Clone Name | rbart56c09 |
---|---|
Clone Library Name | barley_pub |
>gb|BT009394.1| Triticum aestivum clone wlm96.pk037.m21:fis, full insert mRNA sequence Length = 953 Score = 188 bits (95), Expect = 9e-45 Identities = 110/115 (95%) Strand = Plus / Minus Query: 253 cgcccgtctaaacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaa 312 |||||| ||| |||| |||||||||||||||||| ||||||||||||||||||||||| | Sbjct: 816 cgcccgcctagacgatgcggcggcagatggtgactccgtcggcgatggcgagctggcaga 757 Query: 313 cctcgatgcgcgggtcggcggcgagcttggcgttgaggtccctgagggcggcgga 367 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 756 cctcgatgcgcgggtcggcggcgagcttggcgttgaggtccctgagggcggcgga 702 Score = 60.0 bits (30), Expect = 5e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 160 aataatacaattgattaagggaagcggctggtaaggaa 197 ||||||||||||||||||| ||||||||||||||||| Sbjct: 927 aataatacaattgattaagataagcggctggtaaggaa 890
>ref|XM_483167.1| Oryza sativa (japonica cultivar-group), mRNA Length = 996 Score = 143 bits (72), Expect = 5e-31 Identities = 96/104 (92%) Strand = Plus / Minus Query: 264 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgc 323 |||| ||||||||||||||||| |||||||||||||||||||||||| || ||||||||| Sbjct: 825 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 766 Query: 324 gggtcggcggcgagcttggcgttgaggtccctgagggcggcgga 367 ||||||||||||||| ||| |||||||||||||| |||| |||| Sbjct: 765 gggtcggcggcgagcctggagttgaggtccctgatggcgacgga 722
>ref|XM_507591.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA Length = 1096 Score = 143 bits (72), Expect = 5e-31 Identities = 96/104 (92%) Strand = Plus / Minus Query: 264 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgc 323 |||| ||||||||||||||||| |||||||||||||||||||||||| || ||||||||| Sbjct: 832 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 773 Query: 324 gggtcggcggcgagcttggcgttgaggtccctgagggcggcgga 367 ||||||||||||||| ||| |||||||||||||| |||| |||| Sbjct: 772 gggtcggcggcgagcctggagttgaggtccctgatggcgacgga 729
>ref|XM_507281.2| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.24 mRNA Length = 1098 Score = 143 bits (72), Expect = 5e-31 Identities = 96/104 (92%) Strand = Plus / Minus Query: 264 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgc 323 |||| ||||||||||||||||| |||||||||||||||||||||||| || ||||||||| Sbjct: 834 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 775 Query: 324 gggtcggcggcgagcttggcgttgaggtccctgagggcggcgga 367 ||||||||||||||| ||| |||||||||||||| |||| |||| Sbjct: 774 gggtcggcggcgagcctggagttgaggtccctgatggcgacgga 731
>gb|AY644637.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA O-methyltransferase (COA20) gene, complete cds Length = 1158 Score = 143 bits (72), Expect = 5e-31 Identities = 96/104 (92%) Strand = Plus / Minus Query: 264 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgc 323 |||| ||||||||||||||||| |||||||||||||||||||||||| || ||||||||| Sbjct: 1054 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 995 Query: 324 gggtcggcggcgagcttggcgttgaggtccctgagggcggcgga 367 ||||||||||||||| ||| |||||||||||||| |||| |||| Sbjct: 994 gggtcggcggcgagcctggagttgaggtccctgatggcgacgga 951
>dbj|AB110168.1| Oryza sativa (japonica cultivar-group) mRNA for caffeoyl-CoA 3-O-methyltransferase, complete cds, clone: 12FPR057 Length = 976 Score = 143 bits (72), Expect = 5e-31 Identities = 96/104 (92%) Strand = Plus / Minus Query: 264 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgc 323 |||| ||||||||||||||||| |||||||||||||||||||||||| || ||||||||| Sbjct: 802 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 743 Query: 324 gggtcggcggcgagcttggcgttgaggtccctgagggcggcgga 367 ||||||||||||||| ||| |||||||||||||| |||| |||| Sbjct: 742 gggtcggcggcgagcctggagttgaggtccctgatggcgacgga 699
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 143 bits (72), Expect = 5e-31 Identities = 96/104 (92%) Strand = Plus / Plus Query: 264 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgc 323 |||| ||||||||||||||||| |||||||||||||||||||||||| || ||||||||| Sbjct: 24579635 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 24579694 Query: 324 gggtcggcggcgagcttggcgttgaggtccctgagggcggcgga 367 ||||||||||||||| ||| |||||||||||||| |||| |||| Sbjct: 24579695 gggtcggcggcgagcctggagttgaggtccctgatggcgacgga 24579738 Score = 48.1 bits (24), Expect = 0.020 Identities = 66/80 (82%) Strand = Plus / Plus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 328 ||||||||| | |||||||||||||||| || |||| |||| |||||| ||| ||| Sbjct: 24590673 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 24590732 Query: 329 ggcggcgagcttggcgttga 348 |||||||| | ||||||||| Sbjct: 24590733 ggcggcgaccatggcgttga 24590752 Score = 46.1 bits (23), Expect = 0.080 Identities = 71/87 (81%) Strand = Plus / Plus Query: 262 aaacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgc 321 |||||| ||||||||||| ||||| |||||||| || | |||||| |||| | || Sbjct: 24586267 aaacgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgc 24586326 Query: 322 gcgggtcggcggcgagcttggcgttga 348 |||||||| |||||| ||||||||||| Sbjct: 24586327 gcgggtcgccggcgatcttggcgttga 24586353
