ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart56d02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AF123608.1|AF123608 Triticum aestivum clone CYP73-TA cytochro... 325 6e-86
2gb|AY034143.1| Sorghum bicolor cinnamic acid 4-hydroxylase (C4H)... 234 2e-58
3gb|AY104175.1| Zea mays PCO098406 mRNA sequence 234 2e-58
4gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome... 224 2e-55
5dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 224 2e-55
6dbj|AK104994.2| Oryza sativa (japonica cultivar-group) cDNA clon... 224 2e-55
7dbj|AK100598.1| Oryza sativa (japonica cultivar-group) cDNA clon... 224 2e-55
8dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 145 1e-31
9dbj|AP003446.3| Oryza sativa (japonica cultivar-group) genomic D... 145 1e-31
10gb|AY616436.1| Agastache rugosa cinnamic acid 4-hydroxylase mRNA... 107 3e-20
11gb|U19922.1|ZEU19922 Zinnia elegans cinnamic acid 4-hydroxylase ... 64 4e-07
12ref|XM_465542.1| Oryza sativa (japonica cultivar-group), mRNA 56 9e-05
13ref|XM_465538.1| Oryza sativa (japonica cultivar-group), mRNA 56 9e-05
14dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
15dbj|AP004850.3| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
16dbj|AK072588.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
17gb|AC158158.6| Mus musculus chromosome 1, clone RP23-10D8, compl... 46 0.084
18gb|AC110266.15| Mus musculus chromosome 1, clone RP23-319C1, com... 46 0.084
19gb|AY670393.1| Pinus taeda isolate 27 trans-cinnamate 4-hydroxyl... 44 0.33
20gb|AY670388.1| Pinus taeda isolate 28 trans-cinnamate 4-hydroxyl... 44 0.33
21gb|AY670384.1| Pinus taeda isolate 10 trans-cinnamate 4-hydroxyl... 44 0.33
22gb|AY670382.1| Pinus taeda isolate 30 trans-cinnamate 4-hydroxyl... 44 0.33
23gb|AY670380.1| Pinus taeda isolate 25 trans-cinnamate 4-hydroxyl... 44 0.33
24gb|AY670377.1| Pinus taeda isolate 24 trans-cinnamate 4-hydroxyl... 44 0.33
25gb|AY670376.1| Pinus taeda isolate 20 trans-cinnamate 4-hydroxyl... 44 0.33
26gb|AY670375.1| Pinus taeda isolate 15 trans-cinnamate 4-hydroxyl... 44 0.33
27gb|AY670372.1| Pinus taeda isolate 21 trans-cinnamate 4-hydroxyl... 44 0.33
28gb|AY670371.1| Pinus taeda isolate 18 trans-cinnamate 4-hydroxyl... 44 0.33
29gb|AY670370.1| Pinus taeda isolate 12 trans-cinnamate 4-hydroxyl... 44 0.33
30gb|AY670367.1| Pinus taeda isolate 23 trans-cinnamate 4-hydroxyl... 44 0.33
31gb|AY670363.1| Pinus taeda isolate 6 trans-cinnamate 4-hydroxyla... 44 0.33
32gb|AY670362.1| Pinus taeda isolate 16 trans-cinnamate 4-hydroxyl... 44 0.33
33gb|AC124764.3| Mus musculus BAC clone RP23-166K1 from chromosome... 44 0.33
34gb|AF096998.1| Pinus taeda trans-cinnamate 4-hydroxylase (TC4H) ... 44 0.33
35gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 44 0.33
36dbj|AB088224.1| Streptomyces rochei plasmid pSLA2-L DNA, complet... 44 0.33
37gb|U55006.1|PEU55006 Pinus elliottii PEC18 mRNA, partial sequence 44 0.33
38gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 42 1.3
39dbj|BA000011.4| Thermoplasma volcanium GSS1 DNA, complete genome 42 1.3
40dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 42 1.3
41ref|NM_198321.2| Homo sapiens UDP-N-acetyl-alpha-D-galactosamine... 40 5.2
42gb|AY528720.1| Danio rerio activation-induced cytidine deaminase... 40 5.2
43gb|BC050333.1| Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:p... 40 5.2
44ref|XM_976546.1| PREDICTED: Mus musculus membrane-associated rin... 40 5.2
45ref|XM_816528.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 5.2
46ref|XM_546283.2| PREDICTED: Canis familiaris similar to GalNAc t... 40 5.2
47gb|AC079804.5| Homo sapiens BAC clone RP11-740N7 from 7, complet... 40 5.2
48gb|AC010295.7| Homo sapiens chromosome 5 clone CTB-143H13, compl... 40 5.2
49ref|NM_001008403.1| Danio rerio activation-induced cytidine deam... 40 5.2
50ref|XM_775811.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 5.2
51emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 5.2
52gb|AC148832.5| Pan troglodytes BAC clone CH251-48K6 from chromos... 40 5.2
53dbj|AK127135.1| Homo sapiens cDNA FLJ45192 fis, clone BRAWH30495... 40 5.2
54dbj|AB234902.1| Verbena x hybrida mRNA for Cinnamic acid 4-hydro... 40 5.2
55gb|AF368379.1| Nicotiana tabacum elicitor-inducible cytochrome P... 40 5.2
56gb|AF368378.1| Nicotiana tabacum elicitor-inducible cytochrome P... 40 5.2
57dbj|AK158026.1| Mus musculus adult inner ear cDNA, RIKEN full-le... 40 5.2
58gb|AC148692.1| Macaca mulatta Major Histocompatibility Complex B... 40 5.2
59gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex B... 40 5.2
60gb|AC148660.1| Macaca mulatta Major Histocompatibility Complex B... 40 5.2
61gb|DQ075002.1| Malus x domestica cinnamic acid hydroxylase (C4H1... 40 5.2
62ref|NM_001033262.1| Mus musculus membrane-associated ring finger... 40 5.2
63emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro... 40 5.2
64gb|AC131760.4| Mus musculus BAC clone RP24-220M2 from 10, comple... 40 5.2
65gb|AC134329.3| Mus musculus BAC clone RP24-310D17 from 10, compl... 40 5.2
66emb|CR848818.10| Zebrafish DNA sequence from clone DKEY-38O19 in... 40 5.2
67dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 40 5.2 
>gb|AF123608.1|AF123608 Triticum aestivum clone CYP73-TA cytochrome P450 mRNA, complete cds
          Length = 1506

