||| || |||||||| |||||||| ||||| Sbjct: 12 tagaacttttgcttctctgatgttgtctggaaacgaccatgtccaaacttggaagaggta 71 Query: 227 tcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggac 286 ||||| |||||||| |||||||||||||| || | || || |||||||| | |||||| Sbjct: 72 tcgataaacttgagtttgatatcctcaagagcaagacgagaagtctgcttaagaagggac 131 Query: 287 tggcggagggtcaccaccctcttcttggggcccacgcagcagcccttgatcatgaggtag 346 ||||| || || | |||||||||||||| || || |||| ||||||||||| || | Sbjct: 132 tggcgcagagtaataaccctcttcttgggaccaacacagcctcccttgatcatcagaaaa 191 Query: 347 tcacccttcaccacaccgtagtgagggaacccacccatgggggtgatgtccttctcagtc 406 || |||| || | ||||||||| ||||| |||||||| || || ||||| ||||||||| Sbjct: 192 tcctccttgacaataccgtagtgtgggaaaccacccataggtgtaatgtctttctcagtc 251 Query: 407 ctgt 410 |||| Sbjct: 252 ctgt 255
>gb|AC126014.6| Medicago truncatula clone mth2-18j5, complete sequence Length = 113200 Score = 119 bits (60), Expect = 8e-24 Identities = 198/244 (81%) Strand = Plus / Minus Query: 167 tagaacctctgcttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtg 226 |||||| | ||||||||| ||||||||||| || |||||||| |||||||| ||||| Sbjct: 99627 tagaacttttgcttctctgatgttgtctggaaacgaccatgtccaaacttggaagaggta 99568 Query: 227 tcgatgaacttgagcttgatatcctcaagggccaaccgcgaggtctgcttcaacagggac 286 ||||| |||||||| |||||||||||||| || | || || |||||||| | |||||| Sbjct: 99567 tcgataaacttgagtttgatatcctcaagagcaagacgagaagtctgcttaagaagggac 99508 Query: 287 tggcggagggtcaccaccctcttcttggggcccacgcagcagcccttgatcatgaggtag 346 ||||| || || | |||||||||||||| || || |||| ||||||||||| || | Sbjct: 99507 tggcgcagagtaataaccctcttcttgggaccaacacagcctcccttgatcatcagaaaa 99448 Query: 347 tcacccttcaccacaccgtagtgagggaacccacccatgggggtgatgtccttctcagtc 406 || |||| || | ||||||||| ||||| |||||||| || || ||||| ||||||||| Sbjct: 99447 tcctccttgacaataccgtagtgtgggaaaccacccataggtgtaatgtctttctcagtc 99388 Query: 407 ctgt 410 |||| Sbjct: 99387 ctgt 99384
>emb|AJ248327.1|MSA248327 Medicago sativa subsp. X varia mRNA for L3 Ribosomal protein Length = 1201 Score = 111 bits (56), Expect = 2e-21 Identities = 188/232 (81%) Strand = Plus / Minus Query: 188 gttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgata 247 ||||||||||| || |||||||| |||||| | ||||| ||||| |||||||| |||||| Sbjct: 1151 gttgtctggaaacgaccatgtccaaacttgaaagaggtatcgataaacttgagtttgata 1092 Query: 248 tcctcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctc 307 |||||||| || | || || |||||||| | ||||||||||| || || | |||||| Sbjct: 1091 tcctcaagagcaagacgagaagtctgcttaagaagggactggcgcagagtaataaccctc 1032 Query: 308 ttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgtag 367 |||||||| || || |||| ||||||||||| || | || |||| || | ||||||| Sbjct: 1031 ttcttgggaccaacacagcctcccttgatcatcagaaaatcctccttgacaataccgtag 972 Query: 368 tgagggaacccacccatgggggtgatgtccttctcagtcctgtcaaactcag 419 || ||||| |||||||| || || ||||| ||||||||||| || ||||||| Sbjct: 971 tgtgggaaaccacccataggtgtaatgtctttctcagtcctatcgaactcag 920
>gb|BT011339.1| Drosophila melanogaster RH62603 full insert cDNA Length = 1396 Score = 103 bits (52), Expect = 5e-19 Identities = 166/204 (81%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 250 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 1176 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 1117 Query: 251 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 310 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 1116 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 1057 Query: 311 ttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgtagtga 370 |||| ||| | |||||||||||||||||||| | |||| || ||| |||||||||| Sbjct: 1056 ttggagccgatgcagcagcccttgatcatgacgaagtcgttgttgacctcaccgtagtgg 997 Query: 371 gggaacccacccatgggggtgatg 394 ||||| ||||||||||| |||||| Sbjct: 996 gggaagccacccatgggcgtgatg 973
>ref|NM_169379.1| Drosophila melanogaster Ribosomal protein L3 CG4863-RE, transcript variant E (RpL3), mRNA Length = 1829 Score = 103 bits (52), Expect = 5e-19 Identities = 166/204 (81%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 250 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 1395 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 1336 Query: 251 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 310 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 1335 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 1276 Query: 311 ttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgtagtga 370 |||| ||| | |||||||||||||||||||| | |||| || ||| |||||||||| Sbjct: 1275 ttggagccgatgcagcagcccttgatcatgacgaagtcgttgttgacctcaccgtagtgg 1216 Query: 371 gggaacccacccatgggggtgatg 394 ||||| ||||||||||| |||||| Sbjct: 1215 gggaagccacccatgggcgtgatg 1192
>ref|NM_169378.1| Drosophila melanogaster Ribosomal protein L3 CG4863-RB, transcript variant B (RpL3), mRNA Length = 1579 Score = 103 bits (52), Expect = 5e-19 Identities = 166/204 (81%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 250 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 1145 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 1086 Query: 251 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 310 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 1085 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 1026 Query: 311 ttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgtagtga 370 |||| ||| | |||||||||||||||||||| | |||| || ||| |||||||||| Sbjct: 1025 ttggagccgatgcagcagcccttgatcatgacgaagtcgttgttgacctcaccgtagtgg 966 Query: 371 gggaacccacccatgggggtgatg 394 ||||| ||||||||||| |||||| Sbjct: 965 gggaagccacccatgggcgtgatg 942
>ref|NM_079592.2| Drosophila melanogaster Ribosomal protein L3 CG4863-RA, transcript variant A (RpL3), mRNA Length = 1610 Score = 103 bits (52), Expect = 5e-19 Identities = 166/204 (81%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 250 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 1176 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 1117 Query: 251 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 310 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 1116 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 1057 Query: 311 ttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgtagtga 370 |||| ||| | |||||||||||||||||||| | |||| || ||| |||||||||| Sbjct: 1056 ttggagccgatgcagcagcccttgatcatgacgaagtcgttgttgacctcaccgtagtgg 997 Query: 371 gggaacccacccatgggggtgatg 394 ||||| ||||||||||| |||||| Sbjct: 996 gggaagccacccatgggcgtgatg 973
>gb|AC006491.24|AC006491 Drosophila melanogaster, chromosome 3R, region 86D1-86E1, BAC clone BACR48M21, complete sequence Length = 164386 Score = 103 bits (52), Expect = 5e-19 Identities = 166/204 (81%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 250 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 113227 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 113168 Query: 251 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 310 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 113167 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 113108 Query: 311 ttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgtagtga 370 |||| ||| | |||||||||||||||||||| | |||| || ||| |||||||||| Sbjct: 113107 ttggagccgatgcagcagcccttgatcatgacgaagtcgttgttgacctcaccgtagtgg 113048 Query: 371 gggaacccacccatgggggtgatg 394 ||||| ||||||||||| |||||| Sbjct: 113047 gggaagccacccatgggcgtgatg 113024
>gb|AE003690.3| Drosophila melanogaster chromosome 3R, section 28 of 118 of the complete sequence Length = 170298 Score = 103 bits (52), Expect = 5e-19 Identities = 166/204 (81%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 250 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 138452 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 138393 Query: 251 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 310 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 138392 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 138333 Query: 311 ttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgtagtga 370 |||| ||| | |||||||||||||||||||| | |||| || ||| |||||||||| Sbjct: 138332 ttggagccgatgcagcagcccttgatcatgacgaagtcgttgttgacctcaccgtagtgg 138273 Query: 371 gggaacccacccatgggggtgatg 394 ||||| ||||||||||| |||||| Sbjct: 138272 gggaagccacccatgggcgtgatg 138249
