ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart55g02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 90 8e-15
2dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic D... 90 8e-15
3dbj|AK108733.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 8e-15
4gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, part... 74 5e-10
5gb|AY110841.1| Zea mays CL908_1 mRNA sequence 62 2e-06
6gb|M95060.1|MZEORFA Zea mays putative thiol protease homolog mRN... 62 2e-06
7emb|Z97023.1|HVZ97023 Hordeum vulgare mRNA encoding cysteine end... 58 3e-05
8emb|Z97021.1|HVZ97021 Hordeum vulgare gene encoding cysteine end... 58 3e-05
9gb|U94591.1|HVU94591 Hordeum vulgare cysteine proteinase precurs... 58 3e-05
10gb|AY700585.1| Zingiber officinale cysteine protease gp2a mRNA, ... 56 1e-04
11gb|BT017759.1| Zea mays clone EL01N0501D06.c mRNA sequence 56 1e-04
12emb|X82185.1|ZMCYSPRO Z.mays mRNA for cysteine proteinase 56 1e-04
13gb|AY110563.1| Zea mays CL897_1 mRNA sequence 56 1e-04
14gb|AY104312.1| Zea mays PCO074362 mRNA sequence 56 1e-04
15dbj|D45402.1|MZECP Corn mRNA for cysteine proteinase, clone CCP,... 56 1e-04
16gb|AY700587.1| Zingiber officinale cysteine protease gp3a mRNA, ... 54 4e-04
17ref|XM_425038.1| PREDICTED: Gallus gallus similar to cathepsin L... 52 0.002
18gb|AY251054.1| Anthurium andraeanum cysteine protease mRNA, comp... 52 0.002
19ref|XM_536212.2| PREDICTED: Canis familiaris similar to Cathepsi... 52 0.002
20emb|X62163.1|LMLCPA L.mexicana LCPa mRNA for cysteine proteinase 52 0.002
21emb|AJ420285.1|LIN420285 Leishmania infantum cpa gene for cystei... 52 0.002
22emb|AJ130942.1|LMA130942 Leishmania major (MRHO/IR/75/ER), amast... 52 0.002
23gb|AF309687.1|AF309687 Leishmania donovani cysteine protease gen... 52 0.002
24gb|AF538038.1| Leishmania mexicana amazonensis cysteine proteina... 52 0.002
25gb|AY141759.1| Leishmania mexicana amazonensis clone 2A1 cystein... 52 0.002
26gb|AY141758.1| Leishmania mexicana amazonensis clone 3A4 cystein... 52 0.002
27gb|AY028171.1| Leishmania donovani extra chromosome XC290, parti... 52 0.002
28gb|AF004593.2|AF004593 Leishmania donovani chagasi promastigote-... 52 0.002
29emb|BX932251.2| Gallus gallus finished cDNA, clone ChEST354a5 52 0.002
30emb|BX936191.1| Gallus gallus finished cDNA, clone ChEST143c11 52 0.002
31emb|BX933970.1| Gallus gallus finished cDNA, clone ChEST130n15 52 0.002
32dbj|AK099197.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
33dbj|AK072767.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
34gb|AY111799.1| Zea mays CL872_-2 mRNA sequence 52 0.002
35gb|AF019146.1|AF019146 Zea mays cysteine proteinase Mir2 (mir2) ... 52 0.002
36gb|U32430.1|TAU32430 Triticum aestivum thiol protease mRNA, comp... 52 0.002
37gb|L29168.1|LEICYSTPRO Leishmania pifanoi cysteine proteinase ge... 52 0.002
38gb|AY700588.1| Zingiber officinale cysteine protease gp3b mRNA, ... 50 0.007
39gb|AF462226.1| Narcissus pseudonarcissus putative cysteine prote... 50 0.007
40dbj|AB091669.1| Pandalus borealis PbCys mRNA for crustapain, com... 50 0.007
41gb|AY110047.1| Zea mays CL878_1 mRNA sequence 50 0.007
42gb|AC148242.14| Medicago truncatula clone mth2-18f6, complete se... 48 0.027
43tpe|BN000093.1|HVA000093 TPA: TPA_exp: Hordeum vulgare mRNA for ... 48 0.027
44gb|AF019145.2|AF019145 Zea mays cysteine protease Mir1 (mir1) mR... 48 0.027
45gb|AC172870.1| Brassica rapa subsp. pekinensis clone KBrH004A06,... 48 0.027
46gb|AY432200.1| Aedes aegypti ASAP ID: 43331 cathepsin F mRNA seq... 46 0.11
47gb|AY159378.1| Leptinotarsa decemlineata clone IntC4 digestive c... 46 0.11
48gb|AY251055.1| Anthurium andraeanum senescence-associated cystei... 46 0.11
49gb|AY504968.1| Iris hollandica putative cysteine protease 3 (CYS... 46 0.11
50gb|DQ459306.1| Aedes aegypti cathepsin L (CAT-L4) mRNA, partial cds 46 0.11
51emb|Z99953.1|PVZ99953 Phaseolus vulgaris Moldavian encoding cyst... 46 0.11
52gb|AY121614.1| Drosophila melanogaster GH01606 full insert cDNA 46 0.11
53ref|NM_169033.2| Drosophila melanogaster CG12163-RA, transcript ... 46 0.11
54ref|NM_141264.2| Drosophila melanogaster CG12163-RB, transcript ... 46 0.11
55dbj|AB183488.1| Oryzias latipes DNA, MHC class I region 46 0.11
56gb|AC007532.8| Drosophila melanogaster, chromosome 3R, region 82... 46 0.11
57gb|BT003231.1| Drosophila melanogaster LP08529 full insert cDNA 46 0.11
58gb|AE003603.4| Drosophila melanogaster chromosome 3R, section 5 ... 46 0.11
59gb|AY700586.1| Zingiber officinale cysteine protease gp2b mRNA, ... 44 0.42
60gb|AY850168.1| Cloning vector pQ-CPB recombinant cysteine protea... 44 0.42
61ref|NM_120069.3| Arabidopsis thaliana RD19 (RESPONSIVE TO DEHYDR... 44 0.42
62ref|NM_120068.3| Arabidopsis thaliana ATPase AT4G39080 mRNA, com... 44 0.42
63ref|XM_474131.1| Oryza sativa (japonica cultivar-group), predic... 44 0.42
64ref|XM_463580.1| Oryza sativa (japonica cultivar-group), predic... 44 0.42
65ref|XM_471773.1| Oryza sativa (japonica cultivar-group), predic... 44 0.42
66gb|AC145324.3| Oryza sativa (japonica cultivar-group) chromosome... 44 0.42
67gb|BC067615.1| Danio rerio zgc:85774, mRNA (cDNA clone MGC:85774... 44 0.42
68gb|AY253445.1| Triticum aestivum P9346A1-2-5-1 putative thiol pr... 44 0.42
69gb|DQ079995.1| Drosophila simulans male accessory gland protein ... 44 0.42
70gb|AY426971.1| Bombyx mori fibroinase precursor, mRNA, complete cds 44 0.42
71emb|Z97022.1|HVZ97022 Hordeum vulgare gene encoding cysteine pro... 44 0.42
72gb|AY133844.1| Arabidopsis thaliana clone U11713 putative cystei... 44 0.42
73emb|X80876.1|OSCYSPRO O.sativa mRNA for cysteine protease 44 0.42
74gb|AY080598.1| Arabidopsis thaliana putative cysteine proteinase... 44 0.42
75emb|AL663007.2|OSJN00206 Oryza sativa genomic DNA, chromosome 4,... 44 0.42
76emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosome 4, ... 44 0.42
77emb|AL035679.1|ATF19H22 Arabidopsis thaliana DNA chromosome 4, B... 44 0.42
78emb|AJ512653.1|LGU512653 Leishmania guyanensis partial cpb gene ... 44 0.42
79ref|NM_212688.1| Danio rerio zgc:85774 (zgc:85774), mRNA 44 0.42
80dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.42
81dbj|AK220782.1| Arabidopsis thaliana mRNA for drought-inducible ... 44 0.42
82gb|S77508.1| cysteine proteinase [Bombyx mori=silkmoths, pupae, ... 44 0.42
83dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.42
84dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.42
85dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.42
86emb|BX828077.1|CNS0A48A Arabidopsis thaliana Full-length cDNA Co... 44 0.42
87emb|BX826350.1|CNS0A43C Arabidopsis thaliana Full-length cDNA Co... 44 0.42
88gb|AY087621.1| Arabidopsis thaliana clone 37132 mRNA, complete s... 44 0.42
89dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.42
90dbj|D13042.1|ATHRD19A Arabidopsis thaliana rd19A gene for thiol ... 44 0.42
91dbj|AP006170.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.42
92dbj|AK121305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.42
93gb|AF099203.1|AF099203 Oryza sativa cysteine endopeptidase precu... 44 0.42
94dbj|AK098910.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.42
95dbj|AK071913.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.42
96dbj|AK071495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.42
97dbj|AK061729.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.42
98gb|AY109437.1| Zea mays CL903_-1 mRNA sequence 44 0.42
99gb|AY103676.1| Zea mays PCO102242 mRNA sequence 44 0.42
100emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 44 0.42
101gb|AF019147.1|AF019147 Zea mays cysteine proteinase Mir3 (mir3) ... 44 0.42
102dbj|AB004648.1| Oryza sativa (japonica cultivar-group) RepA gene... 44 0.42
103dbj|D90406.1|RICOZA Oryza sativa (japonica cultivar-group) mRNA ... 44 0.42
104dbj|AB020961.1| Zea mays mRNA for cysteine protease component of... 44 0.42
105gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.42
106emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4,... 44 0.42
107emb|CR450750.18| Zebrafish DNA sequence from clone CH211-234P18 ... 44 0.42
108dbj|AP006096.1| Lotus japonicus genomic DNA, chromosome 4, clone... 44 0.42
109dbj|D76415.1| Rice seedling mRNA for cysteine proteinase, comple... 44 0.42
110dbj|AB004819.1| Oryza sativa Rep1 gene for cysteine endopeptidas... 44 0.42
111gb|BT018299.1| Zea mays clone EL01T0206B09.c mRNA sequence 42 1.7
112gb|AY159375.1| Leptinotarsa decemlineata clone IntC1 digestive c... 42 1.7
113gb|AY528231.1| Leptinotarsa decemlineata clone IntC14 digestive ... 42 1.7
114dbj|AB081845.1| Engraulis japonicus aCatL mRNA for cathepsin L, ... 42 1.7
115ref|XM_510533.1| PREDICTED: Pan troglodytes similar to Cathepsin... 40 6.5
116ref|NM_189456.1| Oryza sativa (japonica cultivar-group), predic... 40 6.5
117ref|NM_148979.1| Homo sapiens cathepsin H (CTSH), transcript var... 40 6.5
118ref|NM_004390.2| Homo sapiens cathepsin H (CTSH), transcript var... 40 6.5
119gb|AC134472.4| Mus musculus BAC clone RP23-123E16 from chromosom... 40 6.5
120emb|Z19155.1|CEF54G8 Caenorhabditis elegans Cosmid F54G8, comple... 40 6.5
121gb|AC066608.6| Homo sapiens chromosome 3 clone RP11-785A7 map 3p... 40 6.5
122ref|XM_762953.1| Giardia lamblia ATCC 50803 hypothetical protein... 40 6.5
123ref|XM_762954.1| Giardia lamblia ATCC 50803 protease (GLP_449_32... 40 6.5
124ref|XM_766421.1| Giardia lamblia ATCC 50803 cathepsin L (GLP_163... 40 6.5
125gb|AC102626.9| Mus musculus chromosome 12, clone RP23-456E21, co... 40 6.5
126emb|AL589993.5| Human DNA sequence from clone RP11-57K17 on chro... 40 6.5
127emb|CR456881.1| Homo sapiens full open reading frame cDNA clone ... 40 6.5
128emb|AJ222774.1|HVJ222774 Hordeum vulgare mRNA for putative thiol... 40 6.5
129gb|BC002479.2| Homo sapiens cathepsin H, transcript variant 1, m... 40 6.5
130emb|X07549.1|HSCATH Human mRNA for cathepsin H (E.C.3.4.22.16.) 40 6.5
131gb|AC011944.12| Homo sapiens chromosome 15, clone RP11-16K12, co... 40 6.5
132emb|CR749582.1| Homo sapiens mRNA; cDNA DKFZp686B24257 (from clo... 40 6.5
133emb|CR613401.1| full-length cDNA clone CS0DC026YK23 of Neuroblas... 40 6.5
134emb|CR596280.1| full-length cDNA clone CS0DF022YJ05 of Fetal bra... 40 6.5
135gb|AF426248.1| Homo sapiens truncated cathepsin H mRNA, complete... 40 6.5
136gb|AF426247.1| Homo sapiens cathepsin H mRNA, complete cds 40 6.5
137gb|AC157098.5| Mus musculus 6 BAC RP24-398G2 (Roswell Park Cance... 40 6.5
138dbj|AK014748.1| Mus musculus 0 day neonate head cDNA, RIKEN full... 40 6.5
139gb|AC007303.7|AC007303 Drosophila melanogaster, chromosome 2R, r... 40 6.5
140gb|AC007471.4|AC007471 Drosophila melanogaster, chromosome 2R, r... 40 6.5
141gb|AC158650.7| Mus musculus 6 BAC RP23-280O4 (Roswell Park Cance... 40 6.5
142dbj|AP003277.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.5
143dbj|AB099890.1| Oryzias latipes ctsL mRNA for cathepsin L, compl... 40 6.5
144gb|AY891889.1| Synthetic construct Homo sapiens clone FLH116936.... 40 6.5
145gb|AY889402.1| Synthetic construct Homo sapiens clone FLH116940.... 40 6.5
146dbj|AK119182.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.5
147dbj|AK026152.1| Homo sapiens cDNA: FLJ22499 fis, clone HRC11250,... 40 6.5
148dbj|AK130158.1| Homo sapiens cDNA FLJ26648 fis, clone MPE04736, ... 40 6.5
149dbj|AK109160.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.5
150gb|AY893780.1| Synthetic construct Homo sapiens clone FLH054888.... 40 6.5
151dbj|AK106011.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.5
152dbj|AK105881.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.5
153dbj|AK059528.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.5
154gb|AE003835.4| Drosophila melanogaster chromosome 2R, section 15... 40 6.5
155emb|CT025710.9| Mouse DNA sequence from clone RP23-261P14 on chr... 40 6.5
156gb|BC018821.2| Homo sapiens cathepsin H, transcript variant 1, m... 40 6.5
157gb|AC018842.6| Homo sapiens chromosome 3 clone RP11-82O3 map 3p,... 40 6.5
158emb|X16832.1|HSCATHH Human mRNA for cathepsin H (EC 3.4.22.16) 40 6.5
159gb|L25066.1|SCMGTP2A Schistosoma mansoni glucose transporter pro... 40 6.5 
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 111/133 (83%)
 Strand = Plus / Plus