>dbj|AP000364.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0026F07 Length = 137354 Score = 143 bits (72), Expect = 5e-31 Identities = 96/104 (92%) Strand = Plus / Plus Query: 264 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgc 323 |||| ||||||||||||||||| |||||||||||||||||||||||| || ||||||||| Sbjct: 87895 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 87954 Query: 324 gggtcggcggcgagcttggcgttgaggtccctgagggcggcgga 367 ||||||||||||||| ||| |||||||||||||| |||| |||| Sbjct: 87955 gggtcggcggcgagcctggagttgaggtccctgatggcgacgga 87998 Score = 48.1 bits (24), Expect = 0.020 Identities = 66/80 (82%) Strand = Plus / Plus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 328 ||||||||| | |||||||||||||||| || |||| |||| |||||| ||| ||| Sbjct: 98933 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 98992 Query: 329 ggcggcgagcttggcgttga 348 |||||||| | ||||||||| Sbjct: 98993 ggcggcgaccatggcgttga 99012 Score = 46.1 bits (23), Expect = 0.080 Identities = 71/87 (81%) Strand = Plus / Plus Query: 262 aaacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgc 321 |||||| ||||||||||| ||||| |||||||| || | |||||| |||| | || Sbjct: 94527 aaacgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgc 94586 Query: 322 gcgggtcggcggcgagcttggcgttga 348 |||||||| |||||| ||||||||||| Sbjct: 94587 gcgggtcgccggcgatcttggcgttga 94613
>dbj|AK104801.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C03, full insert sequence Length = 1096 Score = 143 bits (72), Expect = 5e-31 Identities = 96/104 (92%) Strand = Plus / Minus Query: 264 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgc 323 |||| ||||||||||||||||| |||||||||||||||||||||||| || ||||||||| Sbjct: 832 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 773 Query: 324 gggtcggcggcgagcttggcgttgaggtccctgagggcggcgga 367 ||||||||||||||| ||| |||||||||||||| |||| |||| Sbjct: 772 gggtcggcggcgagcctggagttgaggtccctgatggcgacgga 729
>dbj|AK104326.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-028-F10, full insert sequence Length = 996 Score = 143 bits (72), Expect = 5e-31 Identities = 96/104 (92%) Strand = Plus / Minus Query: 264 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgc 323 |||| ||||||||||||||||| |||||||||||||||||||||||| || ||||||||| Sbjct: 825 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 766 Query: 324 gggtcggcggcgagcttggcgttgaggtccctgagggcggcgga 367 ||||||||||||||| ||| |||||||||||||| |||| |||| Sbjct: 765 gggtcggcggcgagcctggagttgaggtccctgatggcgacgga 722
>dbj|AK071482.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023093N24, full insert sequence Length = 1098 Score = 143 bits (72), Expect = 5e-31 Identities = 96/104 (92%) Strand = Plus / Minus Query: 264 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgc 323 |||| ||||||||||||||||| |||||||||||||||||||||||| || ||||||||| Sbjct: 834 acgaggcggcggcagatggtgatgccgtcggcgatggcgagctggcagacgtcgatgcgc 775 Query: 324 gggtcggcggcgagcttggcgttgaggtccctgagggcggcgga 367 ||||||||||||||| ||| |||||||||||||| |||| |||| Sbjct: 774 gggtcggcggcgagcctggagttgaggtccctgatggcgacgga 731
>gb|AY108449.1| Zea mays PCO131734 mRNA sequence Length = 1072 Score = 101 bits (51), Expect = 2e-18 Identities = 54/55 (98%) Strand = Plus / Minus Query: 264 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcga 318 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 820 acgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcagacctcga 766
>gb|BT009389.1| Triticum aestivum clone wlm96.pk036.e8:fis, full insert mRNA sequence Length = 1078 Score = 67.9 bits (34), Expect = 2e-08 Identities = 61/70 (87%) Strand = Plus / Minus Query: 268 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggt 327 |||||||||||| ||||| ||||||| ||| || ||||||||| | ||||| |||| ||| Sbjct: 874 cgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcgctggt 815 Query: 328 cggcggcgag 337 |||||||||| Sbjct: 814 cggcggcgag 805
>emb|AJ242980.1|ZMA242980 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene), 1136 BP Length = 1136 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 859 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 800 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 799 gtcggcggcgagc 787
>gb|BT009186.1| Triticum aestivum clone wl1n.pk0141.a9:fis, full insert mRNA sequence Length = 1118 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 860 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 801 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 800 gtcggcggcgagc 788
>gb|AY104406.1| Zea mays PCO108855 mRNA sequence Length = 1146 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 865 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 806 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 805 gtcggcggcgagc 793
>gb|AY098515.1| Ananas comosus caffeoyl CoA O-methyltransferase mRNA, partial cds Length = 607 Score = 65.9 bits (33), Expect = 9e-08 Identities = 60/69 (86%) Strand = Plus / Minus Query: 270 cggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtcg 329 |||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| |||||| Sbjct: 361 cggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcgggggtcg 302 Query: 330 gcggcgagc 338 |||||||| Sbjct: 301 acggcgagc 293