>gb|AF016835.1|AF016835 Drosophila melanogaster ribosomal protein L3 (RpL3) mRNA, complete cds Length = 1381 Score = 103 bits (52), Expect = 5e-19 Identities = 166/204 (81%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 250 ||||||||||| || || || | |||||| |||||||||||||||||||||||||| | | Sbjct: 1175 gtctggaagcgaccgtgacccatcttggacgaggtgtcgatgaacttgagcttgatctgc 1116 Query: 251 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 310 || ||||| | ||| ||| ||||||| |||||||| ||| ||||| | | | |||| Sbjct: 1115 tccagggcagagcgcttggtgtgcttcagcagggacttgcgcagggtgatgatgcgcttc 1056 Query: 311 ttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgtagtga 370 |||| ||| | |||||||||||||||||||| | |||| || ||| |||||||||| Sbjct: 1055 ttggagccgatgcagcagcccttgatcatgacgaagtcgttgttgacctcaccgtagtgg 996 Query: 371 gggaacccacccatgggggtgatg 394 ||||| ||||||||||| |||||| Sbjct: 995 gggaagccacccatgggcgtgatg 972
>gb|AY395739.1| Nicotiana tabacum ribosomal protein L3B (RPL3B) mRNA, complete cds Length = 1487 Score = 97.6 bits (49), Expect = 3e-17 Identities = 184/229 (80%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 250 ||||||||||| ||||| || |||||||| || ||||| ||||||||||||||||| ||| Sbjct: 1255 gtctggaagcgtccatggccaaacttggaggatgtgtcaatgaacttgagcttgatctcc 1196 Query: 251 tcaagggccaaccgcgaggtctgcttcaacagggactggcggagggtcaccaccctcttc 310 || | || | || || ||||| |||||||| ||||| | || ||||| || | |||| Sbjct: 1195 tccaatgcaaccctagatgtctgattcaacagagactgcctcagagtcacaacacgcttc 1136 Query: 311 ttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgtagtga 370 || || || || ||||||||||| |||| || |||| | ||||| | ||| || ||| Sbjct: 1135 tttggtccaacacagcagcccttaatcaacagaaagtcttctttcacaataccataatga 1076 Query: 371 gggaacccacccatgggggtgatgtccttctcagtcctgtcaaactcag 419 || || |||||||| || ||||| ||||||||||||||||||||||||| Sbjct: 1075 ggaaatccacccattggcgtgatatccttctcagtcctgtcaaactcag 1027
>dbj|AK109100.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-B01, full insert sequence Length = 1470 Score = 93.7 bits (47), Expect = 4e-16 Identities = 65/71 (91%) Strand = Plus / Minus Query: 329 cccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccacccatgggg 388 |||||||||||||||||||| |||| |||||||||||||||||||| || ||||||||| Sbjct: 1027 cccttgatcatgaggtagtcctccttgaccacaccgtagtgagggaagccgcccatgggg 968 Query: 389 gtgatgtcctt 399 ||||| ||||| Sbjct: 967 gtgatctcctt 957 Score = 60.0 bits (30), Expect = 6e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 250 ||||||||||| || || |||||||||||||| ||||| | |||||||||||||| ||| Sbjct: 1165 gtctggaagcgaccgtggccgaacttggatgatgtgtccacaaacttgagcttgatctcc 1106 Query: 251 tc 252 || Sbjct: 1105 tc 1104
>ref|XM_547185.2| PREDICTED: Canis familiaris similar to 60S ribosomal protein L3-like (LOC490065), mRNA Length = 1733 Score = 83.8 bits (42), Expect = 4e-13 Identities = 72/82 (87%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||| || ||||||||||||||| || || |||||||| | ||||||||||||||| Sbjct: 1416 cttctcttgggctgtctggaagcggccgtggccaaacttggaggtggtgtcgatgaactt 1357 Query: 238 gagcttgatatcctcaagggcc 259 ||||| ||||| ||| |||||| Sbjct: 1356 gagctcgatattctccagggcc 1335
>gb|AC005606.3| Homo sapiens chromosome 16, P1 clone 109-8C (LANL), complete sequence Length = 80662 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 4608 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 4667 Query: 238 gagct 242 ||||| Sbjct: 4668 gagct 4672
>gb|AC005363.1| Homo sapiens chromosome 16, P1 clone 47-2H (LANL), complete sequence Length = 75108 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 47195 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 47254 Query: 238 gagct 242 ||||| Sbjct: 47255 gagct 47259
>ref|NM_005061.2| Homo sapiens ribosomal protein L3-like (RPL3L), mRNA Length = 1547 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 1202 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 1143 Query: 238 gagct 242 ||||| Sbjct: 1142 gagct 1138
>gb|AE006640.1| Homo sapiens 16p13.3 sequence section 8 of 8 Length = 81579 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 67254 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 67313 Query: 238 gagct 242 ||||| Sbjct: 67314 gagct 67318
>gb|BC050413.1| Homo sapiens ribosomal protein L3-like, mRNA (cDNA clone MGC:54082 IMAGE:6204847), complete cds Length = 2142 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 1194 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 1135 Query: 238 gagct 242 ||||| Sbjct: 1134 gagct 1130
>gb|U65581.1|HSU65581 Human ribosomal protein L3-like mRNA, complete cds Length = 1548 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 1203 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 1144 Query: 238 gagct 242 ||||| Sbjct: 1143 gagct 1139
>emb|AL499629.1| Human DNA sequence from clone XX-PAC76P10 on chromosome 16, complete sequence Length = 26689 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||| || |||||||||||||||||| ||||||||||| | |||||| |||||||| Sbjct: 11761 cttctcttgggctgtctggaagcggccatggccgaacttggaggtggtgtcaatgaactt 11820 Query: 238 gagct 242 ||||| Sbjct: 11821 gagct 11825
>gb|BC103272.1| Bos taurus ribosomal protein L3-like, mRNA (cDNA clone MGC:128622 IMAGE:7986314), complete cds Length = 1342 Score = 75.8 bits (38), Expect = 1e-10 Identities = 71/82 (86%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||| || |||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1175 cttctcttgggctgtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1116 Query: 238 gagcttgatatcctcaagggcc 259 ||||| ||| | ||| |||||| Sbjct: 1115 gagctcgatgttctccagggcc 1094
>ref|NM_001035501.1| Bos taurus ribosomal protein L3-like (RPL3L), mRNA Length = 1342 Score = 75.8 bits (38), Expect = 1e-10 Identities = 71/82 (86%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||| || |||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1175 cttctcttgggctgtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1116 Query: 238 gagcttgatatcctcaagggcc 259 ||||| ||| | ||| |||||| Sbjct: 1115 gagctcgatgttctccagggcc 1094
>ref|NM_001036069.1| Arabidopsis thaliana ARP1 (ARABIDOPSIS RIBOSOMAL PROTEIN 1); structural constituent of ribosome AT1G43170 (ARP1) transcript variant AT1G43170.3 mRNA, complete cds Length = 1447 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 ||||||||||| || || ||||| ||||| ||||| | ||||||| ||||||| | |||| Sbjct: 1051 ctcttcttgggaccaacacagcaccccttaatcatcaagtagtcatccttcacaataccg 992 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcctgtca 412 ||||| ||||| || ||||| || || | |||||||||||||||||| Sbjct: 991 tagtgtgggaagcctcccattggagtcacatccttctcagtcctgtca 944
>ref|NM_202237.1| Arabidopsis thaliana ARP1 (ARABIDOPSIS RIBOSOMAL PROTEIN 1); structural constituent of ribosome AT1G43170 (ARP1) transcript variant AT1G43170.2 mRNA, complete cds Length = 1449 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 ||||||||||| || || ||||| ||||| ||||| | ||||||| ||||||| | |||| Sbjct: 1053 ctcttcttgggaccaacacagcaccccttaatcatcaagtagtcatccttcacaataccg 994 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcctgtca 412 ||||| ||||| || ||||| || || | |||||||||||||||||| Sbjct: 993 tagtgtgggaagcctcccattggagtcacatccttctcagtcctgtca 946
>ref|NM_103469.2| Arabidopsis thaliana ARP1 (ARABIDOPSIS RIBOSOMAL PROTEIN 1); structural constituent of ribosome AT1G43170 (ARP1) transcript variant AT1G43170.1 mRNA, complete cds Length = 1483 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 ||||||||||| || || ||||| ||||| ||||| | ||||||| ||||||| | |||| Sbjct: 1087 ctcttcttgggaccaacacagcaccccttaatcatcaagtagtcatccttcacaataccg 1028 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcctgtca 412 ||||| ||||| || ||||| || || | |||||||||||||||||| Sbjct: 1027 tagtgtgggaagcctcccattggagtcacatccttctcagtcctgtca 980
>gb|BT000756.1| Arabidopsis thaliana clone RAFL09-59-D03 (R18985) putative ribosomal protein (At1g43170) mRNA, complete cds Length = 1452 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 ||||||||||| || || ||||| ||||| ||||| | ||||||| ||||||| | |||| Sbjct: 1074 ctcttcttgggaccaacacagcaccccttaatcatcaagtagtcatccttcacaataccg 1015 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcctgtca 412 ||||| ||||| || ||||| || || | |||||||||||||||||| Sbjct: 1014 tagtgtgggaagcctcccattggagtcacatccttctcagtcctgtca 967