                                                                            
Query: 160      atcacatgagcgggaaagatggccggatggcaatgccgcagatcccctcgggcttgtcta 219
                |||||||||||||||| || ||||||||||| |||||||||| |||||| |||||| |  
Sbjct: 22050448 atcacatgagcgggaatgacggccggatggcgatgccgcagagcccctccggcttgccgg 22050507

                                                                            
Query: 220      tgatgcccttcttcattctgaggtatccgttgtcaccccacttctcaccccacgagttct 279
                 || | ||||||||||  ||| |||||| | ||| ||||| ||||  |||||||||||||
Sbjct: 22050508 cgacgtccttcttcatcttgatgtatccctggtcgccccagttcttcccccacgagttct 22050567

                             
Query: 280      tcacgatccagta 292
                | | |||||||||
Sbjct: 22050568 tgatgatccagta 22050580



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                            
Query: 318      ccgtacccgaccaccgtgactccatggttcagccgcgtcccgcatggaccattgtacaca 377
                ||||| ||||| || ||||| || ||||| |||||||||||||| || || | |||||| 
Sbjct: 22050627 ccgtagccgacgacggtgacgccgtggttgagccgcgtcccgcacggcccgtcgtacacg 22050686

                                                                        
Query: 378      ccattccggtagtgctggaagttggctccgccagcctcgatcgacaccgccacggg 433
                || |||| |||||||||||||||| | ||||| |||||||| ||||| ||||||||
Sbjct: 22050687 cccttcctgtagtgctggaagttgtcgccgccggcctcgatggacacggccacggg 22050742



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                          
Query: 267      ccccacgagttcttcacgatccagta 292
                ||||||||||||||||||||||||||
Sbjct: 18948275 ccccacgagttcttcacgatccagta 18948300



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 267      ccccacgagttcttcacgatccagta 292
                |||||||||||||| |||||||||||
Sbjct: 22136829 ccccacgagttcttaacgatccagta 22136854