 Score =  325 bits (164), Expect = 6e-86
 Identities = 182/188 (96%)
 Strand = Plus / Minus

                                                                        
Query: 201  aagcctcgagtggcttgcagacgatggtggcgtgcctgaggatctggttgctgaactgcc 260
            |||||||||||||||||||||| |||||||||||| |||||||||||||| | |||||||
Sbjct: 1504 aagcctcgagtggcttgcagacaatggtggcgtgcttgaggatctggttggtaaactgcc 1445

                                                                        
Query: 261  ctggcttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttct 320
            | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 1444 cgggcttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctggaagttct 1385

                                                                        
Query: 321  gcaccaggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagc 380
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1384 gcaccaggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagc 1325

                    
Query: 381  tccggcgg 388
            ||||||||
Sbjct: 1324 tccggcgg 1317
to top
>gb|AY034143.1| Sorghum bicolor cinnamic acid 4-hydroxylase (C4H) mRNA, complete cds
          Length = 1762

 Score =  234 bits (118), Expect = 2e-58
 Identities = 169/186 (90%)
 Strand = Plus / Minus

                                                                        
Query: 203  gcctcgagtggcttgcagacgatggtggcgtgcctgaggatctggttgctgaactgccct 262
            |||||||| |||||||||||||| ||||| ||| |   |||||||||||||||||| || 
Sbjct: 1568 gcctcgaggggcttgcagacgattgtggcatgcttagcgatctggttgctgaactggccg 1509