>gb|AF361101.1| Arabidopsis thaliana putative ribosomal protein (At1g43170) mRNA, complete cds Length = 1220 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 ||||||||||| || || ||||| ||||| ||||| | ||||||| ||||||| | |||| Sbjct: 1013 ctcttcttgggaccaacacagcaccccttaatcatcaagtagtcatccttcacaataccg 954 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcctgtca 412 ||||| ||||| || ||||| || || | |||||||||||||||||| Sbjct: 953 tagtgtgggaagcctcccattggagtcacatccttctcagtcctgtca 906
>gb|AF327421.1| Arabidopsis thaliana putative ribosomal protein (At1g43170) mRNA, complete cds Length = 1456 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 ||||||||||| || || ||||| ||||| ||||| | ||||||| ||||||| | |||| Sbjct: 1076 ctcttcttgggaccaacacagcaccccttaatcatcaagtagtcatccttcacaataccg 1017 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcctgtca 412 ||||| ||||| || ||||| || || | |||||||||||||||||| Sbjct: 1016 tagtgtgggaagcctcccattggagtcacatccttctcagtcctgtca 969
>gb|AF361809.1| Arabidopsis thaliana At1g43170/F1I21_18 mRNA, complete cds Length = 1380 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 ||||||||||| || || ||||| ||||| ||||| | ||||||| ||||||| | |||| Sbjct: 1072 ctcttcttgggaccaacacagcaccccttaatcatcaagtagtcatccttcacaataccg 1013 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcctgtca 412 ||||| ||||| || ||||| || || | |||||||||||||||||| Sbjct: 1012 tagtgtgggaagcctcccattggagtcacatccttctcagtcctgtca 965
>gb|AY057487.1| Arabidopsis thaliana At1g43170/F1I21_18 mRNA, complete cds Length = 1361 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 ||||||||||| || || ||||| ||||| ||||| | ||||||| ||||||| | |||| Sbjct: 1070 ctcttcttgggaccaacacagcaccccttaatcatcaagtagtcatccttcacaataccg 1011 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcctgtca 412 ||||| ||||| || ||||| || || | |||||||||||||||||| Sbjct: 1010 tagtgtgggaagcctcccattggagtcacatccttctcagtcctgtca 963
>gb|AY052743.1| Arabidopsis thaliana At1g43170/F1I21_18 mRNA, complete cds Length = 1170 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 ||||||||||| || || ||||| ||||| ||||| | ||||||| ||||||| | |||| Sbjct: 1013 ctcttcttgggaccaacacagcaccccttaatcatcaagtagtcatccttcacaataccg 954 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcctgtca 412 ||||| ||||| || ||||| || || | |||||||||||||||||| Sbjct: 953 tagtgtgggaagcctcccattggagtcacatccttctcagtcctgtca 906
>gb|AY039544.1| Arabidopsis thaliana At1g43170/F1I21_18 mRNA, complete cds Length = 1440 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 ||||||||||| || || ||||| ||||| ||||| | ||||||| ||||||| | |||| Sbjct: 1076 ctcttcttgggaccaacacagcaccccttaatcatcaagtagtcatccttcacaataccg 1017 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcctgtca 412 ||||| ||||| || ||||| || || | |||||||||||||||||| Sbjct: 1016 tagtgtgggaagcctcccattggagtcacatccttctcagtcctgtca 969
>gb|AY089000.1| Arabidopsis thaliana clone 14534 mRNA, complete sequence Length = 1389 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 ||||||||||| || || ||||| ||||| ||||| | ||||||| ||||||| | |||| Sbjct: 1073 ctcttcttgggaccaacacagcaccccttaatcatcaagtagtcatccttcacaataccg 1014 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcctgtca 412 ||||| ||||| || ||||| || || | |||||||||||||||||| Sbjct: 1013 tagtgggggaatcctcccattggagtcacatccttctcagtcctgtca 966 Score = 44.1 bits (22), Expect = 0.36 Identities = 52/62 (83%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 250 ||||||||||| |||||||| || |||| | |||||| || |||||||| ||||| ||| Sbjct: 1187 gtctggaagcgaccatgtccaaaaatggaggcggtgtcaataaacttgagtttgatctcc 1128 Query: 251 tc 252 || Sbjct: 1127 tc 1126
>gb|M32654.1|ATHRPCA Arabidopsis thaliana cytoplasmic ribosomal protein mRNA, complete cds Length = 1462 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 |||||||||| || || ||||| ||||| ||||||| ||||||| ||||||| | |||| Sbjct: 1046 ctcttcttggcaccaacacagcaccccttaatcatgaagtagtcatccttcacaataccg 987 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcctgtca 412 ||||| ||||| || ||||| || || | |||||||||||||||||| Sbjct: 986 tagtgtgggaagcctcccattggagtcacatccttctcagtcctgtca 939
>ref|XM_786257.1| PREDICTED: Strongylocentrotus purpuratus similar to 60S ribosomal protein L3 (L4) (LOC586477), mRNA Length = 1495 Score = 69.9 bits (35), Expect = 6e-09 Identities = 92/111 (82%) Strand = Plus / Minus Query: 284 gactggcggagggtcaccaccctcttcttggggcccacgcagcagcccttgatcatgagg 343 |||| |||||| || | ||||||||||||||| || ||| ||||||||||||||| ||| Sbjct: 1142 gacttgcggagagtaagcaccctcttcttgggtccgacgacgcagcccttgatcatcagg 1083 Query: 344 tagtcacccttcaccacaccgtagtgagggaacccacccatgggggtgatg 394 |||| |||||| |||| ||||||||||| || ||||||||| ||||| Sbjct: 1082 aagtcgttcttcacttcaccatagtgagggaatcctcccatggggttgatg 1032 Score = 52.0 bits (26), Expect = 0.001 Identities = 44/50 (88%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgag 240 ||||||||||| |||||||| |||||||| | ||||||||| | |||||| Sbjct: 1235 gtctggaagcgaccatgtccaaacttggaggtggtgtcgatcagcttgag 1186
>gb|AY072287.1| Spodoptera frugiperda ribosomal protein L3 mRNA, complete cds Length = 1380 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgatatcc 250 ||||||||||| ||||| ||||||||||| || |||||||||||||| || ||||| | | Sbjct: 1169 gtctggaagcgaccatgaccgaacttggacgatgtgtcgatgaacttaagattgatcttc 1110 Query: 251 tcaag 255 ||||| Sbjct: 1109 tcaag 1105 Score = 52.0 bits (26), Expect = 0.001 Identities = 80/98 (81%) Strand = Plus / Minus Query: 307 cttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgta 366 ||||||||| |||| ||||| ||||||||||||| | ||||| || || | || || Sbjct: 1053 cttcttgggtcccatacagcaacccttgatcatgacgaagtcattgttgacttctccata 994 Query: 367 gtgagggaacccacccatgggggtgatgtccttctcag 404 ||| ||||| |||||||||||||||||| |||||||| Sbjct: 993 gtgggggaaaccacccatgggggtgatggacttctcag 956
>gb|AC005687.1| Arabidopsis thaliana BAC F1I21 from chromosome 1, near 59 cM, complete sequence Length = 129271 Score = 63.9 bits (32), Expect = 4e-07 Identities = 86/104 (82%) Strand = Plus / Minus Query: 305 ctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccg 364 ||||||||||| || || ||||| ||||| ||||| | ||||||| ||||||| | |||| Sbjct: 40480 ctcttcttgggaccaacacagcaccccttaatcatcaagtagtcatccttcacaataccg 40421 Query: 365 tagtgagggaacccacccatgggggtgatgtccttctcagtcct 408 ||||| ||||| || ||||| || || | |||||||||||||| Sbjct: 40420 tagtgtgggaagcctcccattggagtcacatccttctcagtcct 40377
>gb|DQ440217.1| Aedes aegypti clone AET-2405 ribosomal protein L3 mRNA, complete cds Length = 1248 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| |||||||| | ||| || |||||||||||||||||||| ||||| Sbjct: 1142 gtctggaagcgaccatgtcccatcttcgacgaggtgtcgatgaacttgaggttgat 1087
>gb|DQ249176.1| Homo sapiens isolate 218CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic sequence Length = 363675 Score = 63.9 bits (32), Expect = 4e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||| || || ||||||||||||||||| || |||||||| |||||||| |||||||| Sbjct: 110846 cttctcctccgtggtctggaagcggccatggccaaacttggaggaggtgtcaatgaactt 110905
>gb|DQ249173.1| Homo sapiens isolate 135CLS51 haplotype HLA-B140201/HLA-Cw0802 genomic sequence Length = 336776 Score = 63.9 bits (32), Expect = 4e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||| || || ||||||||||||||||| || |||||||| |||||||| |||||||| Sbjct: 89950 cttctcctccgtggtctggaagcggccatggccaaacttggaggaggtgtcaatgaactt 90009
>emb|BX248310.3| Human DNA sequence from clone DASS-311G1 on chromosome 6, complete sequence Length = 116320 Score = 63.9 bits (32), Expect = 4e-07 Identities = 53/60 (88%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||| || || ||||||||||||||||| || |||||||| |||||||| |||||||| Sbjct: 18173 cttctcctccgtggtctggaagcggccatggccaaacttggaggaggtgtcaatgaactt 18114
>emb|AL845443.3| Human DNA sequence from clone DAQB-48K1 on chromosome 6 Contains the USP8P pseudogene for ubiquitin specific protease 8, the RPL3P2 pseudogene for ribosomal protein L3 pseudogene 2, the WASF5P pseudogene for WAS protein family, member 5, the HLA-B gene for major histocompatibility complex, class I, B, the DHFRP2 pseudogene for dihydrofolate reductase 2, the FGFR3P pseudogene for fibroblast growth factor receptor 3, the HLA-S gene for major histocompatibility complex, class I, S, the MICA gene for MHC class I polypeptide-related sequence A and 3 CpG islands, complete sequence Length = 148076 Score = 63.9 bits (32), Expect = 4e-07 Identities = 53/60 (88%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||| || || ||||||||||||||||| || |||||||| |||||||| |||||||| Sbjct: 9600 cttctcctccgtggtctggaagcggccatggccaaacttggaggaggtgtcaatgaactt 9541
