ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart56f10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009213.1| Triticum aestivum clone wle1n.pk0057.g6:fis, full... 141 2e-30
2gb|AC079907.25| Homo sapiens 12q BAC RP11-554E23 (Roswell Park C... 44 0.29
3gb|AY046315.3| Bradyrhizobium japonicum inner membrane ABC trans... 40 4.6
4gb|AC105071.7| Mus musculus, clone RP23-277C24, complete sequence 40 4.6
5gb|AC026688.7| Homo sapiens chromosome 5 clone CTB-158E9, comple... 40 4.6
6gb|AC134620.4| Homo sapiens BAC clone RP11-1432C17 from 4, compl... 40 4.6
7dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 4.6

>gb|BT009213.1| Triticum aestivum clone wle1n.pk0057.g6:fis, full insert mRNA
            sequence
          Length = 1405

 Score =  141 bits (71), Expect = 2e-30
 Identities = 205/244 (84%), Gaps = 18/244 (7%)
 Strand = Plus / Minus

                                                                        
Query: 107  taacaaacggtgtcgacagttcaacagaggaacggcaaacccgcacccgcccctgtatgt 166
            |||||||||||||||||| ||||||||||||| ||||||||| |      ||||||||||
Sbjct: 1369 taacaaacggtgtcgacaattcaacagaggaatggcaaacccac------ccctgtatgt 1316

                                                                        
Query: 167  agaacacaggaaggggctgatcggcac-aatataatgcccaaatagaatcttcggtttcc 225
             || ||||   |||||  |||| |||| ||||||||||||| |  ||||| || ||||| 
Sbjct: 1315 ggagcaca---aggggtcgatccgcacgaatataatgcccaca--gaatcctcagtttcg 1261

                                                                        
Query: 226  cttcgggatcccgggtacgaatgctacaaacacataggcaccggtgtccgctgtttctgg 285
            |||| | ||| ||||||||||||||| || |||||||||||||||||| |||||||||||
Sbjct: 1260 cttctg-atctcgggtacgaatgctataagcacataggcaccggtgtctgctgtttctgg 1202

                                                                        
Query: 286  cactacaggcttagttcagtctggc--gacatcaaagccagtagcacattttattgtgga 343
             |||||||| | |||||||||||||  |||||||||||||||   ||||||||||| |||
Sbjct: 1201 tactacaggttcagttcagtctggcgagacatcaaagccagt---acattttattgcgga 1145

                
Query: 344  gcac 347
            ||||
Sbjct: 1144 gcac 1141



to top

>gb|AC079907.25| Homo sapiens 12q BAC RP11-554E23 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 184840

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 72    ccaaaaaagcacacaccaacaaataa 97
             ||||||||||||| ||||||||||||
Sbjct: 95167 ccaaaaaagcacaaaccaacaaataa 95142



to top

>gb|AY046315.3| Bradyrhizobium japonicum inner membrane ABC transporter (ndvA) gene,
            partial cds; Pbp, phosphoribosyl-ATP pyrophosphohydrolase
            (his2), DedA (dedA), aspartate ammonium lyase (aspA), and
            fatty acid CoA-ligase (coaL) genes, complete cds; and
            unknown genes
          Length = 10628

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 256  cacataggcaccggtgtccg 275
            ||||||||||||||||||||
Sbjct: 6278 cacataggcaccggtgtccg 6259



to top

>gb|AC105071.7| Mus musculus, clone RP23-277C24, complete sequence
          Length = 199946

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     caaagaagcacacacccaaa 21
             ||||||||||||||||||||
Sbjct: 65425 caaagaagcacacacccaaa 65406



to top

>gb|AC026688.7| Homo sapiens chromosome 5 clone CTB-158E9, complete sequence
          Length = 134778

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 167   agaacacaggaaggggctga 186
             ||||||||||||||||||||
Sbjct: 55148 agaacacaggaaggggctga 55129



to top

>gb|AC134620.4| Homo sapiens BAC clone RP11-1432C17 from 4, complete sequence
          Length = 80150

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 317   aaagccagtagcacatttta 336
             ||||||||||||||||||||
Sbjct: 60394 aaagccagtagcacatttta 60375



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 256     cacataggcaccggtgtccg 275
               ||||||||||||||||||||
Sbjct: 1440699 cacataggcaccggtgtccg 1440680


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,646,862
Number of Sequences: 3902068
Number of extensions: 2646862
Number of successful extensions: 46189
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46171
Number of HSP's gapped (non-prelim): 16
length of query: 347
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 325
effective length of database: 17,147,199,772
effective search space: 5572839925900
effective search space used: 5572839925900
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top