                                                                        
Query: 263  ggcttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgc 322
            |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 1508 ggcttctccgtggtgtcgatcttgtcctgccccggcggcggcagcagctggaagttctgc 1449

                                                                        
Query: 323  accaggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctc 382
            ||||| |  || || |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 1448 accagcctgcccagggtgatgccgatgataggcagcgcgaggatgatcccggggcagctc 1389

                  
Query: 383  cggcgg 388
            ||||||
Sbjct: 1388 cggcgg 1383
to top
>gb|AY104175.1| Zea mays PCO098406 mRNA sequence
          Length = 1755

 Score =  234 bits (118), Expect = 2e-58
 Identities = 169/186 (90%)
 Strand = Plus / Minus

                                                                        
Query: 203  gcctcgagtggcttgcagacgatggtggcgtgcctgaggatctggttgctgaactgccct 262
            |||||||| |||||||| ||||||||||| ||| ||  |||||||||||||||||| || 
Sbjct: 1566 gcctcgaggggcttgcaaacgatggtggcatgcttggcgatctggttgctgaactggccg 1507

                                                                        
Query: 263  ggcttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgc 322
            |||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||
Sbjct: 1506 ggcttctccgtggtgtcgatcttgtccagccccggcggcggcagcagctggaagttctgc 1447

                                                                        
Query: 323  accaggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctc 382
            ||||| || || || |||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 1446 accagccggcccagggtgatgccgatgataggcagcgcgaggatgatcccagggcagctc 1387

                  
Query: 383  cggcgg 388
            ||||||
Sbjct: 1386 cggcgg 1381
to top
>gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0006B22,
              complete sequence
          Length = 166052

 Score =  224 bits (113), Expect = 2e-55
 Identities = 161/177 (90%)
 Strand = Plus / Plus

                                                                          
Query: 212    ggcttgcagacgatggtggcgtgcctgaggatctggttgctgaactgccctggcttctcg 271
              ||||||||||||| |||||||||| |||||||||||||||||||||| || |||||||||
Sbjct: 102219 ggcttgcagacgacggtggcgtgcttgaggatctggttgctgaactggccgggcttctcg 102278

                                                                          
Query: 272    gtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgt 331
              |||||||| | |||||||  ||| |||||||||||||| |||||| |||| || ||||| 
Sbjct: 102279 gtggtgtccaccttgtccatcccgggcggcggcagcaggtcgaagctctggacgaggcgg 102338

                                                                       
Query: 332    ccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccggcgg 388
              ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 102339 ccgagcgtgatcccgatgatgggcagcgcgaggatgatcccggggcagctgcggcgg 102395
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  224 bits (113), Expect = 2e-55
 Identities = 161/177 (90%)
 Strand = Plus / Plus

                                                                            
Query: 212      ggcttgcagacgatggtggcgtgcctgaggatctggttgctgaactgccctggcttctcg 271
                ||||||||||||| |||||||||| |||||||||||||||||||||| || |||||||||
Sbjct: 14766805 ggcttgcagacgacggtggcgtgcttgaggatctggttgctgaactggccgggcttctcg 14766864

                                                                            
Query: 272      gtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgt 331
                |||||||| | |||||||  ||| |||||||||||||| |||||| |||| || ||||| 
Sbjct: 14766865 gtggtgtccaccttgtccatcccgggcggcggcagcaggtcgaagctctggacgaggcgg 14766924

                                                                         
Query: 332      ccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccggcgg 388
                ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 14766925 ccgagcgtgatcccgatgatgggcagcgcgaggatgatcccggggcagctgcggcgg 14766981
to top
>dbj|AK104994.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-H11, full
            insert sequence
          Length = 1796

 Score =  224 bits (113), Expect = 2e-55
 Identities = 161/177 (90%)
 Strand = Plus / Minus