>gb|AY323271.1| Zea mays genotype Quebec28 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1320 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1294 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1235 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1234 gtcggcggcgagc 1222
>gb|AY323270.1| Zea mays genotype Sibiriacka caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1306 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1220 gtcggcggcgagc 1208
>gb|AY323269.1| Zea mays genotype PolarDent caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1308 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1282 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1223 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1222 gtcggcggcgagc 1210
>gb|AY323268.1| Zea mays genotype RainbowFlint caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1314 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1288 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1229 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1228 gtcggcggcgagc 1216
>gb|AY323267.1| Zea mays genotype NoordlanderVC145 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1311 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1225 gtcggcggcgagc 1213
>gb|AY323266.1| Zea mays genotype RottalerSilomais caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1309 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1224 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1223 gtcggcggcgagc 1211
>gb|AY323265.1| Zea mays genotype Du101 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323264.1| Zea mays genotype W64A caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1311 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1225 gtcggcggcgagc 1213
>gb|AY323263.1| Zea mays genotype line16 (private BIOGEMMA line) caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323262.1| Zea mays genotype line212 (private BIOGEMMA line) caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1306 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1220 gtcggcggcgagc 1208
>gb|AY323261.1| Zea mays genotype F66 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323260.1| Zea mays genotype F113 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323259.1| Zea mays genotype EP1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323258.1| Zea mays genotype B14 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323257.1| Zea mays genotype wis93-3520 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1311 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1225 gtcggcggcgagc 1213
>gb|AY323256.1| Zea mays genotype F7 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1309 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1224 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1223 gtcggcggcgagc 1211
>gb|AY323255.1| Zea mays genotype Wis94-443 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323254.1| Zea mays genotype F1 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1298 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323253.1| Zea mays genotype Mo17 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1314 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1288 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1229 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1228 gtcggcggcgagc 1216
>gb|AY323252.1| Zea mays genotype DE811 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1311 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1225 gtcggcggcgagc 1213
>gb|AY323251.1| Zea mays genotype B73 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1537 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323250.1| Zea mays genotype F324 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323249.1| Zea mays genotype Lan496 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1549 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1285 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1226 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1225 gtcggcggcgagc 1213
>gb|AY323248.1| Zea mays genotype MBS847 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323247.1| Zea mays genotype F4 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323246.1| Zea mays genotype F2 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1544 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1220 gtcggcggcgagc 1208
>gb|AY323245.1| Zea mays genotype W117 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323244.1| Zea mays genotype F7012 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1546 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1282 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1223 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1222 gtcggcggcgagc 1210
>gb|AY323243.1| Zea mays genotype F7025 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323242.1| Zea mays genotype F288 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1537 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1273 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1214 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1213 gtcggcggcgagc 1201