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 267      ccccacgagttcttcacgatccagta 292
                |||||||||||||| |||||||||||
Sbjct: 22126325 ccccacgagttcttaacgatccagta 22126350
to top
>dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0635G10
          Length = 146728

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 111/133 (83%)
 Strand = Plus / Plus

                                                                         
Query: 160   atcacatgagcgggaaagatggccggatggcaatgccgcagatcccctcgggcttgtcta 219
             |||||||||||||||| || ||||||||||| |||||||||| |||||| |||||| |  
Sbjct: 92512 atcacatgagcgggaatgacggccggatggcgatgccgcagagcccctccggcttgccgg 92571

                                                                         
Query: 220   tgatgcccttcttcattctgaggtatccgttgtcaccccacttctcaccccacgagttct 279
              || | ||||||||||  ||| |||||| | ||| ||||| ||||  |||||||||||||
Sbjct: 92572 cgacgtccttcttcatcttgatgtatccctggtcgccccagttcttcccccacgagttct 92631

                          
Query: 280   tcacgatccagta 292
             | | |||||||||
Sbjct: 92632 tgatgatccagta 92644



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Plus

                                                                         
Query: 318   ccgtacccgaccaccgtgactccatggttcagccgcgtcccgcatggaccattgtacaca 377
             ||||| ||||| || ||||| || ||||| |||||||||||||| || || | |||||| 
Sbjct: 92691 ccgtagccgacgacggtgacgccgtggttgagccgcgtcccgcacggcccgtcgtacacg 92750

                                                                     
Query: 378   ccattccggtagtgctggaagttggctccgccagcctcgatcgacaccgccacggg 433
             || |||| |||||||||||||||| | ||||| |||||||| ||||| ||||||||
Sbjct: 92751 cccttcctgtagtgctggaagttgtcgccgccggcctcgatggacacggccacggg 92806
to top
>dbj|AK108733.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-150-D05, full
           insert sequence
          Length = 904

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 111/133 (83%)
 Strand = Plus / Minus

                                                                       
Query: 160 atcacatgagcgggaaagatggccggatggcaatgccgcagatcccctcgggcttgtcta 219
           |||||||||||||||| || ||||||||||| |||||||||| |||||| |||||| |  
Sbjct: 709 atcacatgagcgggaatgacggccggatggcgatgccgcagagcccctccggcttgccgg 650

                                                                       
Query: 220 tgatgcccttcttcattctgaggtatccgttgtcaccccacttctcaccccacgagttct 279
            || | ||||||||||  ||| |||||| | ||| ||||| ||||  |||||||||||||
Sbjct: 649 cgacgtccttcttcatcttgatgtatccctggtcgccccagttcttcccccacgagttct 590

                        
Query: 280 tcacgatccagta 292
           | | |||||||||
Sbjct: 589 tgatgatccagta 577



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Minus

                                                                       
Query: 318 ccgtacccgaccaccgtgactccatggttcagccgcgtcccgcatggaccattgtacaca 377
           ||||| ||||| || ||||| || ||||| |||||||||||||| || || | |||||| 
Sbjct: 530 ccgtagccgacgacggtgacgccgtggttgagccgcgtcccgcacggcccgtcgtacacg 471

                                                                   
Query: 378 ccattccggtagtgctggaagttggctccgccagcctcgatcgacaccgccacggg 433
           || |||| |||||||||||||||| | ||||| |||||||| ||||| ||||||||
Sbjct: 470 cccttcctgtagtgctggaagttgtcgccgccggcctcgatggacacggccacggg 415
to top
>gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence
          Length = 268433

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                          
Query: 267    ccccacgagttcttcacgatccagtaactctccccggtcacctcgtcctccccgtacccg 326
              |||||||||||||| |||||||||||  ||||||||||  || |||||||||||||||| 
Sbjct: 152882 ccccacgagttcttgacgatccagtacttctccccggtggccgcgtcctccccgtaccca 152823

                   
Query: 327    accac 331
              |||||
Sbjct: 152822 accac 152818
to top
>gb|AY110841.1| Zea mays CL908_1 mRNA sequence
          Length = 916

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 242 gtatccgttgtcaccccacttctcaccccacgagttcttcacgatccagta 292
           |||||| || || ||||||||||| |||||||||||||| |||||||||||
Sbjct: 644 gtatcccttctcgccccacttctcgccccacgagttcttgacgatccagta 594
to top
>gb|M95060.1|MZEORFA Zea mays putative thiol protease homolog mRNA, partial cds
          Length = 171

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 242 gtatccgttgtcaccccacttctcaccccacgagttcttcacgatccagta 292
           |||||| || || ||||||||||| |||||||||||||| |||||||||||
Sbjct: 119 gtatcccttctcgccccacttctcgccccacgagttcttgacgatccagta 69
to top
>emb|Z97023.1|HVZ97023 Hordeum vulgare mRNA encoding cysteine endopeptidase EP-A
          Length = 1299

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 252  tcaccccacttctcaccccacgagttcttcacgatccagta 292
            |||||||| | ||| ||||||||||||||||||||||||||
Sbjct: 1001 tcaccccagtcctctccccacgagttcttcacgatccagta 961
to top
>emb|Z97021.1|HVZ97021 Hordeum vulgare gene encoding cysteine endopeptidase EP-A
          Length = 2752

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 252  tcaccccacttctcaccccacgagttcttcacgatccagta 292
            |||||||| | ||| ||||||||||||||||||||||||||
Sbjct: 2378 tcaccccagtcctctccccacgagttcttcacgatccagta 2338
to top
>gb|U94591.1|HVU94591 Hordeum vulgare cysteine proteinase precursor, mRNA, complete cds
          Length = 1328

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 252  tcaccccacttctcaccccacgagttcttcacgatccagta 292
            |||||||| | ||| ||||||||||||||||||||||||||
Sbjct: 1009 tcaccccagtcctctccccacgagttcttcacgatccagta 969
to top
>gb|AY700585.1| Zingiber officinale cysteine protease gp2a mRNA, complete cds
          Length = 1359

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                
Query: 255  ccccacttctcaccccacgagttcttcacgatccag 290
            ||||| |||| |||||||||||||||||||||||||
Sbjct: 1013 ccccagttcttaccccacgagttcttcacgatccag 978
to top
>gb|BT017759.1| Zea mays clone EL01N0501D06.c mRNA sequence
          Length = 1131

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 242 gtatccgttgtcaccccacttctcaccccacgagttcttcacgatccagtaa 293
           ||||||||| || ||||| ||||| |||||||||||||| | ||||||||||
Sbjct: 737 gtatccgttctccccccagttctcgccccacgagttcttgatgatccagtaa 686
to top
>emb|X82185.1|ZMCYSPRO Z.mays mRNA for cysteine proteinase
          Length = 693

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 242 gtatccgttgtcaccccacttctcaccccacgagttcttcacgatccagtaa 293
           ||||||||| || ||||| ||||| |||||||||||||| | ||||||||||
Sbjct: 345 gtatccgttctccccccagttctcgccccacgagttcttgatgatccagtaa 294
to top
>gb|AY110563.1| Zea mays CL897_1 mRNA sequence
          Length = 794

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                       
Query: 354 gtcccgcatggaccattgtacacaccattccggtagtgctggaagttggctccgccagcc 413
           |||||||| || || |||||||| || |||  |||||||||||||||| | ||||| |||
Sbjct: 449 gtcccgcagggcccgttgtacactcccttcttgtagtgctggaagttgtcgccgccggcc 390

                               
Query: 414 tcgatcgacaccgccacggg 433
           ||||| ||||| | ||||||
Sbjct: 389 tcgatggacacggacacggg 370
to top
>gb|AY104312.1| Zea mays PCO074362 mRNA sequence
          Length = 2610

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 242  gtatccgttgtcaccccacttctcaccccacgagttcttcacgatccagtaa 293
            ||||||||| || ||||| ||||| |||||||||||||| | ||||||||||
Sbjct: 1107 gtatccgttctccccccagttctcgccccacgagttcttgatgatccagtaa 1056
to top
>dbj|D45402.1|MZECP Corn mRNA for cysteine proteinase, clone CCP, complete cds
          Length = 1311

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 242  gtatccgttgtcaccccacttctcaccccacgagttcttcacgatccagtaa 293
            ||||||||| || ||||| ||||| |||||||||||||| | ||||||||||
Sbjct: 1046 gtatccgttctccccccagttctcgccccacgagttcttgatgatccagtaa 995
to top
>gb|AY700587.1| Zingiber officinale cysteine protease gp3a mRNA, complete cds
          Length = 1597