                                                                        
Query: 212  ggcttgcagacgatggtggcgtgcctgaggatctggttgctgaactgccctggcttctcg 271
            ||||||||||||| |||||||||| |||||||||||||||||||||| || |||||||||
Sbjct: 1569 ggcttgcagacgacggtggcgtgcttgaggatctggttgctgaactggccgggcttctcg 1510

                                                                        
Query: 272  gtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgt 331
            |||||||| | |||||||  ||| |||||||||||||| |||||| |||| || ||||| 
Sbjct: 1509 gtggtgtccaccttgtccatcccgggcggcggcagcaggtcgaagctctggacgaggcgg 1450

                                                                     
Query: 332  ccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccggcgg 388
            ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1449 ccgagcgtgatcccgatgatgggcagcgcgaggatgatcccggggcagctgcggcgg 1393
to top
>dbj|AK100598.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023107C01, full
            insert sequence
          Length = 1838

 Score =  224 bits (113), Expect = 2e-55
 Identities = 161/177 (90%)
 Strand = Plus / Minus

                                                                        
Query: 212  ggcttgcagacgatggtggcgtgcctgaggatctggttgctgaactgccctggcttctcg 271
            ||||||||||||| |||||||||| |||||||||||||||||||||| || |||||||||
Sbjct: 1567 ggcttgcagacgacggtggcgtgcttgaggatctggttgctgaactggccgggcttctcg 1508

                                                                        
Query: 272  gtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgt 331
            |||||||| | |||||||  ||| |||||||||||||| |||||| |||| || ||||| 
Sbjct: 1507 gtggtgtccaccttgtccatcccgggcggcggcagcaggtcgaagctctggacgaggcgg 1448

                                                                     
Query: 332  ccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctccggcgg 388
            ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1447 ccgagcgtgatcccgatgatgggcagcgcgaggatgatcccggggcagctgcggcgg 1391
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  145 bits (73), Expect = 1e-31
 Identities = 139/161 (86%)
 Strand = Plus / Plus

                                                                            
Query: 224      atggtggcgtgcctgaggatctggttgctgaactgccctggcttctcggtggtgtcgatc 283
                ||||||| |||| | ||||| |||  ||||||||||||   ||||||||||||||||| |
Sbjct: 34955260 atggtggagtgcttcaggatgtggaggctgaactgcccacccttctcggtggtgtcgacc 34955319

                                                                            
Query: 284      ttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgtccgagcgtgatg 343
                 |||||| ||| |||||||||||||||||||||||||| || ||||| ||||  |||| |
Sbjct: 34955320 ctgtccttcccgggcggcggcagcagctcgaagttctggacgaggcggccgatggtgacg 34955379

                                                         
Query: 344      ccgatgatgggcagcgcgaggatgatcccggggcagctccg 384
                |||| ||||||||||||||||| ||| ||||||||||||||
Sbjct: 34955380 ccgaggatgggcagcgcgaggacgatgccggggcagctccg 34955420
to top
>dbj|AP003446.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1529_G03
          Length = 100635

 Score =  145 bits (73), Expect = 1e-31
 Identities = 139/161 (86%)
 Strand = Plus / Plus

                                                                         
Query: 224   atggtggcgtgcctgaggatctggttgctgaactgccctggcttctcggtggtgtcgatc 283
             ||||||| |||| | ||||| |||  ||||||||||||   ||||||||||||||||| |
Sbjct: 84624 atggtggagtgcttcaggatgtggaggctgaactgcccacccttctcggtggtgtcgacc 84683

                                                                         
Query: 284   ttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgtccgagcgtgatg 343
              |||||| ||| |||||||||||||||||||||||||| || ||||| ||||  |||| |
Sbjct: 84684 ctgtccttcccgggcggcggcagcagctcgaagttctggacgaggcggccgatggtgacg 84743