>gb|AY323241.1| Zea mays genotype F271 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1536 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1272 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1213 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1212 gtcggcggcgagc 1200
>gb|AY323240.1| Zea mays genotype F64 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1306 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1220 gtcggcggcgagc 1208
>gb|AY323239.1| Zea mays genotype F286 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1309 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1283 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1224 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1223 gtcggcggcgagc 1211
>gb|AY323238.1| Zea mays genotype F564 caffeoyl-CoA 3-O-methyltransferase 1 (ccoaomt1) gene, complete cds Length = 1306 Score = 65.9 bits (33), Expect = 9e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1280 gacgcggcggcagagggtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1221 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1220 gtcggcggcgagc 1208
>gb|AY644636.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA O-methyltransferase (COA1) gene, complete cds Length = 1272 Score = 63.9 bits (32), Expect = 3e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||| ||||||| ||| || ||||||||| | ||||| ||| | Sbjct: 1166 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 1107 Query: 326 gtcggcggcgag 337 |||||||||||| Sbjct: 1106 gtcggcggcgag 1095
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 63.9 bits (32), Expect = 3e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 310 ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 18420524 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 18420567
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 63.9 bits (32), Expect = 3e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||| ||||||| ||| || ||||||||| | ||||| ||| | Sbjct: 3314239 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 3314180 Query: 326 gtcggcggcgag 337 |||||||||||| Sbjct: 3314179 gtcggcggcgag 3314168
>dbj|AP005633.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0463G11 Length = 154188 Score = 63.9 bits (32), Expect = 3e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 310 ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 135260 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 135303
>dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0463D04 Length = 145828 Score = 63.9 bits (32), Expect = 3e-07 Identities = 41/44 (93%) Strand = Plus / Plus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 310 ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 82398 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 82441
>dbj|AP002536.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0015I14 Length = 150650 Score = 63.9 bits (32), Expect = 3e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||| ||||||| ||| || ||||||||| | ||||| ||| | Sbjct: 101602 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 101543 Query: 326 gtcggcggcgag 337 |||||||||||| Sbjct: 101542 gtcggcggcgag 101531
>dbj|AB023482.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone P0680A03 Length = 156054 Score = 63.9 bits (32), Expect = 3e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||| ||||||| ||| || ||||||||| | ||||| ||| | Sbjct: 5793 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 5734 Query: 326 gtcggcggcgag 337 |||||||||||| Sbjct: 5733 gtcggcggcgag 5722
>dbj|AK108479.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-143-F02, full insert sequence Length = 959 Score = 63.9 bits (32), Expect = 3e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 267 acgcggcggcagatggtgacgccgtcggcgatggcgagctggca 310 ||||||||||||| |||||||||||||||||||||||||||| Sbjct: 817 acgcggcggcagagcatgacgccgtcggcgatggcgagctggca 774
>dbj|AK065744.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013039L12, full insert sequence Length = 1052 Score = 63.9 bits (32), Expect = 3e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| ||||| ||||||| ||| || ||||||||| | ||||| ||| | Sbjct: 847 gacgcggcggcagagggtgatgccgtcgccgacggggagctggcagatctcgacgcggtg 788 Query: 326 gtcggcggcgag 337 |||||||||||| Sbjct: 787 gtcggcggcgag 776
>emb|AJ242981.1|ZMA242981 Zea mays mRNA for Caffeoyl CoA O-methyltransferase (ccoAOMT gene), 1167 BP Length = 1167 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 859 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 800 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 799 gtcggcggcgagc 787
>gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1084 gtcggcggcgagc 1072
>gb|AY279034.1| Zea mays Mo17 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1136 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1070 gtcggcggcgagc 1058
>gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1084 gtcggcggcgagc 1072
>gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1152 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1146 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1087 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1086 gtcggcggcgagc 1074
>gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1145 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1139 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1080 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1079 gtcggcggcgagc 1067
>gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1084 gtcggcggcgagc 1072
>gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1222 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1097 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1096 gtcggcggcgagc 1084
>gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1209 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1097 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1096 gtcggcggcgagc 1084
>gb|AY279027.1| Zea mays F113 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1172 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1106 gtcggcggcgagc 1094
>gb|AY279026.1| Zea mays De811 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1181 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1070 gtcggcggcgagc 1058
>gb|AY279025.1| Zea mays Du101 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1172 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1106 gtcggcggcgagc 1094
>gb|AY279024.1| Zea mays B14 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1181 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1070 gtcggcggcgagc 1058
>gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1152 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1146 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1087 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1086 gtcggcggcgagc 1074
>gb|AY279022.1| Zea mays B73 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1445 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1106 gtcggcggcgagc 1094
>gb|AY279021.1| Zea mays Lan496 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1438 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1162 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1103 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1102 gtcggcggcgagc 1090
>gb|AY279020.1| Zea mays F288 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1451 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1169 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1110 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1109 gtcggcggcgagc 1097
>gb|AY279019.1| Zea mays W117 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1442 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1106 gtcggcggcgagc 1094
>gb|AY279018.1| Zea mays MBS847 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1445 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1106 gtcggcggcgagc 1094
>gb|AY279017.1| Zea mays F7012 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1444 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1106 gtcggcggcgagc 1094
>gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1463 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1182 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1123 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1122 gtcggcggcgagc 1110
>gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1464 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1182 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1123 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1122 gtcggcggcgagc 1110
>gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1434 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1152 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1093 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1092 gtcggcggcgagc 1080
>gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1084 gtcggcggcgagc 1072
>gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1144 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1085 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1084 gtcggcggcgagc 1072
>gb|AY279011.1| Zea mays F64 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1136 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1070 gtcggcggcgagc 1058
>gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1153 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1147 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1088 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1087 gtcggcggcgagc 1075
>gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1182 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1176 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1117 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1116 gtcggcggcgagc 1104
>gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1206 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1156 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1097 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1096 gtcggcggcgagc 1084
>gb|AY279007.1| Zea mays RainbowFlint caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1172 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1106 gtcggcggcgagc 1094