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 254  accccacttctcaccccacgagttcttcacgatccagta 292
            |||||| ||||||||||| ||||||||||| ||||||||
Sbjct: 1019 accccagttctcaccccatgagttcttcacaatccagta 981
to top
>ref|XM_425038.1| PREDICTED: Gallus gallus similar to cathepsin L precursor
            (LOC427466), mRNA
          Length = 1451

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 243  tatccgttgtcaccccacttctcaccccacgagttcttcacgatccagta 292
            ||||| |||||||||||||||||||||||   |||||| || ||||||||
Sbjct: 1067 tatcctttgtcaccccacttctcaccccagctgttcttaacaatccagta 1018
to top
>gb|AY251054.1| Anthurium andraeanum cysteine protease mRNA, complete cds
          Length = 1814

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||||||||||||||||||||||||
Sbjct: 1104 ccccacgagttcttcacgatccagta 1079
to top
>ref|XM_536212.2| PREDICTED: Canis familiaris similar to Cathepsin H precursor
           (LOC479065), mRNA
          Length = 1206

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           ||||||||||||||||||||||||||
Sbjct: 818 ccccacgagttcttcacgatccagta 793
to top
>emb|X62163.1|LMLCPA L.mexicana LCPa mRNA for cysteine proteinase
          Length = 2355

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||||||||||||||||||||||||
Sbjct: 2162 ccccacgagttcttcacgatccagta 2137
to top
>emb|AJ420285.1|LIN420285 Leishmania infantum cpa gene for cysteine proteinase
          Length = 1665

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||||||||||||||||||||||||
Sbjct: 1025 ccccacgagttcttcacgatccagta 1000
to top
>emb|AJ130942.1|LMA130942 Leishmania major (MRHO/IR/75/ER), amastigote cpa gene encoding
           cysteine proteinase A
          Length = 697

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           ||||||||||||||||||||||||||
Sbjct: 561 ccccacgagttcttcacgatccagta 536
to top
>gb|AF309687.1|AF309687 Leishmania donovani cysteine protease gene, complete cds
          Length = 1062

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           ||||||||||||||||||||||||||
Sbjct: 932 ccccacgagttcttcacgatccagta 907
to top
>gb|AF538038.1| Leishmania mexicana amazonensis cysteine proteinase (cys1) gene,
           complete cds
          Length = 1065

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           ||||||||||||||||||||||||||
Sbjct: 935 ccccacgagttcttcacgatccagta 910
to top
>gb|AY141759.1| Leishmania mexicana amazonensis clone 2A1 cysteine proteinase mRNA,
           complete cds
          Length = 1568

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           ||||||||||||||||||||||||||
Sbjct: 983 ccccacgagttcttcacgatccagta 958
to top
>gb|AY141758.1| Leishmania mexicana amazonensis clone 3A4 cysteine proteinase mRNA,
            complete cds
          Length = 2431

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||||||||||||||||||||||||
Sbjct: 1101 ccccacgagttcttcacgatccagta 1076
to top
>gb|AY028171.1| Leishmania donovani extra chromosome XC290, partial sequence
          Length = 44273

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 267   ccccacgagttcttcacgatccagta 292
             ||||||||||||||||||||||||||
Sbjct: 27755 ccccacgagttcttcacgatccagta 27730
to top
>gb|AF004593.2|AF004593 Leishmania donovani chagasi promastigote-specific cysteine protease
            (ldccys2) gene, complete cds
          Length = 2684

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||||||||||||||||||||||||
Sbjct: 1290 ccccacgagttcttcacgatccagta 1265
to top
>emb|BX932251.2| Gallus gallus finished cDNA, clone ChEST354a5
          Length = 1108

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 243 tatccgttgtcaccccacttctcaccccacgagttcttcacgatccagta 292
           ||||| |||||||||||||||||||||||   |||||| || ||||||||
Sbjct: 995 tatcctttgtcaccccacttctcaccccagctgttcttaacaatccagta 946
to top
>emb|BX936191.1| Gallus gallus finished cDNA, clone ChEST143c11
          Length = 1370

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 243 tatccgttgtcaccccacttctcaccccacgagttcttcacgatccagta 292
           ||||| |||||||||||||||||||||||   |||||| || ||||||||
Sbjct: 983 tatcctttgtcaccccacttctcaccccagctgttcttaacaatccagta 934
to top
>emb|BX933970.1| Gallus gallus finished cDNA, clone ChEST130n15
          Length = 1382

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 243 tatccgttgtcaccccacttctcaccccacgagttcttcacgatccagta 292
           ||||| |||||||||||||||||||||||   |||||| || ||||||||
Sbjct: 996 tatcctttgtcaccccacttctcaccccagctgttcttaacaatccagta 947
to top
>dbj|AK099197.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023120K15, full
            insert sequence
          Length = 1290

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||||||||||||||||||||||||
Sbjct: 1000 ccccacgagttcttcacgatccagta 975
to top
>dbj|AK072767.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023138P12, full
            insert sequence
          Length = 1322

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||||||||||||||||||||||||
Sbjct: 1009 ccccacgagttcttcacgatccagta 984
to top
>gb|AY111799.1| Zea mays CL872_-2 mRNA sequence
          Length = 1761

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||||||||||||||||||||||||
Sbjct: 1095 ccccacgagttcttcacgatccagta 1070
to top
>gb|AF019146.1|AF019146 Zea mays cysteine proteinase Mir2 (mir2) mRNA, complete cds
          Length = 1761

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||||||||||||||||||||||||
Sbjct: 1095 ccccacgagttcttcacgatccagta 1070
to top
>gb|U32430.1|TAU32430 Triticum aestivum thiol protease mRNA, complete cds
          Length = 1353

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 255  ccccacttctcaccccacgagttcttcacgatccagta 292
            ||||||||||| ||||||||||||||  ||||||||||
Sbjct: 1052 ccccacttctcgccccacgagttcttggcgatccagta 1015
to top
>gb|L29168.1|LEICYSTPRO Leishmania pifanoi cysteine proteinase gene, complete cds
          Length = 1377

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||||||||||||||||||||||||
Sbjct: 1135 ccccacgagttcttcacgatccagta 1110
to top
>gb|AY700588.1| Zingiber officinale cysteine protease gp3b mRNA, complete cds
          Length = 1575

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 252 tcaccccacttctcaccccacgagttcttcacgatccagta 292
           ||||||||  |||||||||| ||||||||||| ||||||||
Sbjct: 992 tcaccccagctctcaccccatgagttcttcacaatccagta 952
to top
>gb|AF462226.1| Narcissus pseudonarcissus putative cysteine proteinase mRNA,
           partial cds
          Length = 631

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 252 tcaccccacttctcaccccacgagttcttcacgatccagta 292
           |||||||| ||||| |||||||||||||| | |||||||||
Sbjct: 314 tcaccccaattctcgccccacgagttcttgatgatccagta 274
to top
>dbj|AB091669.1| Pandalus borealis PbCys mRNA for crustapain, complete cds
          Length = 1242

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 265 caccccacgagttcttcacgatccagtaa 293
           |||||||||||||||| ||||||||||||
Sbjct: 892 caccccacgagttcttgacgatccagtaa 864
to top
>gb|AY110047.1| Zea mays CL878_1 mRNA sequence
          Length = 1403

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 318 ccgtacccgaccaccgtgactccatggttcagc 350
           |||||||||||||||||||| || |||||||||
Sbjct: 961 ccgtacccgaccaccgtgacgccgtggttcagc 929
to top
>gb|AC148242.14| Medicago truncatula clone mth2-18f6, complete sequence
          Length = 125077

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                             
Query: 242   gtatccgttgtcaccccacttctcaccccacgagttcttcacgatcca 289
             ||||||||| || |||||  |||||||||||||||| || ||||||||
Sbjct: 81694 gtatccgttctctccccaggtctcaccccacgagtttttaacgatcca 81741
to top
>tpe|BN000093.1|HVA000093 TPA: TPA_exp: Hordeum vulgare mRNA for putative cysteine proteinase
            precursor (sf42 gene)
          Length = 1438

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 249  ttgtcaccccacttctcaccccacgagttcttcacgatccagta 292
            ||||| ||||| ||||| |||||||||||||| | |||||||||
Sbjct: 1057 ttgtccccccagttctcgccccacgagttcttgatgatccagta 1014
to top
>gb|AF019145.2|AF019145 Zea mays cysteine protease Mir1 (mir1) mRNA, complete cds
          Length = 1463