                                                      
Query: 344   ccgatgatgggcagcgcgaggatgatcccggggcagctccg 384
             |||| ||||||||||||||||| ||| ||||||||||||||
Sbjct: 84744 ccgaggatgggcagcgcgaggacgatgccggggcagctccg 84784
to top
>gb|AY616436.1| Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.~~
          Length = 1676

 Score =  107 bits (54), Expect = 3e-20
 Identities = 102/118 (86%)
 Strand = Plus / Minus

                                                                        
Query: 266  ttctcggtggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctgcacc 325
            ||||| ||||||||||||||   || |||||| || ||||||||||| ||||||||||||
Sbjct: 1507 ttctctgtggtgtcgatcttcgacttccccggaggaggcagcagctcaaagttctgcacc 1448

                                                                      
Query: 326  aggcgtccgagcgtgatgccgatgatgggcagcgcgaggatgatcccggggcagctcc 383
            |||||||| | ||||||||| |  || |||| |||||| |||||||||||||||||||
Sbjct: 1447 aggcgtcccaacgtgatgccaagaataggcaacgcgagaatgatcccggggcagctcc 1390
to top
>gb|U19922.1|ZEU19922 Zinnia elegans cinnamic acid 4-hydroxylase mRNA, complete cds
          Length = 1648

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 283  cttgtcctgccccggcggcggcagcagctcgaagttctgcaccaggcgtccgagcgtgat 342
            ||||||||| || |||||||||| ||||||||| ||||||||||| || |||| ||||||
Sbjct: 1453 cttgtcctgtccgggcggcggcaacagctcgaaattctgcaccagccgcccgatcgtgat 1394
to top
>ref|XM_465542.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1910

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 349  gatgggcagcgcgaggatgatcccggggcagctccggcgg 388
            |||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 1557 gatgggcagcgccaggatgatccccgggcagctgcggcgg 1518
to top
>ref|XM_465538.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1602

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 349  gatgggcagcgcgaggatgatcccggggcagctccggcgg 388
            |||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 1452 gatgggcagcgccaggatgatccccgggcagctgcggcgg 1413
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                        
Query: 349      gatgggcagcgcgaggatgatcccggggcagctccggcgg 388
                |||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 15836284 gatgggcagcgccaggatgatccccgggcagctgcggcgg 15836245



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                        
Query: 349      gatgggcagcgcgaggatgatcccggggcagctccggcgg 388
                |||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 15816982 gatgggcagcgccaggatgatccccgggcagctgcggcgg 15817021
to top
>dbj|AP004850.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1342_D02
          Length = 125460

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                     
Query: 349   gatgggcagcgcgaggatgatcccggggcagctccggcgg 388
             |||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 94224 gatgggcagcgccaggatgatccccgggcagctgcggcgg 94185



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 349   gatgggcagcgcgaggatgatcccggggcagctccggcgg 388
             |||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 74922 gatgggcagcgccaggatgatccccgggcagctgcggcgg 74961
to top
>dbj|AK072588.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132G16, full
            insert sequence
          Length = 1910

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 349  gatgggcagcgcgaggatgatcccggggcagctccggcgg 388
            |||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 1558 gatgggcagcgccaggatgatccccgggcagctgcggcgg 1519
to top
>gb|AC158158.6| Mus musculus chromosome 1, clone RP23-10D8, complete sequence
          Length = 193479

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 80    caacaccaaagaaaaattaaacttact 106
             |||||||||||||| ||||||||||||
Sbjct: 97110 caacaccaaagaaatattaaacttact 97136
to top
>gb|AC110266.15| Mus musculus chromosome 1, clone RP23-319C1, complete sequence
          Length = 177482