>gb|AY279006.1| Zea mays NoordlanderVC145 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1172 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1166 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1107 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1106 gtcggcggcgagc 1094
>gb|AY279005.1| Zea mays isolate 1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1181 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1130 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1071 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1070 gtcggcggcgagc 1058
>gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1451 Score = 58.0 bits (29), Expect = 2e-05 Identities = 62/73 (84%) Strand = Plus / Minus Query: 266 gacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgg 325 |||||||||||||| |||||||||||| ||| || ||||||||| | ||||| ||| Sbjct: 1173 gacgcggcggcagagcgtgacgccgtcgccgacggggagctggcagatctcgacgcggtc 1114 Query: 326 gtcggcggcgagc 338 ||||||||||||| Sbjct: 1113 gtcggcggcgagc 1101
>gb|AY644638.1| Oryza sativa (japonica cultivar-group) caffeoyl-CoA O-methyltransferase (COA26) gene, complete cds Length = 1116 Score = 48.1 bits (24), Expect = 0.020 Identities = 66/80 (82%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 328 ||||||||| | |||||||||||||||| || |||| |||| |||||| ||| ||| Sbjct: 1007 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 948 Query: 329 ggcggcgagcttggcgttga 348 |||||||| | ||||||||| Sbjct: 947 ggcggcgaccatggcgttga 928
>dbj|AK106735.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-A04, full insert sequence Length = 1895 Score = 48.1 bits (24), Expect = 0.020 Identities = 66/80 (82%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggtc 328 ||||||||| | |||||||||||||||| || |||| |||| |||||| ||| ||| Sbjct: 1671 gcggcggcacagcgtgacgccgtcggcgacggggagcaggcatgcctcgacgcggtcgtc 1612 Query: 329 ggcggcgagcttggcgttga 348 |||||||| | ||||||||| Sbjct: 1611 ggcggcgaccatggcgttga 1592
>ref|XM_507282.1| PREDICTED Oryza sativa (japonica cultivar-group), P0026F07.26-2 mRNA Length = 1149 Score = 46.1 bits (23), Expect = 0.080 Identities = 71/87 (81%) Strand = Plus / Minus Query: 262 aaacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgc 321 |||||| ||||||||||| ||||| |||||||| || | |||||| |||| | || Sbjct: 945 aaacgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgc 886 Query: 322 gcgggtcggcggcgagcttggcgttga 348 |||||||| |||||| ||||||||||| Sbjct: 885 gcgggtcgccggcgatcttggcgttga 859
>ref|XM_483170.1| Oryza sativa (japonica cultivar-group), mRNA Length = 612 Score = 46.1 bits (23), Expect = 0.080 Identities = 71/87 (81%) Strand = Plus / Minus Query: 262 aaacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgc 321 |||||| ||||||||||| ||||| |||||||| || | |||||| |||| | || Sbjct: 610 aaacgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgc 551 Query: 322 gcgggtcggcggcgagcttggcgttga 348 |||||||| |||||| ||||||||||| Sbjct: 550 gcgggtcgccggcgatcttggcgttga 524
>ref|XM_483169.1| Oryza sativa (japonica cultivar-group), mRNA Length = 879 Score = 46.1 bits (23), Expect = 0.080 Identities = 71/87 (81%) Strand = Plus / Minus Query: 262 aaacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgc 321 |||||| ||||||||||| ||||| |||||||| || | |||||| |||| | || Sbjct: 877 aaacgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgc 818 Query: 322 gcgggtcggcggcgagcttggcgttga 348 |||||||| |||||| ||||||||||| Sbjct: 817 gcgggtcgccggcgatcttggcgttga 791
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 312 acctcgatgcgcgggtcggcggc 334 ||||||||||||||||||||||| Sbjct: 4035539 acctcgatgcgcgggtcggcggc 4035517
>dbj|AK065515.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013030H15, full insert sequence Length = 1466 Score = 46.1 bits (23), Expect = 0.080 Identities = 71/87 (81%) Strand = Plus / Minus Query: 262 aaacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgc 321 |||||| ||||||||||| ||||| |||||||| || | |||||| |||| | || Sbjct: 1098 aaacgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgc 1039 Query: 322 gcgggtcggcggcgagcttggcgttga 348 |||||||| |||||| ||||||||||| Sbjct: 1038 gcgggtcgccggcgatcttggcgttga 1012
>dbj|AK061757.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-A06, full insert sequence Length = 1149 Score = 46.1 bits (23), Expect = 0.080 Identities = 71/87 (81%) Strand = Plus / Minus Query: 262 aaacgacgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgc 321 |||||| ||||||||||| ||||| |||||||| || | |||||| |||| | || Sbjct: 945 aaacgaggcggcggcagagggtgatgccgtcggagaccgggagctgcacggcctccacgc 886 Query: 322 gcgggtcggcggcgagcttggcgttga 348 |||||||| |||||| ||||||||||| Sbjct: 885 gcgggtcgccggcgatcttggcgttga 859
>gb|AC118289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0099O15, complete sequence Length = 137357 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 67 ccctctcctctcatcaaatttc 88 |||||||||||||||||||||| Sbjct: 118827 ccctctcctctcatcaaatttc 118848
>gb|AC093952.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1004_E02, complete sequence Length = 127642 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 67 ccctctcctctcatcaaatttc 88 |||||||||||||||||||||| Sbjct: 9747 ccctctcctctcatcaaatttc 9768