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 269  ccacgagttcttcacgatccagta 292
            ||||||||||||||||||||||||
Sbjct: 1060 ccacgagttcttcacgatccagta 1037
to top
>gb|AC172870.1| Brassica rapa subsp. pekinensis clone KBrH004A06, complete sequence
          Length = 145603

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                             
Query: 242   gtatccgttgtcaccccacttctcaccccacgagttcttcacgatcca 289
             |||||| ||||| ||||||||||  |||||||||||||| | ||||||
Sbjct: 79642 gtatccattgtctccccacttctttccccacgagttcttgatgatcca 79689
to top
>gb|AY432200.1| Aedes aegypti ASAP ID: 43331 cathepsin F mRNA sequence
          Length = 692

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 266 accccacgagttcttcacgatccagta 292
           |||||||||||||||||| ||||||||
Sbjct: 593 accccacgagttcttcacaatccagta 567
to top
>gb|AY159378.1| Leptinotarsa decemlineata clone IntC4 digestive cysteine protease
           intestain mRNA, partial cds
          Length = 305

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 255 ccccacttctcaccccacgagttcttcacgatccagtaa 293
           ||||| || |||||||| ||||||||||| |||||||||
Sbjct: 114 ccccagttatcaccccaggagttcttcacaatccagtaa 76
to top
>gb|AY251055.1| Anthurium andraeanum senescence-associated cysteine protease mRNA,
            complete cds
          Length = 1703

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 266  accccacgagttcttcacgatccagta 292
            ||||||||||||| |||||||||||||
Sbjct: 1004 accccacgagttcctcacgatccagta 978
to top
>gb|AY504968.1| Iris hollandica putative cysteine protease 3 (CYS3) mRNA, complete
           cds
          Length = 1286

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 262 tctcaccccacgagttcttcacgatccagta 292
           ||||||||||||||||||| | |||||||||
Sbjct: 970 tctcaccccacgagttctttatgatccagta 940
to top
>gb|DQ459306.1| Aedes aegypti cathepsin L (CAT-L4) mRNA, partial cds
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 266 accccacgagttcttcacgatccagta 292
           |||||||||||||||||| ||||||||
Sbjct: 705 accccacgagttcttcacaatccagta 679
to top
>emb|Z99953.1|PVZ99953 Phaseolus vulgaris Moldavian encoding cysteine proteinase precursor
            (clone cp41)
          Length = 1376

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 255  ccccacttctcaccccacgagttcttcacgatccagtaa 293
            ||||| ||||| |||||||||||||| | ||||||||||
Sbjct: 1004 ccccagttctccccccacgagttcttgatgatccagtaa 966
to top
>gb|AY121614.1| Drosophila melanogaster GH01606 full insert cDNA
          Length = 6646

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 266  accccacgagttcttcacgatccagta 292
            |||||||||||||||||| ||||||||
Sbjct: 6130 accccacgagttcttcacaatccagta 6104
to top
>ref|NM_169033.2| Drosophila melanogaster CG12163-RA, transcript variant A (CG12163),
            mRNA
          Length = 2450

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 266  accccacgagttcttcacgatccagta 292
            |||||||||||||||||| ||||||||
Sbjct: 1967 accccacgagttcttcacaatccagta 1941
to top
>ref|NM_141264.2| Drosophila melanogaster CG12163-RB, transcript variant B (CG12163),
            mRNA
          Length = 2033

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 266  accccacgagttcttcacgatccagta 292
            |||||||||||||||||| ||||||||
Sbjct: 1550 accccacgagttcttcacaatccagta 1524
to top
>dbj|AB183488.1| Oryzias latipes DNA, MHC class I region
          Length = 540982

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 2      acaatttccatgtttcttattcacaaatatt 32
              |||||||  ||||||||||||||||||||||
Sbjct: 246483 acaatttaaatgtttcttattcacaaatatt 246513
to top
>gb|AC007532.8| Drosophila melanogaster, chromosome 3R, region 82F-82F, BAC clone
             BACR01D10, complete sequence
          Length = 171105

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 266   accccacgagttcttcacgatccagta 292
             |||||||||||||||||| ||||||||
Sbjct: 80677 accccacgagttcttcacaatccagta 80651
to top
>gb|BT003231.1| Drosophila melanogaster LP08529 full insert cDNA
          Length = 2233

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 266  accccacgagttcttcacgatccagta 292
            |||||||||||||||||| ||||||||
Sbjct: 1879 accccacgagttcttcacaatccagta 1853
to top
>gb|AE003603.4| Drosophila melanogaster chromosome 3R, section 5 of 118 of the complete
             sequence
          Length = 265289

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 266   accccacgagttcttcacgatccagta 292
             |||||||||||||||||| ||||||||
Sbjct: 92603 accccacgagttcttcacaatccagta 92629
to top
>gb|AY700586.1| Zingiber officinale cysteine protease gp2b mRNA, complete cds
          Length = 1358

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 255  ccccacttctcaccccacgagttcttcacg 284
            ||||| |||| |||||||||||||||||||
Sbjct: 1007 ccccagttcttaccccacgagttcttcacg 978
to top
>gb|AY850168.1| Cloning vector pQ-CPB recombinant cysteine protease mRNA, partial
           cds
          Length = 1005

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 255 ccccacttctcaccccacgagttctt 280
           ||||| ||||||||||||||||||||
Sbjct: 920 ccccagttctcaccccacgagttctt 895
to top
>ref|NM_120069.3| Arabidopsis thaliana RD19 (RESPONSIVE TO DEHYDRATION 19);
            cysteine-type peptidase AT4G39090 (RD19) mRNA, complete
            cds
          Length = 2514

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 252  tcaccccacttctcaccccacgagttcttcacgatccagtaa 293
            ||||||||  |||| |||||||||||||| | ||||||||||
Sbjct: 1166 tcaccccaagtctctccccacgagttcttgatgatccagtaa 1125
to top
>ref|NM_120068.3| Arabidopsis thaliana ATPase AT4G39080 mRNA, complete cds
          Length = 4147

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 252  tcaccccacttctcaccccacgagttcttcacgatccagtaa 293
            ||||||||  |||| |||||||||||||| | ||||||||||
Sbjct: 3721 tcaccccaagtctctccccacgagttcttgatgatccagtaa 3762
to top
>ref|XM_474131.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1377

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           |||||||||||| |||||||||||||
Sbjct: 935 ccccacgagttcctcacgatccagta 910
to top
>ref|XM_463580.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1116

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           |||||||||||||| |||||||||||
Sbjct: 959 ccccacgagttcttgacgatccagta 934
to top
>ref|XM_471773.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1146

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 255  ccccacttctcaccccacgagttcttcacgatccagta 292
            ||||| ||||| |||||||||||||| | |||||||||
Sbjct: 1034 ccccagttctcgccccacgagttcttgatgatccagta 997
to top
>gb|AC145324.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0026D03 map near S2137, complete sequence
          Length = 115141

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 267   ccccacgagttcttcacgatccagta 292
             |||||||||||||| |||||||||||
Sbjct: 34061 ccccacgagttcttgacgatccagta 34036
to top
>gb|BC067615.1| Danio rerio zgc:85774, mRNA (cDNA clone MGC:85774 IMAGE:6960726),
           complete cds
          Length = 1331

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           ||||| ||||||||||||||||||||
Sbjct: 902 ccccaggagttcttcacgatccagta 877
to top
>gb|AY253445.1| Triticum aestivum P9346A1-2-5-1 putative thiol protease mRNA,
           partial cds
          Length = 560

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 255 ccccacttctcaccccacgagttcttcacgatccagta 292
           ||||||||||| |||||||||||| |  ||||||||||
Sbjct: 429 ccccacttctcgccccacgagttcctggcgatccagta 392
to top
>gb|DQ079995.1| Drosophila simulans male accessory gland protein (CG4847) mRNA,
           partial cds
          Length = 1086

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 268 cccacgagttcttcacgatccagtaa 293
           ||||||||||||| ||||||||||||
Sbjct: 997 cccacgagttcttgacgatccagtaa 972
to top
>gb|AY426971.1| Bombyx mori fibroinase precursor, mRNA, complete cds
          Length = 1026

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           ||||||||||||||||||| ||||||
Sbjct: 932 ccccacgagttcttcacgagccagta 907
to top
>emb|Z97022.1|HVZ97022 Hordeum vulgare gene encoding cysteine proteinase
          Length = 5593

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            |||||||||||||||| |||||||||
Sbjct: 4812 ccccacgagttcttcatgatccagta 4787
to top
>gb|AY133844.1| Arabidopsis thaliana clone U11713 putative cysteine proteinase RD19A
            (At4g39090) mRNA, complete cds
          Length = 1138