>emb|BX070229.1|CNS09QCP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 494 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 382 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 437
>emb|BX069091.1|CNS09PH3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 719 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 370 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 425
>emb|BX067464.1|CNS09O7W Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51AF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 732 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 368 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 423
>emb|BX066688.1|CNS09NMC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50AD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 733 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 372 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 427
>emb|BX063181.1|CNS09KWX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 498 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 390 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 445
>emb|BX062383.1|CNS09KAR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43CF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 473 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 358 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 413
>emb|BX062239.1|CNS09K6R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1023 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 367 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 422
>emb|BX060194.1|CNS09ILY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40BH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 814 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 376 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 431
>emb|BX058958.1|CNS09HNM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 354 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 409
>emb|BX057772.1|CNS09GQO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC37DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 805 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 366 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 421
>emb|BX057771.1|CNS09GQN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC37DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 549 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 494
>emb|BX053703.1|CNS09DLN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31CB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 813 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 384 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 439
>emb|BX052320.1|CNS09CJ8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3BD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 823 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 383 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 438
>emb|BX052207.1|CNS09CG3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3AG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 365 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 420
>emb|BX051342.1|CNS09BS2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC28CE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 505 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 381 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 436
>emb|BX047013.1|CNS098FT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21AA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 412 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 102 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 157
>emb|BX045562.1|CNS097BI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC19DB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 711 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 358 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 413
>emb|BX042075.1|CNS094MN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC13DF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 361 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 416
>emb|BX041788.1|CNS094EO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC13BG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 452 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 376 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 431
>emb|BX041879.1|CNS094H7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC13CC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1010 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 394 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 449
>emb|BX040939.1|CNS093R3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC12AB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 917 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 380 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 435
>emb|BX040435.1|CNS093D3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC11BB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 502 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 347 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 402
>emb|BX040075.1|CNS09333 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 365 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 420
>emb|BX039982.1|CNS0930I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10CB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 880 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 375 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 430
>emb|BX039400.1|CNS092KC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC1AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 366 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 421
>emb|BX037369.1|CNS090ZX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 354 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 409
>emb|BX036641.1|CNS090FP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA8DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 738 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 149 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 204
>emb|BX036928.1|CNS090NO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9AF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 798 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 372 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 427
>emb|BX035976.1|CNS08ZX8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7CC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 371 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 426
>emb|BX034744.1|CNS08YZ0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 817 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 368 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 423
>emb|BX034675.1|CNS08YX3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50CG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 439 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 342 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 397
>emb|BX034953.1|CNS08Z4T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA6AD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 805 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 366 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 421
>emb|BX034935.1|CNS08Z4B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA6AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 399 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 454
>emb|BX034934.1|CNS08Z4A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 853 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 683 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 628
>emb|BX034893.1|CNS08Z35 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA6AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 441 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 368 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 423
>emb|BX034597.1|CNS08YUX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA50CC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 460 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 344 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 399