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 80   caacaccaaagaaaaattaaacttact 106
            |||||||||||||| ||||||||||||
Sbjct: 4472 caacaccaaagaaatattaaacttact 4498
to top
>gb|AY670393.1| Pinus taeda isolate 27 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670388.1| Pinus taeda isolate 28 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670384.1| Pinus taeda isolate 10 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670382.1| Pinus taeda isolate 30 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670380.1| Pinus taeda isolate 25 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670377.1| Pinus taeda isolate 24 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670376.1| Pinus taeda isolate 20 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670375.1| Pinus taeda isolate 15 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670372.1| Pinus taeda isolate 21 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670371.1| Pinus taeda isolate 18 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670370.1| Pinus taeda isolate 12 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670367.1| Pinus taeda isolate 23 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670363.1| Pinus taeda isolate 6 trans-cinnamate 4-hydroxylase 2 (c4h-2) gene,
           partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AY670362.1| Pinus taeda isolate 16 trans-cinnamate 4-hydroxylase 2 (c4h-2)
           gene, partial cds
          Length = 522

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 290 tgccccggcggcggcagcagctcgaagttctgcaccag 327
           ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 458 tgcccaggcggaggcagcagctcaaagttctgaaccag 421
to top
>gb|AC124764.3| Mus musculus BAC clone RP23-166K1 from chromosome 18, complete sequence
          Length = 209579

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 30    aactatttggaaatttacaaca 51
             ||||||||||||||||||||||
Sbjct: 60597 aactatttggaaatttacaaca 60576
to top
>gb|AF096998.1| Pinus taeda trans-cinnamate 4-hydroxylase (TC4H) mRNA, complete cds
          Length = 1996

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 290  tgccccggcggcggcagcagctcgaagttctgcaccag 327
            ||||| ||||| ||||||||||| |||||||| |||||
Sbjct: 1504 tgcccaggcggaggcagcagctcaaagttctgaaccag 1467
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 355     cagcgcgaggatgatcccgggg 376
               ||||||||||||||||||||||
Sbjct: 2623598 cagcgcgaggatgatcccgggg 2623619
to top
>dbj|AB088224.1| Streptomyces rochei plasmid pSLA2-L DNA, complete sequence
          Length = 210614

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 288    cctgccccggcggcggcagcagctcg 313
              ||||| ||||||||||||||||||||
Sbjct: 187673 cctgcaccggcggcggcagcagctcg 187648
to top
>gb|U55006.1|PEU55006 Pinus elliottii PEC18 mRNA, partial sequence
          Length = 404

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 292 ccccggcggcggcagcagctcgaagttctg 321
           ||||||||| ||||| ||||||||||||||
Sbjct: 53  ccccggcggaggcagaagctcgaagttctg 24
to top
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 333    cgagcgtgatgccgatgatgggcag 357
              |||||||| ||||||||||||||||
Sbjct: 674771 cgagcgtgttgccgatgatgggcag 674747
to top
>dbj|BA000011.4| Thermoplasma volcanium GSS1 DNA, complete genome
          Length = 1584804

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 24     attgccaactatttggaaatttaca 48
              |||||||||||| ||||||||||||
Sbjct: 588797 attgccaactatatggaaatttaca 588773
to top
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 296    ggcggcggcagcagctcgaag 316
              |||||||||||||||||||||
Sbjct: 694404 ggcggcggcagcagctcgaag 694384



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 294     ccggcggcggcagcagctcg 313
               ||||||||||||||||||||
Sbjct: 5809939 ccggcggcggcagcagctcg 5809958
to top
>ref|NM_198321.2| Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide
           N-acetylgalactosaminyltransferase 10 (GalNAc-T10)
           (GALNT10), transcript variant 1, mRNA
          Length = 5222

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 293 cccggcggcggcagcagctc 312
           ||||||||||||||||||||
Sbjct: 59  cccggcggcggcagcagctc 40
to top
>gb|AY528720.1| Danio rerio activation-induced cytidine deaminase (aicda) mRNA,
           complete cds
          Length = 889

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 177 catgaccgagatctgaactc 196
           ||||||||||||||||||||
Sbjct: 500 catgaccgagatctgaactc 481
to top
>gb|BC050333.1| Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide
           N-acetylgalactosaminyltransferase 10 (GalNAc-T10), mRNA
           (cDNA clone IMAGE:4838534), with apparent retained
           intron
          Length = 4359