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 252  tcaccccacttctcaccccacgagttcttcacgatccagtaa 293
            ||||||||  |||| |||||||||||||| | ||||||||||
Sbjct: 1010 tcaccccaagtctctccccacgagttcttgatgatccagtaa 969
to top
>emb|X80876.1|OSCYSPRO O.sativa mRNA for cysteine protease
          Length = 1440

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            |||||||||||||| |||||||||||
Sbjct: 1073 ccccacgagttcttgacgatccagta 1048
to top
>gb|AY080598.1| Arabidopsis thaliana putative cysteine proteinase RD19A (At4g39090)
            mRNA, complete cds
          Length = 1249

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 252  tcaccccacttctcaccccacgagttcttcacgatccagtaa 293
            ||||||||  |||| |||||||||||||| | ||||||||||
Sbjct: 1019 tcaccccaagtctctccccacgagttcttgatgatccagtaa 978
to top
>emb|AL663007.2|OSJN00206 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0054B09,
             complete sequence
          Length = 146506

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 255   ccccacttctcaccccacgagttcttcacgatccagta 292
             ||||| ||||| |||||||||||||| | |||||||||
Sbjct: 21966 ccccagttctcgccccacgagttcttgatgatccagta 21929
to top
>emb|AL161594.2|ATCHRIV90 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 90
          Length = 198987

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 252    tcaccccacttctcaccccacgagttcttcacgatccagtaa 293
              ||||||||  |||| |||||||||||||| | ||||||||||
Sbjct: 130078 tcaccccaagtctctccccacgagttcttgatgatccagtaa 130119
to top
>emb|AL035679.1|ATF19H22 Arabidopsis thaliana DNA chromosome 4, BAC clone F19H22 (ESSA project)
          Length = 100469

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 252   tcaccccacttctcaccccacgagttcttcacgatccagtaa 293
             ||||||||  |||| |||||||||||||| | ||||||||||
Sbjct: 92068 tcaccccaagtctctccccacgagttcttgatgatccagtaa 92109
to top
>emb|AJ512653.1|LGU512653 Leishmania guyanensis partial cpb gene for cysteine proteinase b
          Length = 522

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 255 ccccacttctcaccccacgagttctt 280
           ||||| ||||||||||||||||||||
Sbjct: 518 ccccagttctcaccccacgagttctt 493
to top
>ref|NM_212688.1| Danio rerio zgc:85774 (zgc:85774), mRNA
          Length = 1331

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           ||||| ||||||||||||||||||||
Sbjct: 902 ccccaggagttcttcacgatccagta 877
to top
>dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0497A05
          Length = 130919

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 267   ccccacgagttcttcacgatccagta 292
             |||||||||||||| |||||||||||
Sbjct: 50138 ccccacgagttcttgacgatccagta 50113
to top
>dbj|AK220782.1| Arabidopsis thaliana mRNA for drought-inducible cysteine proteinase
           RD19A precursor, complete cds, clone: RAFL22-25-O05
          Length = 399

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 252 tcaccccacttctcaccccacgagttcttcacgatccagtaa 293
           ||||||||  |||| |||||||||||||| | ||||||||||
Sbjct: 175 tcaccccaagtctctccccacgagttcttgatgatccagtaa 134
to top
>gb|S77508.1| cysteine proteinase [Bombyx mori=silkmoths, pupae, eggs, mRNA, 1465
           nt]
          Length = 1465

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           ||||||||||||||||||| ||||||
Sbjct: 971 ccccacgagttcttcacgagccagta 946
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 267      ccccacgagttcttcacgatccagta 292
                |||||||||||| |||||||||||||
Sbjct: 33158095 ccccacgagttcctcacgatccagta 33158120



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                      
Query: 255      ccccacttctcaccccacgagttcttcacgatccagta 292
                ||||| ||||| |||||||||||||| | |||||||||
Sbjct: 14184200 ccccagttctcgccccacgagttcttgatgatccagta 14184163
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 267     ccccacgagttcttcacgatccagta 292
               |||||||||||||| |||||||||||
Sbjct: 8298339 ccccacgagttcttgacgatccagta 8298364
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 267      ccccacgagttcttcacgatccagta 292
                |||||||||||||| |||||||||||
Sbjct: 39495696 ccccacgagttcttgacgatccagta 39495671



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 267      ccccacgagttcttcacgat 286
                ||||||||||||||||||||
Sbjct: 42849417 ccccacgagttcttcacgat 42849398
to top
>emb|BX828077.1|CNS0A48A Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH50ZA07 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1179

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 252  tcaccccacttctcaccccacgagttcttcacgatccagtaa 293
            ||||||||  |||| |||||||||||||| | ||||||||||
Sbjct: 1004 tcaccccaagtctctccccacgagttcttgatgatccagtaa 963
to top
>emb|BX826350.1|CNS0A43C Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB18ZD12 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1186

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 252  tcaccccacttctcaccccacgagttcttcacgatccagtaa 293
            ||||||||  |||| |||||||||||||| | ||||||||||
Sbjct: 1006 tcaccccaagtctctccccacgagttcttgatgatccagtaa 965
to top
>gb|AY087621.1| Arabidopsis thaliana clone 37132 mRNA, complete sequence
          Length = 1461

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 252  tcaccccacttctcaccccacgagttcttcacgatccagtaa 293
            ||||||||  |||| |||||||||||||| | ||||||||||
Sbjct: 1166 tcaccccaagtctctccccacgagttcttgatgatccagtaa 1125
to top
>dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1417F08
          Length = 155536

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 267   ccccacgagttcttcacgatccagta 292
             |||||||||||||| |||||||||||
Sbjct: 70710 ccccacgagttcttgacgatccagta 70685
to top
>dbj|D13042.1|ATHRD19A Arabidopsis thaliana rd19A gene for thiol protease, partial cds
          Length = 3255

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 252  tcaccccacttctcaccccacgagttcttcacgatccagtaa 293
            ||||||||  |||| |||||||||||||| | ||||||||||
Sbjct: 2937 tcaccccaagtctctccccacgagttcttgatgatccagtaa 2896
to top
>dbj|AP006170.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBa0042B15
          Length = 157981

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 267   ccccacgagttcttcacgatccagta 292
             |||||||||||||| |||||||||||
Sbjct: 58322 ccccacgagttcttaacgatccagta 58347



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 267   ccccacgagttcttcacgatccagta 292
             |||||||||||||| |||||||||||
Sbjct: 47818 ccccacgagttcttaacgatccagta 47843
to top
>dbj|AK121305.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023111H18, full
            insert sequence
          Length = 1981

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 255  ccccacttctcaccccacgagttcttcacgatccagta 292
            ||||| ||||| |||||||||||||| | |||||||||
Sbjct: 1602 ccccagttctcgccccacgagttcttgatgatccagta 1565
to top
>gb|AF099203.1|AF099203 Oryza sativa cysteine endopeptidase precursor (EP3A) gene, complete
            cds
          Length = 2588

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            |||||||||||||| |||||||||||
Sbjct: 1923 ccccacgagttcttgacgatccagta 1898
to top
>dbj|AK098910.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H09, full
            insert sequence
          Length = 1753

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            |||||||||||| |||||||||||||
Sbjct: 1000 ccccacgagttcctcacgatccagta 975
to top
>dbj|AK071913.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013065M08, full
            insert sequence
          Length = 1774

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            |||||||||||| |||||||||||||
Sbjct: 1000 ccccacgagttcctcacgatccagta 975
to top
>dbj|AK071495.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023099K03, full
            insert sequence
          Length = 1511

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            |||||||||||||| |||||||||||
Sbjct: 1079 ccccacgagttcttgacgatccagta 1054
to top
>dbj|AK061729.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B12, full
           insert sequence
          Length = 976

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           |||||||||||| |||||||||||||
Sbjct: 202 ccccacgagttcctcacgatccagta 177
to top
>gb|AY109437.1| Zea mays CL903_-1 mRNA sequence
          Length = 1664

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            |||||||||||||| |||||||||||
Sbjct: 1050 ccccacgagttcttgacgatccagta 1025
to top
>gb|AY103676.1| Zea mays PCO102242 mRNA sequence
          Length = 1878

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||| ||||||||||||||||||||
Sbjct: 1089 ccccaagagttcttcacgatccagta 1064
to top
>emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0212B02, complete
             sequence
          Length = 118971