>emb|BX033937.1|CNS08YCL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1024 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 380 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 435
>emb|BX033936.1|CNS08YCK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5CE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1038 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 977 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 922
>emb|BX033914.1|CNS08YBY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5CD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 793 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 394 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 449
>emb|BX033913.1|CNS08YBX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5CD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 958 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 903
>emb|BX032095.1|CNS08WXF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA47DC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 754 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 365 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 420
>emb|BX030105.1|CNS08VE5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44DH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 378 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 433
>emb|BX029793.1|CNS08V5H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44CA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 503 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 395 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 450
>emb|BX028838.1|CNS08UEY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA43AC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 960 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 368 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 423
>emb|BX022368.1|CNS08PF8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34BA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 834 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 400 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 455
>emb|BX028315.1|CNS08U0F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA42BC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 783 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 281 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 336
>emb|BX028101.1|CNS08TUH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA42AB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 387 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 442
>emb|BX026943.1|CNS08SYB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA40BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 839 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 387 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 442
>emb|BX026942.1|CNS08SYA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA40BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1034 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 958 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 903
>emb|BX025362.1|CNS08RQE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA38DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 381 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 436
>emb|BX022756.1|CNS08PQ0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34DC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 445 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 365 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 420
>emb|BX023768.1|CNS08QI4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA36BB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 381 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 436
>emb|BX023517.1|CNS08QB5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA35DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 782 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 406 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 461
>emb|BX022149.1|CNS08P95 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA32DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1020 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 856 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 801
>emb|BX020590.1|CNS08O1U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA30BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 142 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 68 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 123
>emb|BX016154.1|CNS08KMM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA24AH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 803 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 377 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 432
>emb|BX014588.1|CNS08JF4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA21DH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 802 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 372 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 427
>emb|BX013163.1|CNS08IBJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA2DD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 669 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 376 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 431
>emb|BX012542.1|CNS08HUA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA19DF02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 825 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 376 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 431
>emb|BX011336.1|CNS08GWS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA18AE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 377 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 432
>emb|BX011335.1|CNS08GWR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA18AE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1001 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 973 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 918
>emb|BX009748.1|CNS08FOO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA15CH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 876 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 366 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 421
>emb|BX008998.1|CNS08F3U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA14CG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 372 gtctggaagcgaccatggcctatcttcgacgaggtgtcgatgaacttgagcttgat 427
>emb|BX008818.1|CNS08EYU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA14BF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 385 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 440
>emb|BX008450.1|CNS08EOM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA13DF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 358 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 413
>emb|BX007553.1|CNS08DZP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA12CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 803 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 384 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 439
>emb|BX006242.1|CNS08CZA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA10CD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 383 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 438
>emb|BX006017.1|CNS08CT1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA10BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1015 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 386 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 441
>emb|BX006005.1|CNS08CSP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA10BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 864 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 372 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 427
>emb|BX005636.1|CNS08CIG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA1AH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 820 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 372 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 427