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 293 cccggcggcggcagcagctc 312
           ||||||||||||||||||||
Sbjct: 59  cccggcggcggcagcagctc 40
to top
>ref|XM_976546.1| PREDICTED: Mus musculus membrane-associated ring finger (C3HC4) 9
           (March9), mRNA
          Length = 2563

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 290 tgccccggcggcggcagcag 309
           ||||||||||||||||||||
Sbjct: 798 tgccccggcggcggcagcag 817
to top
>ref|XM_816528.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053508461.290) partial mRNA
          Length = 1707

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 287 tcctgccccggcggcggcagcagc 310
           |||||||||||||||||| |||||
Sbjct: 864 tcctgccccggcggcggcggcagc 887
to top
>ref|XM_546283.2| PREDICTED: Canis familiaris similar to GalNAc transferase 10
           isoform a (LOC489165), mRNA
          Length = 2637

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 293 cccggcggcggcagcagctc 312
           ||||||||||||||||||||
Sbjct: 752 cccggcggcggcagcagctc 733
to top
>gb|AC079804.5| Homo sapiens BAC clone RP11-740N7 from 7, complete sequence
          Length = 184512

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    ccaacaccaaagaaaaatta 98
             ||||||||||||||||||||
Sbjct: 99068 ccaacaccaaagaaaaatta 99049
to top
>gb|AC010295.7| Homo sapiens chromosome 5 clone CTB-143H13, complete sequence
          Length = 108051

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cccggcggcggcagcagctc 312
            ||||||||||||||||||||
Sbjct: 7435 cccggcggcggcagcagctc 7454
to top
>ref|NM_001008403.1| Danio rerio activation-induced cytidine deaminase (aicda), mRNA
          Length = 889

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 177 catgaccgagatctgaactc 196
           ||||||||||||||||||||
Sbjct: 500 catgaccgagatctgaactc 481
to top
>ref|XM_775811.1| PREDICTED: Strongylocentrotus purpuratus similar to CG5262-PA
           (LOC575408), mRNA
          Length = 1284

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 335 agcgtgatgccgatgatggg 354
           ||||||||||||||||||||
Sbjct: 917 agcgtgatgccgatgatggg 898
to top
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 331    tccgagcgtgatgccgatga 350
              ||||||||||||||||||||
Sbjct: 407531 tccgagcgtgatgccgatga 407550
to top
>gb|AC148832.5| Pan troglodytes BAC clone CH251-48K6 from chromosome 7, complete
             sequence
          Length = 186606

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 79    ccaacaccaaagaaaaatta 98
             ||||||||||||||||||||
Sbjct: 46922 ccaacaccaaagaaaaatta 46941
to top
>dbj|AK127135.1| Homo sapiens cDNA FLJ45192 fis, clone BRAWH3049544, weakly  similar
           to Polypeptide N-acetylgalactosaminyltransferase (EC
           2.4.1.41)
          Length = 3938

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 293 cccggcggcggcagcagctc 312
           ||||||||||||||||||||
Sbjct: 20  cccggcggcggcagcagctc 1
to top
>dbj|AB234902.1| Verbena x hybrida mRNA for Cinnamic acid 4-hydroxylase, complete cds,
            cultivar: Tapien Pink
          Length = 1768

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 338  gtgatgccgatgatgggcagcgcgaggatgatcccggggcagct 381
            |||||||| | |||||||||||| || || || |||||||||||
Sbjct: 1434 gtgatgcccaggatgggcagcgcaagaataattccggggcagct 1391
to top
>gb|AF368379.1| Nicotiana tabacum elicitor-inducible cytochrome P450 (CYP73A28) mRNA,
            complete cds
          Length = 1693