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 267   ccccacgagttcttcacgatccagta 292
             |||||||||||| |||||||||||||
Sbjct: 48488 ccccacgagttcctcacgatccagta 48513
to top
>gb|AF019147.1|AF019147 Zea mays cysteine proteinase Mir3 (mir3) mRNA, complete cds
          Length = 1830

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||| ||||||||||||||||||||
Sbjct: 1054 ccccatgagttcttcacgatccagta 1029
to top
>dbj|AB004648.1| Oryza sativa (japonica cultivar-group) RepA gene for cysteine
            endopeptidase, complete cds
          Length = 3836

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            |||||||||||||| |||||||||||
Sbjct: 2595 ccccacgagttcttgacgatccagta 2570
to top
>dbj|D90406.1|RICOZA Oryza sativa (japonica cultivar-group) mRNA for oryzain alpha,
           complete cds
          Length = 1929

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           |||||||||||| |||||||||||||
Sbjct: 980 ccccacgagttcctcacgatccagta 955
to top
>dbj|AB020961.1| Zea mays mRNA for cysteine protease component of protease-inhibitor
            complex, complete cds
          Length = 1828

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            ||||| ||||||||||||||||||||
Sbjct: 1053 ccccatgagttcttcacgatccagta 1028
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 267     ccccacgagttcttcacgatccagta 292
               |||||||||||||| |||||||||||
Sbjct: 8369102 ccccacgagttcttgacgatccagta 8369127
to top
>emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0059K02,
             complete sequence
          Length = 165745

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 267   ccccacgagttcttcacgatccagta 292
             |||||||||||| |||||||||||||
Sbjct: 40745 ccccacgagttcctcacgatccagta 40770
to top
>emb|CR450750.18| Zebrafish DNA sequence from clone CH211-234P18 in linkage group 13,
             complete sequence
          Length = 78721

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 267   ccccacgagttcttcacgatccagta 292
             ||||| ||||||||||||||||||||
Sbjct: 13135 ccccaggagttcttcacgatccagta 13160
to top
>dbj|AP006096.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10G09, TM0173b,
             complete sequence
          Length = 66866

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 267   ccccacgagttcttcacgatccagta 292
             ||||||||||||||||| ||||||||
Sbjct: 36070 ccccacgagttcttcactatccagta 36095
to top
>dbj|D76415.1| Rice seedling mRNA for cysteine proteinase, complete cds
          Length = 1429

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 267 ccccacgagttcttcacgatccagta 292
           |||||||||||||| |||||||||||
Sbjct: 969 ccccacgagttcttgacgatccagta 944
to top
>dbj|AB004819.1| Oryza sativa Rep1 gene for cysteine endopeptidase, complete cds
          Length = 2544

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 267  ccccacgagttcttcacgatccagta 292
            |||||||||||||| |||||||||||
Sbjct: 1885 ccccacgagttcttgacgatccagta 1860
to top
>gb|BT018299.1| Zea mays clone EL01T0206B09.c mRNA sequence
          Length = 1209

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 252 tcaccccacttctcaccccacgagttcttcacgatccagta 292
           |||||||||| ||  |||||||||||||| | |||||||||
Sbjct: 905 tcaccccactgctttccccacgagttcttgatgatccagta 865
to top
>gb|AY159375.1| Leptinotarsa decemlineata clone IntC1 digestive cysteine protease
           intestain mRNA, partial cds
          Length = 978

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 265 caccccacgagttcttcacgatccagtaa 293
           ||||||| ||||||||||| |||||||||
Sbjct: 774 caccccaggagttcttcacaatccagtaa 746
to top
>gb|AY528231.1| Leptinotarsa decemlineata clone IntC14 digestive cysteine
           proteinase intestain mRNA, complete cds
          Length = 975

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 265 caccccacgagttcttcacgatccagtaa 293
           ||||||| ||||||||||| |||||||||
Sbjct: 883 caccccaggagttcttcacaatccagtaa 855
to top
>dbj|AB081845.1| Engraulis japonicus aCatL mRNA for cathepsin L, complete cds
          Length = 1563

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 252 tcaccccacttctcaccccacgagttcttcacgatccagta 292
           |||||||||||||||| |||   |||||| |||||||||||
Sbjct: 964 tcaccccacttctcactccagctgttcttgacgatccagta 924
to top
>ref|XM_510533.1| PREDICTED: Pan troglodytes similar to Cathepsin H precursor
            (LOC453574), mRNA
          Length = 2493

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 266  accccacgagttcttcacgatccagtaa 293
            |||||| ||||| |||||||||||||||
Sbjct: 2295 accccaagagtttttcacgatccagtaa 2268
to top
>ref|NM_189456.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1098

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 267 ccccacgagttcttcacgat 286
           ||||||||||||||||||||
Sbjct: 989 ccccacgagttcttcacgat 970
to top
>ref|NM_148979.1| Homo sapiens cathepsin H (CTSH), transcript variant 2, mRNA
          Length = 1432

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 971 accccaagagtttttcacgatccagtaa 944
to top
>ref|NM_004390.2| Homo sapiens cathepsin H (CTSH), transcript variant 1, mRNA
          Length = 1504

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 266  accccacgagttcttcacgatccagtaa 293
            |||||| ||||| |||||||||||||||
Sbjct: 1007 accccaagagtttttcacgatccagtaa 980
to top
>gb|AC134472.4| Mus musculus BAC clone RP23-123E16 from chromosome 18, complete
             sequence
          Length = 185134

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   atggaaagaataatgaccaa 140
             ||||||||||||||||||||
Sbjct: 40603 atggaaagaataatgaccaa 40584
to top
>emb|Z19155.1|CEF54G8 Caenorhabditis elegans Cosmid F54G8, complete sequence
          Length = 31613

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 14    tttcttattcacaaatattt 33
             ||||||||||||||||||||
Sbjct: 29984 tttcttattcacaaatattt 30003
to top
>gb|AC066608.6| Homo sapiens chromosome 3 clone RP11-785A7 map 3p, complete sequence
          Length = 172811

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 17     cttattcacaaatatttgaa 36
              ||||||||||||||||||||
Sbjct: 154813 cttattcacaaatatttgaa 154794
to top
>ref|XM_762953.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_449_31555_31941) partial mRNA
          Length = 387

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 273 gagttcttcacgatccagta 292
           ||||||||||||||||||||
Sbjct: 122 gagttcttcacgatccagta 141
to top
>ref|XM_762954.1| Giardia lamblia ATCC 50803 protease (GLP_449_32565_31567) partial
           mRNA
          Length = 999

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 273 gagttcttcacgatccagta 292
           ||||||||||||||||||||
Sbjct: 890 gagttcttcacgatccagta 871
to top
>ref|XM_766421.1| Giardia lamblia ATCC 50803 cathepsin L (GLP_163_69918_68548)
           partial mRNA
          Length = 1371

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 242 gtatccgttgtcaccccacttctcaccccacgagtt 277
           |||||| | |||||||||||| |||||||| |||||
Sbjct: 957 gtatccatagtcaccccacttttcaccccatgagtt 922
to top
>gb|AC102626.9| Mus musculus chromosome 12, clone RP23-456E21, complete sequence
          Length = 222905

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 129   aataatgaccaagcatacca 148
             ||||||||||||||||||||
Sbjct: 26794 aataatgaccaagcatacca 26775
to top
>emb|AL589993.5| Human DNA sequence from clone RP11-57K17 on chromosome 6 Contains the
             3' end of the gene for serologically defined breast cancer
             antigen NY-BR-15 (LOC221312) and a DEAD/H
             (Asp-Glu-Ala-Asp/His) box polypeptide 24 (DDX24)
             pseudogene, complete sequence
          Length = 96246

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 214   tgtctatgatgcccttcttc 233
             ||||||||||||||||||||
Sbjct: 94589 tgtctatgatgcccttcttc 94570
to top
>emb|CR456881.1| Homo sapiens full open reading frame cDNA clone RZPDo834G0718D for
           gene CTSH, cathepsin H; complete cds, incl. stopcodon
          Length = 1008

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 912 accccaagagtttttcacgatccagtaa 885
to top
>emb|AJ222774.1|HVJ222774 Hordeum vulgare mRNA for putative thiol protease, clone L8
          Length = 382

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 249 ttgtcaccccacttctcaccccacgagttcttcacgatccagta 292
           ||||||||||||||  ||  ||||||||||||  ||||||||||
Sbjct: 198 ttgtcaccccacttggcagtccacgagttcttaccgatccagta 155
to top
>gb|BC002479.2| Homo sapiens cathepsin H, transcript variant 1, mRNA (cDNA clone
           MGC:1519 IMAGE:3349910), complete cds
          Length = 1470