>gb|AC103565.1| Caenorhabditis briggsae cosmid CB019K16, complete sequence Length = 84313 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||||||| |||||||||||||||||| ||||||| ||||| Sbjct: 10218 gtctggaagcgaccatgtccggtcttggatgaggtgtcgatccacttgaggttgat 10273
>ref|XM_313303.2| Anopheles gambiae str. PEST ENSANGP00000011028 (ENSANGG00000008539), partial mRNA Length = 1257 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 1193 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 1138
>gb|AC004204.1|AC004204 Homo sapiens clone UWGC:y3c018 from 6p21, complete sequence Length = 46797 Score = 63.9 bits (32), Expect = 4e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||| || || ||||||||||||||||| || |||||||| |||||||| |||||||| Sbjct: 20416 cttctcctccgtggtctggaagcggccatggccaaacttggaggaggtgtcaatgaactt 20475
>emb|BX064127.1|CNS09LN7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 456 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttga 245 ||||||||||| ||||| || | ||| || ||||||||||||||||||||||||| Sbjct: 363 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttga 417
>emb|BX022547.1|CNS08PK7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA34CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 477 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttga 245 ||||||||||| ||||| || | ||| || ||||||||||||||||||||||||| Sbjct: 362 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttga 416
>emb|BX019299.1|CNS08N1Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA29BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 828 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 192 tctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 |||||||||| ||||| || | ||| || |||||||||||||||||||||||||| Sbjct: 357 tctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 411
>dbj|AB243054.1| Oncorhynchus mykiss mRNA for sex hormone-binding globulin, complete cds Length = 3485 Score = 61.9 bits (31), Expect = 2e-06 Identities = 46/51 (90%) Strand = Plus / Plus Query: 190 tgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgag 240 ||||||||||||||| || || |||||||| | |||||||||||||||||| Sbjct: 154 tgtctggaagcggccgtggccaaacttggaggtggtgtcgatgaacttgag 204
>gb|DQ206600.1| Monosiga brevicollis isolate TOA20 ribosomal protein 3 large subunit mRNA, partial cds Length = 995 Score = 60.0 bits (30), Expect = 6e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgag 240 ||||||||||| || || || |||||||| |||||||||||||||||||| Sbjct: 995 gtctggaagcgaccgtggccaaacttggacgaggtgtcgatgaacttgag 946 Score = 54.0 bits (27), Expect = 4e-04 Identities = 72/87 (82%) Strand = Plus / Minus Query: 307 cttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttcaccacaccgta 366 |||||||| ||| ||| |||||||||||| || ||| | || |||| |||| |||||| Sbjct: 879 cttcttggtgccgacggtgcagcccttgatgatcaggaaatcctccttgaccagaccgta 820 Query: 367 gtgagggaacccacccatgggggtgat 393 ||||||||| || ||||||||| |||| Sbjct: 819 gtgagggaagccgcccatggggttgat 793
>dbj|AB016888.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDH9 Length = 85791 Score = 58.0 bits (29), Expect = 2e-05 Identities = 92/113 (81%) Strand = Plus / Minus Query: 296 gtcaccaccctcttcttggggcccacgcagcagcccttgatcatgaggtagtcacccttc 355 ||||| || |||||||| || |||| |||||| ||||| ||||| | ||||||| ||||| Sbjct: 55241 gtcacaactctcttctttggacccatgcagcaacccttaatcatcaagtagtcatccttc 55182 Query: 356 accacaccgtagtgagggaacccacccatgggggtgatgtccttctcagtcct 408 || | |||||| || | ||| || ||||| || || || |||||||||||||| Sbjct: 55181 actataccgtaatgtgcgaatcctcccattggagttatttccttctcagtcct 55129
>ref|NM_001001590.1| Danio rerio ribosomal protein L3 (rpl3), mRNA Length = 1371 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||||| | |||||||| || ||||| || |||||||| | ||||||||||||||| Sbjct: 1236 cttctcttcgatggtctggaaacgtccatgaccaaacttggaggtggtgtcgatgaactt 1177
>gb|AY769270.1| Bombyx mori ribosomal protein L3 (RpL3) mRNA, complete cds Length = 1298 Score = 56.0 bits (28), Expect = 9e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 |||||||| || ||||| ||||||||||| |||||||| ||||| ||||| ||||| Sbjct: 1145 gtctggaatcgaccatgaccgaacttggacgaggtgtcaatgaatttgaggttgat 1090
>gb|AY439445.1| Armigeres subalbatus ASAP ID: 39847 cytosolic large ribosomal subunit L3 mRNA sequence Length = 912 Score = 56.0 bits (28), Expect = 9e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||| ||| |||||||| | ||| || |||||||||||||||||||| ||||| Sbjct: 717 gtctggaggcgaccatgtcccatctttgacgaggtgtcgatgaacttgaggttgat 662
>gb|AY561514.1| Danio rerio ribosomal protein L3 (rpl3) mRNA, complete cds Length = 1371 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||||| | |||||||| || ||||| || |||||||| | ||||||||||||||| Sbjct: 1236 cttctcttcgatggtctggaaacgtccatgaccaaacttggaggtggtgtcgatgaactt 1177
>emb|AM048987.1| Scarabaeus laticollis mRNA for ribosomal protein L3e (rpL3e gene) Length = 1233 Score = 56.0 bits (28), Expect = 9e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 |||||||| | |||||| |||||||| ||||| |||||||||||||| || ||||| Sbjct: 1142 gtctggaacctgccatggccgaacttcgatgacgtgtcgatgaacttcaggttgat 1087 Score = 40.1 bits (20), Expect = 5.6 Identities = 56/68 (82%) Strand = Plus / Minus Query: 323 cagcagcccttgatcatgaggtagtcacccttcaccacaccgtagtgagggaacccaccc 382 ||||||||||||||||||| | |||| |||||| | |||||||| ||||| || ||| Sbjct: 1010 cagcagcccttgatcatgatgaagtcgttgttcacctcgccgtagtgggggaaaccgccc 951 Query: 383 atgggggt 390 || ||||| Sbjct: 950 atcggggt 943
>gb|DQ249182.1| Homo sapiens isolate 541CLS41 haplotype HLA-B5001/HLA-Cw0602 genomic sequence Length = 346809 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||| || || ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 96129 cttctcctccgtggtctggaagcggccatggccaaacttggagggggtgtcaatgaactt 96188
>gb|DQ249180.1| Homo sapiens isolate 495CLS44 haplotype HLA-B570101/HLA-Cw0602 genomic sequence Length = 265420 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||| || || ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 99288 cttctcctccgtggtctggaagcggccatggccaaacttggagggggtgtcaatgaactt 99347
>gb|DQ249177.1| Homo sapiens isolate 218CLS60 haplotype HLA-B15010101/HLA-Cw030401 genomic sequence Length = 351341 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||| || || ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 110921 cttctcctccgtggtctggaagcggccatggccaaacttggagggggtgtcaatgaactt 110980
>emb|BX070444.1|CNS09QIO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC7CB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 56.0 bits (28), Expect = 9e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| | ||| || | ||| || |||||||||||||||||||||||||| Sbjct: 374 gtctggaagcgacgatggcccatcttcgacgaggtgtcgatgaacttgagcttgat 429
>emb|BX070319.1|CNS09QF7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7BE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 849 Score = 56.0 bits (28), Expect = 9e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagct 242 ||||||||||| ||||| || | ||| || |||||||||||||||||||||| Sbjct: 239 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagct 188
>emb|BX056851.1|CNS09G13 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 415 Score = 56.0 bits (28), Expect = 9e-05 Identities = 46/52 (88%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagct 242 ||||||||||| ||||| || | ||| || |||||||||||||||||||||| Sbjct: 231 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagct 180
>emb|BX050764.1|CNS09BC0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 843 Score = 56.0 bits (28), Expect = 9e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||||||||||||||||| ||||| Sbjct: 361 gtctggaagcgaccatggcccatcttcgacgaggtgtcgatgaacttgagtttgat 416
>emb|BX012729.1|CNS08HZH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA2AF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 56.0 bits (28), Expect = 9e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | || || |||||||||||||||||||||||||| Sbjct: 403 gtctggaagcgaccatggcccattttcgacgaggtgtcgatgaacttgagcttgat 458
>emb|BX011527.1|CNS08H23 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA18BG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 56.0 bits (28), Expect = 9e-05 Identities = 49/56 (87%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaacttgagcttgat 246 ||||||||||| ||||| || | ||| || |||||| ||||||||||||||||||| Sbjct: 361 gtctggaagcgaccatggcccatcttcgacgaggtgccgatgaacttgagcttgat 416