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 353  ggcagcgcgaggatgatcccggggcagctccg 384
            ||||| || |||||||| ||||||||||||||
Sbjct: 1470 ggcagtgcaaggatgattccggggcagctccg 1439
to top
>gb|AF368378.1| Nicotiana tabacum elicitor-inducible cytochrome P450 (CYP73A27) mRNA,
            complete cds
          Length = 1745

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 353  ggcagcgcgaggatgatcccggggcagctccg 384
            ||||| || |||||||| ||||||||||||||
Sbjct: 1470 ggcagtgcaaggatgattccggggcagctccg 1439
to top
>dbj|AK158026.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched
           library, clone:F930017K03 product:LOC92979 protein
           (Fragment) homolog [Homo sapiens], full insert sequence
          Length = 2001

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 290 tgccccggcggcggcagcag 309
           ||||||||||||||||||||
Sbjct: 271 tgccccggcggcggcagcag 290
to top
>gb|AC148692.1| Macaca mulatta Major Histocompatibility Complex BAC MMU235E11, complete
             sequence
          Length = 159875

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 250   gctgaactgccctggcttct 269
             ||||||||||||||||||||
Sbjct: 47514 gctgaactgccctggcttct 47495
to top
>gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex BAC MMU009PO6, complete
              sequence
          Length = 191271

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 250    gctgaactgccctggcttct 269
              ||||||||||||||||||||
Sbjct: 177899 gctgaactgccctggcttct 177880
to top
>gb|AC148660.1| Macaca mulatta Major Histocompatibility Complex BAC MMU007F01,
            complete sequence
          Length = 176267

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 250  gctgaactgccctggcttct 269
            ||||||||||||||||||||
Sbjct: 2794 gctgaactgccctggcttct 2775
to top
>gb|DQ075002.1| Malus x domestica cinnamic acid hydroxylase (C4H1) mRNA, complete cds
          Length = 1946

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 274  ggtgtcgatcttgtcctgccccggcggcggcagcagctcgaagttctg 321
            |||||||| ||||  ||| || ||||| ||||| ||||||||||||||
Sbjct: 1737 ggtgtcgagcttggactgtcctggcggaggcagaagctcgaagttctg 1690
to top
>ref|NM_001033262.1| Mus musculus membrane-associated ring finger (C3HC4) 9 (March9),
           mRNA
          Length = 2001

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 290 tgccccggcggcggcagcag 309
           ||||||||||||||||||||
Sbjct: 271 tgccccggcggcggcagcag 290
to top
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 291  gccccggcggcggcagcagc 310
            ||||||||||||||||||||
Sbjct: 2637 gccccggcggcggcagcagc 2656
to top
>gb|AC131760.4| Mus musculus BAC clone RP24-220M2 from 10, complete sequence
          Length = 173472

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 290    tgccccggcggcggcagcag 309
              ||||||||||||||||||||
Sbjct: 102945 tgccccggcggcggcagcag 102964
to top
>gb|AC134329.3| Mus musculus BAC clone RP24-310D17 from 10, complete sequence
          Length = 159173

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 290   tgccccggcggcggcagcag 309
             ||||||||||||||||||||
Sbjct: 25079 tgccccggcggcggcagcag 25098
to top
>emb|CR848818.10| Zebrafish DNA sequence from clone DKEY-38O19 in linkage group 16,
           complete sequence
          Length = 208738

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 177 catgaccgagatctgaactc 196
           ||||||||||||||||||||
Sbjct: 273 catgaccgagatctgaactc 254
to top
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 336     gcgtgatgccgatgatgggc 355
               ||||||||||||||||||||
Sbjct: 2513672 gcgtgatgccgatgatgggc 2513653


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,743,122
Number of Sequences: 3902068
Number of extensions: 3743122
Number of successful extensions: 95485
Number of sequences better than 10.0: 67
Number of HSP's better than 10.0 without gapping: 68
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 94871
Number of HSP's gapped (non-prelim): 614
length of query: 388
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 366
effective length of database: 17,147,199,772
effective search space: 6275875116552
effective search space used: 6275875116552
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top