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 973 accccaagagtttttcacgatccagtaa 946
to top
>emb|X07549.1|HSCATH Human mRNA for cathepsin H (E.C.3.4.22.16.)
          Length = 1106

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 653 accccaagagtttttcacgatccagtaa 626
to top
>gb|AC011944.12| Homo sapiens chromosome 15, clone RP11-16K12, complete sequence
          Length = 166309

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 266    accccacgagttcttcacgatccagtaa 293
              |||||| ||||| |||||||||||||||
Sbjct: 103341 accccaagagtttttcacgatccagtaa 103314
to top
>emb|CR749582.1| Homo sapiens mRNA; cDNA DKFZp686B24257 (from clone DKFZp686B24257)
          Length = 2172

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 266  accccacgagttcttcacgatccagtaa 293
            |||||| ||||| |||||||||||||||
Sbjct: 1678 accccaagagtttttcacgatccagtaa 1651
to top
>emb|CR613401.1| full-length cDNA clone CS0DC026YK23 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1357

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 962 accccaagagtttttcacgatccagtaa 935
to top
>emb|CR596280.1| full-length cDNA clone CS0DF022YJ05 of Fetal brain of Homo sapiens
           (human)
          Length = 1122

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 665 accccaagagtttttcacgatccagtaa 638
to top
>gb|AF426248.1| Homo sapiens truncated cathepsin H mRNA, complete cds
          Length = 972

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 876 accccaagagtttttcacgatccagtaa 849
to top
>gb|AF426247.1| Homo sapiens cathepsin H mRNA, complete cds
          Length = 1008

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 912 accccaagagtttttcacgatccagtaa 885
to top
>gb|AC157098.5| Mus musculus 6 BAC RP24-398G2 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 168496

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 214   tgtctatgatgcccttcttcattc 237
             ||||||||| ||||||||||||||
Sbjct: 34930 tgtctatgaagcccttcttcattc 34953
to top
>dbj|AK014748.1| Mus musculus 0 day neonate head cDNA, RIKEN full-length enriched
           library, clone:4833422B07 product:unclassifiable, full
           insert sequence
          Length = 1358

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 121 atggaaagaataatgaccaa 140
           ||||||||||||||||||||
Sbjct: 213 atggaaagaataatgaccaa 194
to top
>gb|AC007303.7|AC007303 Drosophila melanogaster, chromosome 2R, region 44E-44F, BAC clone
            BACR43I04, complete sequence
          Length = 169509

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 402  gctccgccagcctcgatcga 421
            ||||||||||||||||||||
Sbjct: 3372 gctccgccagcctcgatcga 3353
to top
>gb|AC007471.4|AC007471 Drosophila melanogaster, chromosome 2R, region 44F-45A, BAC clone
             BACR02C23, complete sequence
          Length = 168601

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 402   gctccgccagcctcgatcga 421
             ||||||||||||||||||||
Sbjct: 12643 gctccgccagcctcgatcga 12662
to top
>gb|AC158650.7| Mus musculus 6 BAC RP23-280O4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 193965

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 214   tgtctatgatgcccttcttcattc 237
             ||||||||| ||||||||||||||
Sbjct: 47084 tgtctatgaagcccttcttcattc 47061
to top
>dbj|AP003277.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518C01
          Length = 173555

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 267   ccccacgagttcttcacgat 286
             ||||||||||||||||||||
Sbjct: 43151 ccccacgagttcttcacgat 43132
to top
>dbj|AB099890.1| Oryzias latipes ctsL mRNA for cathepsin L, complete cds
          Length = 1369

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 249 ttgtcaccccacttctcaccccacgagttcttcacgatccagta 292
           ||||| ||||||||||||| |||   |||||| |||||||||||
Sbjct: 954 ttgtcgccccacttctcactccagctgttcttgacgatccagta 911
to top
>gb|AY891889.1| Synthetic construct Homo sapiens clone FLH116936.01L cathepsin H
           (CTSH) mRNA, partial cds
          Length = 1008

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 912 accccaagagtttttcacgatccagtaa 885
to top
>gb|AY889402.1| Synthetic construct Homo sapiens clone FLH116940.01X cathepsin H
           (CTSH) mRNA, complete cds
          Length = 1008

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 912 accccaagagtttttcacgatccagtaa 885
to top
>dbj|AK119182.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-H03, full
            insert sequence
          Length = 1377

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 267  ccccacgagttcttcacgat 286
            ||||||||||||||||||||
Sbjct: 1039 ccccacgagttcttcacgat 1020
to top
>dbj|AK026152.1| Homo sapiens cDNA: FLJ22499 fis, clone HRC11250, highly similar to
            HSCATHH Human mRNA for cathepsin H (EC 3.4.22.16)
          Length = 1807

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 266  accccacgagttcttcacgatccagtaa 293
            |||||| ||||| |||||||||||||||
Sbjct: 1338 accccaagagtttttcacgatccagtaa 1311
to top
>dbj|AK130158.1| Homo sapiens cDNA FLJ26648 fis, clone MPE04736, highly similar to
           Cathepsin H precursor (EC 3.4.22.16)
          Length = 1438

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 978 accccaagagtttttcacgatccagtaa 951
to top
>dbj|AK109160.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-155-G07, full
            insert sequence
          Length = 1304

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 267  ccccacgagttcttcacgat 286
            ||||||||||||||||||||
Sbjct: 1002 ccccacgagttcttcacgat 983
to top
>gb|AY893780.1| Synthetic construct Homo sapiens clone FLH054888.01L cathepsin H
           (CTSH) mRNA, partial cds
          Length = 1008

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 912 accccaagagtttttcacgatccagtaa 885
to top
>dbj|AK106011.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-B02, full
            insert sequence
          Length = 1377

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 267  ccccacgagttcttcacgat 286
            ||||||||||||||||||||
Sbjct: 1039 ccccacgagttcttcacgat 1020
to top
>dbj|AK105881.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-D02, full
            insert sequence
          Length = 1519

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 267  ccccacgagttcttcacgat 286
            ||||||||||||||||||||
Sbjct: 1039 ccccacgagttcttcacgat 1020
to top
>dbj|AK059528.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-D05, full
            insert sequence
          Length = 1332

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 267  ccccacgagttcttcacgat 286
            ||||||||||||||||||||
Sbjct: 1039 ccccacgagttcttcacgat 1020
to top
>gb|AE003835.4| Drosophila melanogaster chromosome 2R, section 15 of 73 of the complete
             sequence
          Length = 271696

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 402   gctccgccagcctcgatcga 421
             ||||||||||||||||||||
Sbjct: 25763 gctccgccagcctcgatcga 25782
to top
>emb|CT025710.9| Mouse DNA sequence from clone RP23-261P14 on chromosome 12, complete
              sequence
          Length = 225685

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 129    aataatgaccaagcatacca 148
              ||||||||||||||||||||
Sbjct: 135882 aataatgaccaagcatacca 135863
to top
>gb|BC018821.2| Homo sapiens cathepsin H, transcript variant 1, mRNA (cDNA clone
           IMAGE:3342948)
          Length = 1470

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 973 accccaagagtttttcacgatccagtaa 946
to top
>gb|AC018842.6| Homo sapiens chromosome 3 clone RP11-82O3 map 3p, complete sequence
          Length = 175916

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 17     cttattcacaaatatttgaa 36
              ||||||||||||||||||||
Sbjct: 142574 cttattcacaaatatttgaa 142593
to top
>emb|X16832.1|HSCATHH Human mRNA for cathepsin H (EC 3.4.22.16)
          Length = 1399

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 266 accccacgagttcttcacgatccagtaa 293
           |||||| ||||| |||||||||||||||
Sbjct: 946 accccaagagtttttcacgatccagtaa 919
to top
>gb|L25066.1|SCMGTP2A Schistosoma mansoni glucose transporter protein (SGTP2) mRNA,
           complete cds
          Length = 2250

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  gtacttgtgacaacaatata 102
           ||||||||||||||||||||
Sbjct: 547 gtacttgtgacaacaatata 528


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,660,586
Number of Sequences: 3902068
Number of extensions: 3660586
Number of successful extensions: 78228
Number of sequences better than 10.0: 159
Number of HSP's better than 10.0 without gapping: 162
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77856
Number of HSP's gapped (non-prelim): 369
length of query: 484
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 462
effective length of database: 17,147,199,772
effective search space: 7922006294664
effective search space used: 7922006294664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top