>emb|BX901883.5| Zebrafish DNA sequence from clone DKEY-151M15 in linkage group 3, complete sequence Length = 241961 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||||| | |||||||| || ||||| || |||||||| | ||||||||||||||| Sbjct: 170096 cttctcttcgatggtctggaaacgtccatgaccaaacttggaggtggtgtcgatgaactt 170155
>emb|CR759828.5| Human DNA sequence from clone DAMC-153L10 on chromosome 6, complete sequence Length = 102821 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||| || || ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 20109 cttctcctccgtggtctggaagcggccatggccaaacttggagggggtgtcaatgaactt 20050
>emb|CR759814.6| Human DNA sequence from clone DADB-15N24 on chromosome 6, complete sequence Length = 63499 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||| || || ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 2029 cttctcctccgtggtctggaagcggccatggccaaacttggagggggtgtcaatgaactt 1970
>dbj|AB169493.1| Macaca fascicularis brain cDNA, clone: QccE-11024, similar to human ribosomal protein L3 (RPL3), mRNA, RefSeq: NM_000967.2 Length = 1310 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||| | ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1182 cttctcttccatggtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1123
>gb|BC091460.1| Danio rerio ribosomal protein L3, mRNA (cDNA clone MGC:110350 IMAGE:7403740), complete cds Length = 1324 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Minus Query: 178 cttctcttcggttgtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 |||||||||| | |||||||| || ||||| || |||||||| | ||||||||||||||| Sbjct: 1178 cttctcttcgatggtctggaaacgtccatgaccaaacttggaggtggtgtcgatgaactt 1119
>gb|BC088373.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:111436 IMAGE:6195715), complete cds Length = 1305 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1165 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1119
>gb|BC107711.1| Homo sapiens ribosomal protein L3, transcript variant 1, mRNA (cDNA clone MGC:104284 IMAGE:6699816), complete cds Length = 1325 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1172 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1126
>ref|XM_525601.1| PREDICTED: Pan troglodytes similar to ribosomal protein L3; 60S ribosomal protein L3; HIV-1 TAR RNA-binding protein B (LOC470216), mRNA Length = 2523 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1181 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1135
>gb|BC012786.2| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:16463 IMAGE:3951917), complete cds Length = 1323 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1155 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1109
>gb|BC058494.1| Rattus norvegicus ribosomal protein L3, mRNA (cDNA clone MGC:72934 IMAGE:6887923), complete cds Length = 1320 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||| ||||||||||| ||||| | |||||| |||||||| Sbjct: 1171 gtctggaagcgaccatgtccgaatttggaggtggtgtcaatgaactt 1125
>gb|BC063662.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:70878 IMAGE:3852576), complete cds Length = 1299 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1155 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1109
>gb|BC015767.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:23196 IMAGE:4861546), complete cds Length = 1295 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1151 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1105
>gb|BC013674.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:17324 IMAGE:4152521), complete cds Length = 1317 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1151 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1105
>gb|BC008492.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:14821 IMAGE:4251511), complete cds Length = 1322 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1168 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1122
>gb|BC008003.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:15830 IMAGE:3507481), complete cds Length = 1291 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1147 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1101
>gb|BC033296.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone IMAGE:4510463), partial cds Length = 1299 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1148 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1102
>gb|BC004323.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone IMAGE:3628762), partial cds Length = 952 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 809 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 763
>gb|BC012146.1| Homo sapiens ribosomal protein L3, transcript variant 1, mRNA (cDNA clone MGC:20359 IMAGE:4549682), complete cds Length = 1298 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1155 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1109
>gb|BC017593.1| Homo sapiens cDNA clone IMAGE:2988782, **** WARNING: chimeric clone **** Length = 3547 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 3404 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 3358
>gb|BC041578.1| Homo sapiens zinc finger protein 114, mRNA (cDNA clone IMAGE:4640152), **** WARNING: chimeric clone **** Length = 3538 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 3395 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 3349
>emb|AL022326.1|HS333H23 Human DNA sequence from clone RP3-333H23 on chromosome 22q12.1-12.3 Contains the (possibly alternatively spliced) RPL3 gene for 60S Ribosomal Protein L3 and the threefold alternatively spliced gene for Synaptogyrin 1A, 1B and 1C (SYNGR1A, SYBGRIB, SYNGR1C), both genes downstream of a putative CpG island. Contains ESTs, an STS, GSSs, and a ca repeat (D22S1155) polymorphism, complete sequence Length = 122888 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 46253 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 46299
>gb|AY320405.1| Homo sapiens nasopharyngeal carcinoma-associated antigen NPC-A-12 mRNA, complete cds Length = 1414 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1289 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1243
>emb|X73460.1|HSRPL3A H.sapiens mRNA for ribosomal protein L3 Length = 1272 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1148 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1102
>emb|X62166.1|RRRPL3 R.rattus mRNA for ribosomal protein L3 Length = 1316 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||| ||||||||||| ||||| | |||||| |||||||| Sbjct: 1172 gtctggaagcgaccatgtccgaatttggaggtggtgtcaatgaactt 1126
>gb|BC036582.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:42068 IMAGE:4796724), complete cds Length = 2127 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1987 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1941
>emb|CR926481.1| Pongo pygmaeus mRNA; cDNA DKFZp468G0827 (from clone DKFZp468G0827) Length = 1932 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1786 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1740
>gb|BC014017.2| Homo sapiens ribosomal protein L3, mRNA (cDNA clone MGC:20304 IMAGE:4128023), complete cds Length = 1311 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1150 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1104
>emb|BX927178.8| Human DNA sequence from clone DAMA-387C9 on chromosome 6, complete sequence Length = 106199 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 20680 gtctggaagcggccatggccaaacttggagggggtgtcaatgaactt 20634
>gb|BC006483.1| Homo sapiens ribosomal protein L3, mRNA (cDNA clone IMAGE:2905497), complete cds Length = 1304 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1155 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1109
>emb|CR615684.1| full-length cDNA clone CS0DG004YH06 of B cells (Ramos cell line) of Homo sapiens (human) Length = 1230 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1119 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1073
>emb|AL832757.1|HSM804068 Homo sapiens mRNA; cDNA DKFZp686B0827 (from clone DKFZp686B0827) Length = 5458 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 5107 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 5061