>gb|BT009093.1| Triticum aestivum clone wkm2c.pk005.b15:fis, full insert mRNA sequence Length = 1018 Score = 44.1 bits (22), Expect = 0.32 Identities = 40/46 (86%) Strand = Plus / Minus Query: 262 aaacgacgcggcggcagatggtgacgccgtcggcgatggcgagctg 307 |||||||||||||||||| |||| ||| |||||||| | |||||| Sbjct: 798 aaacgacgcggcggcagagcgtgatgccatcggcgatagggagctg 753
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 327 tcggcggcgagcttggcgttga 348 |||||||||||||||||||||| Sbjct: 4580941 tcggcggcgagcttggcgttga 4580920
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 67 ccctctcctctcatcaaatttc 88 |||||||||||||||||||||| Sbjct: 23728874 ccctctcctctcatcaaatttc 23728895
>dbj|AB076979.1| Avena sativa AsCCOAOMT mRNA for caffeoyl-CoA 3-O-methyltransferase, partial cds Length = 622 Score = 44.1 bits (22), Expect = 0.32 Identities = 58/70 (82%) Strand = Plus / Minus Query: 268 cgcggcggcagatggtgacgccgtcggcgatggcgagctggcaaacctcgatgcgcgggt 327 |||||||||||| |||| ||||||| ||| || ||||||||| | ||||| ||| || Sbjct: 387 cgcggcggcagagtgtgatgccgtcgccgacggggagctggcagatctcgacgcggtcgt 328 Query: 328 cggcggcgag 337 |||||||||| Sbjct: 327 cggcggcgag 318
>dbj|AB158406.1| Triticum aestivum CCoAMT mRNA for putative caffeoyl CoA O-methyltransferase, partial cds Length = 875 Score = 44.1 bits (22), Expect = 0.32 Identities = 40/46 (86%) Strand = Plus / Minus Query: 262 aaacgacgcggcggcagatggtgacgccgtcggcgatggcgagctg 307 |||||||||||||||||| |||| ||| |||||||| | |||||| Sbjct: 790 aaacgacgcggcggcagagcgtgatgccatcggcgatagggagctg 745
>dbj|AK062452.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-103-C05, full insert sequence Length = 551 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 67 ccctctcctctcatcaaatttc 88 |||||||||||||||||||||| Sbjct: 216 ccctctcctctcatcaaatttc 195
>gb|AY104670.1| Zea mays PCO117754 mRNA sequence Length = 976 Score = 44.1 bits (22), Expect = 0.32 Identities = 40/46 (86%) Strand = Plus / Minus Query: 265 cgacgcggcggcagatggtgacgccgtcggcgatggcgagctggca 310 ||||||||||||| | |||| |||||||||||||||| |||||| Sbjct: 778 cgacgcggcggcacagcgtgagcccgtcggcgatggcgacctggca 733
>gb|AY697852.1| Perognathus flavescens apache voucher UIMNH 60543 cytochrome b gene, partial cds; mitochondrial Length = 800 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 152 cagggaaaaataatacaattg 172 ||||||||||||||||||||| Sbjct: 742 cagggaaaaataatacaattg 722
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence Length = 2726152 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 330 gcggcgagcttggcgttgagg 350 ||||||||||||||||||||| Sbjct: 363316 gcggcgagcttggcgttgagg 363296
>emb|AL138917.11| Human DNA sequence from clone RP3-354M18 on chromosome 6 Contains the 5' end of the APG5L gene for APG5 autophagy 5-like (S. cerevisiae) and a CpG island, complete sequence Length = 34768 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 aaaaaagtattattgaaaact 115 ||||||||||||||||||||| Sbjct: 11155 aaaaaagtattattgaaaact 11175
>gb|AC147479.17| Mus musculus chromosome 17, clone RP24-178C19, complete sequence Length = 178820 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 59 ccactcctccctctcctctc 78 |||||||||||||||||||| Sbjct: 73124 ccactcctccctctcctctc 73105
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 317 gatgcgcgggtcggcggcga 336 |||||||||||||||||||| Sbjct: 369896 gatgcgcgggtcggcggcga 369877
>gb|AC151292.2| Mus musculus BAC clone RP23-138P14 from chromosome 17, complete sequence Length = 216585 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 59 ccactcctccctctcctctc 78 |||||||||||||||||||| Sbjct: 160872 ccactcctccctctcctctc 160891
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence Length = 3694126 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 315 tcgatgcgcgggtcggcggcgagc 338 ||||||||||| |||||||||||| Sbjct: 1810413 tcgatgcgcggctcggcggcgagc 1810390
>gb|AC116472.14| Mus musculus chromosome 7, clone RP23-384B23, complete sequence Length = 216191 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 155 ggaaaaataatacaattgattaag 178 ||||||||||| |||||||||||| Sbjct: 154435 ggaaaaataatgcaattgattaag 154412
>gb|AF534906.1| Human adenovirus type 1 subgroup C, complete genome Length = 36001 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 266 gacgcggcggcagatggtga 285 |||||||||||||||||||| Sbjct: 11182 gacgcggcggcagatggtga 11201
>gb|AY657045.1| Synthetic construct Peudomonas aeruginosa clone FLH031886.01F PA5269 gene, partial cds Length = 276 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 325 ggtcggcggcgagcttggcgttga 348 |||||||||||||| ||||||||| Sbjct: 208 ggtcggcggcgagcatggcgttga 185
>gb|AC005550.1| Homo sapiens PAC clone RP4-620P6 from 7, complete sequence Length = 133237 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 153 agggaaaaataatacaattgatta 176 ||||||||||||||||||| |||| Sbjct: 111187 agggaaaaataatacaatttatta 111164
>emb|AL591792.1|SME591792 Sinorhizobium meliloti 1021 complete chromosome; segment 11/12 Length = 333800 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 314 ctcgatgcgcgggtcggcggcgag 337 ||||||||||| |||||||||||| Sbjct: 116899 ctcgatgcgcgtgtcggcggcgag 116922
>emb|AL606500.8| Human DNA sequence from clone RP11-274N19 on chromosome 1 Contains the 3' end of the KCNN3 gene for potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3, a novel gene and the 5' end of the ADAR gene for adenosine deaminase, RNA-specific, complete sequence Length = 173014 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 actcctccctctcctctcatcaaa 84 |||||||||||||| ||||||||| Sbjct: 107848 actcctccctctcccctcatcaaa 107871
>emb|AL603964.2| Human DNA sequence from clone RP13-13L9 on chromosome 6, complete sequence Length = 26986 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 59 ccactcctccctctcctctcatca 82 |||||| ||||||||||||||||| Sbjct: 3590 ccactcttccctctcctctcatca 3613
>emb|AL513342.7| Human DNA sequence from clone RP11-96F14 on chromosome 1 Contains part of the FMN2 gene for formin 2, complete sequence Length = 127208 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 61 actcctccctctcctctcat 80 |||||||||||||||||||| Sbjct: 48178 actcctccctctcctctcat 48159
>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the 5' end of the RORB gene for RAR-related orphan receptor B protein (RZRB, ROR-BETA), two novel genes and two CpG islands, complete sequence Length = 174874 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 tttaagagtacagtacataa 52 |||||||||||||||||||| Sbjct: 106430 tttaagagtacagtacataa 106411
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 269 gcggcggcagatggtgacgccgtc 292 ||||||||||||||||| |||||| Sbjct: 427746 gcggcggcagatggtgaggccgtc 427723
>emb|Y00624.1|ACMHC Acanthamoeba castellanii nonmuscle myosin heavy chain gene Length = 5894 Score = 40.1 bits (20), Expect = 4.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 334 cgagcttggcgttgaggtccctgagggcggcg 365 |||||||||||||| |||| ||||||||||| Sbjct: 3847 cgagcttggcgttggcgtccttgagggcggcg 3816
>emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete genome; segment 11/29 Length = 313800 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 315 tcgatgcgcgggtcggcggcgagc 338 |||| ||||||||||||||||||| Sbjct: 2353 tcgaagcgcgggtcggcggcgagc 2330
>emb|AJ417789.1|PSP417789 Polytomella sp. 'Pringsheim 198.80' mRNA for aldehyde dehydrogenase (aldh gene) Length = 2164 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 327 tcggcggcgagcttggcgttgagg 350 |||||||||||||||||| ||||| Sbjct: 767 tcggcggcgagcttggcgatgagg 744
>gb|AC116105.12| Mus musculus chromosome 1, clone RP23-23A4, complete sequence Length = 214780 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 60 cactcctccctctcctctca 79 |||||||||||||||||||| Sbjct: 84202 cactcctccctctcctctca 84221
>gb|AC092118.3| Homo sapiens chromosome 16 clone CTD-2600O9, complete sequence Length = 148794 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 32 gtttaagagtacagtacata 51 |||||||||||||||||||| Sbjct: 114656 gtttaagagtacagtacata 114637
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 315 tcgatgcgcgggtcggcggcgagc 338 |||| ||||||||||||||||||| Sbjct: 6387054 tcgaagcgcgggtcggcggcgagc 6387077
>gb|AE004939.1| Pseudomonas aeruginosa PAO1, section 500 of 529 of the complete genome Length = 10294 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 325 ggtcggcggcgagcttggcgttga 348 |||||||||||||| ||||||||| Sbjct: 8946 ggtcggcggcgagcatggcgttga 8923
>gb|AY007523.1| Pseudomonas fluorescens AlgH (algH), hypothetical protein, regulatory protein PyrR (pyrR), aspartate carbamoyl transferase PyrB (pyrB), and dihydro-orotase PyrC (pyrC) genes, complete cds; and unknown gene Length = 4080 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 284 gacgccgtcggcgatggcga 303 |||||||||||||||||||| Sbjct: 444 gacgccgtcggcgatggcga 425
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 325 ggtcggcggcgagcttggcg 344 |||||||||||||||||||| Sbjct: 1444782 ggtcggcggcgagcttggcg 1444763
>gb|J01917.1|ADRCG Adenovirus type 2, complete genome Length = 35937 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 266 gacgcggcggcagatggtga 285 |||||||||||||||||||| Sbjct: 11163 gacgcggcggcagatggtga 11182
>gb|U47294.2|CVU47294 Cloning vector pAdVantage, complete sequence Length = 4392 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 266 gacgcggcggcagatggtga 285 |||||||||||||||||||| Sbjct: 1333 gacgcggcggcagatggtga 1352
>dbj|AB070936.1| Streptomyces avermitilis siderophore biosynthetic gene cluster Length = 10056 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 315 tcgatgcgcgggtcggcggcgagc 338 |||| ||||||||||||||||||| Sbjct: 5465 tcgaagcgcgggtcggcggcgagc 5488 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,196,435 Number of Sequences: 3902068 Number of extensions: 3196435 Number of successful extensions: 76468 Number of sequences better than 10.0: 139 Number of HSP's better than 10.0 without gapping: 139 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 75610 Number of HSP's gapped (non-prelim): 858 length of query: 371 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 349 effective length of database: 17,147,199,772 effective search space: 5984372720428 effective search space used: 5984372720428 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)