>emb|CR626505.1| full-length cDNA clone CS0DJ010YA12 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1251 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR626451.1| full-length cDNA clone CS0DA008YH04 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR626261.1| full-length cDNA clone CS0DF015YH20 of Fetal brain of Homo sapiens (human) Length = 1265 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR625577.1| full-length cDNA clone CS0DI063YL04 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1234 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR625496.1| full-length cDNA clone CS0DI084YC13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR625393.1| full-length cDNA clone CS0DI003YJ22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1213 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR625263.1| full-length cDNA clone CL0BB015ZB11 of Neuroblastoma of Homo sapiens (human) Length = 760 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 634 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 588
>emb|CR624992.1| full-length cDNA clone CL0BB016ZB06 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR623791.1| full-length cDNA clone CS0DM002YH24 of Fetal liver of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR623564.1| full-length cDNA clone CS0DI019YJ17 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1353 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1320 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1274
>emb|CR622788.1| full-length cDNA clone CS0DJ013YE08 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 1265 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR621566.1| full-length cDNA clone CL0BB003ZH08 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR621265.1| full-length cDNA clone CS0DA008YD14 of Neuroblastoma of Homo sapiens (human) Length = 1227 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1102 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1056
>emb|CR620145.1| full-length cDNA clone CS0DI057YK20 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1236 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR619471.1| full-length cDNA clone CS0DH005YK18 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1264 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR619715.1| full-length cDNA clone CS0DH003YK05 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1269 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR619632.1| full-length cDNA clone CS0DF020YI04 of Fetal brain of Homo sapiens (human) Length = 1265 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR619057.1| full-length cDNA clone CS0DA001YB02 of Neuroblastoma of Homo sapiens (human) Length = 904 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 778 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 732
>emb|CR617467.1| full-length cDNA clone CL0BB009ZB12 of Neuroblastoma of Homo sapiens (human) Length = 1264 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR617147.1| full-length cDNA clone CS0DI072YC22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1228 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR616770.1| full-length cDNA clone CS0DA001YA11 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR616722.1| full-length cDNA clone CS0DI084YN09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR615390.1| full-length cDNA clone CL0BB025ZG06 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR613925.1| full-length cDNA clone CL0BB014ZD01 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR609557.1| full-length cDNA clone CS0DE007YI06 of Placenta of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR612896.1| full-length cDNA clone CS0DA004YC12 of Neuroblastoma of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR612782.1| full-length cDNA clone CS0DA007YN20 of Neuroblastoma of Homo sapiens (human) Length = 1265 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR612126.1| full-length cDNA clone CS0DM006YJ05 of Fetal liver of Homo sapiens (human) Length = 849 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 723 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 677
>emb|CR611722.1| full-length cDNA clone CS0DK002YP16 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 254 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 128 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 82
>emb|CR610441.1| full-length cDNA clone CS0DH006YF09 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 949 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 823 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 777
>emb|CR608886.1| full-length cDNA clone CS0DH007YL14 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>dbj|AK092695.1| Homo sapiens cDNA FLJ35376 fis, clone SKMUS2004044, highly similar to 60S RIBOSOMAL PROTEIN L3 Length = 1160 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1021 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 975
>emb|CR608723.1| full-length cDNA clone CS0DN004YH20 of Adult brain of Homo sapiens (human) Length = 1226 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR607725.1| full-length cDNA clone CS0DI070YF03 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR607164.1| full-length cDNA clone CS0DK005YF16 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1267 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR605080.1| full-length cDNA clone CS0DI031YB01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1233 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR605015.1| full-length cDNA clone CS0DF024YK22 of Fetal brain of Homo sapiens (human) Length = 1216 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR605531.1| full-length cDNA clone CL0BB009ZC01 of Neuroblastoma of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR604030.1| full-length cDNA clone CS0DE014YE11 of Placenta of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR602004.1| full-length cDNA clone CS0DH005YI17 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR601663.1| full-length cDNA clone CS0DF008YN16 of Fetal brain of Homo sapiens (human) Length = 1243 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR601581.1| full-length cDNA clone CS0DI053YP13 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1212 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR601189.1| full-length cDNA clone CS0DE009YE21 of Placenta of Homo sapiens (human) Length = 1268 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR599095.1| full-length cDNA clone CS0DH003YB10 of T cells (Jurkat cell line) of Homo sapiens (human) Length = 1269 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR597745.1| full-length cDNA clone CS0DI076YC23 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1236 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR597737.1| full-length cDNA clone CS0DI083YH07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1229 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR597498.1| full-length cDNA clone CS0DN005YH11 of Adult brain of Homo sapiens (human) Length = 1253 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR597485.1| full-length cDNA clone CS0DI027YH23 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094
>emb|CR597097.1| full-length cDNA clone CS0DK006YJ04 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1266 Score = 54.0 bits (27), Expect = 4e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 191 gtctggaagcggccatgtccgaacttggatgaggtgtcgatgaactt 237 ||||||||||||||||| || |||||||| | |||||| |||||||| Sbjct: 1140 gtctggaagcggccatggccaaacttggaggtggtgtcaatgaactt 1094 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,297,275 Number of Sequences: 3902068 Number of extensions: 3297275 Number of successful extensions: 55485 Number of sequences better than 10.0: 542 Number of HSP's better than 10.0 without gapping: 541 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 54490 Number of HSP's gapped (non-prelim): 974 length of query: 419 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 397 effective length of database: 17,147,199,772 effective search space: 6807438309484 effective search space used: 6807438309484 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
