ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart55d10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY968589.1| Triticum aestivum ice recrystallization inhibitio... 64 5e-07
2gb|AY968588.1| Triticum aestivum ice recrystallization inhibitio... 50 0.007
3gb|AC121079.20| Mus musculus chromosome 3, clone RP24-178P12, co... 46 0.11
4gb|AC104329.22| Mus musculus strain C57BL/6J clone rp23-418c12 m... 46 0.11
5emb|AL731546.4| Human DNA sequence from clone RP11-293L1 on chro... 46 0.11
6gb|AC104632.10| Mus musculus strain C57BL/6J clone rp23-368d24 m... 46 0.11
7gb|AC171273.1| Mus musculus BAC clone RP23-137J12 from chromosom... 46 0.11
8emb|AL672194.1| Mouse DNA sequence from clone RP23-73P3 on chrom... 46 0.11
9gb|DQ366715.1| Uncultured Prochlorococcus marinus clone ASNC2259... 44 0.45
10emb|BX248318.9| Zebrafish DNA sequence from clone CH211-220M17 i... 44 0.45
11gb|AC158767.3| Mus musculus chromosome 1, clone RP24-128E5, comp... 42 1.8
12emb|Z36237.1|CEC48D5 Caenorhabditis elegans Cosmid C48D5, comple... 42 1.8
13gb|AC124765.2| Mus musculus BAC clone RP23-197D9 from 2, complet... 42 1.8
14emb|AL357037.13| Human DNA sequence from clone RP11-383B24 on ch... 42 1.8
15emb|CR933813.6| Zebrafish DNA sequence from clone CH73-227I15 in... 42 1.8
16gb|AC011493.5| Homo sapiens chromosome 19 clone CTB-28I9, comple... 42 1.8
17emb|BX942820.7| Zebrafish DNA sequence from clone CH211-222L23 i... 42 1.8
18gb|AC158674.10| Mus musculus 6 BAC RP23-54E12 (Roswell Park Canc... 42 1.8
19gb|AC069462.3| Homo sapiens chromosome 3 clone RP11-271E2 map 3p... 42 1.8
20gb|AC117771.17| Mus musculus chromosome 1, clone RP24-512A5, com... 42 1.8
21emb|AL133453.3|CNS01DV4 Human chromosome 14 DNA sequence BAC R-8... 42 1.8
22emb|AL844840.8| Mouse DNA sequence from clone RP23-337P9 on chro... 42 1.8
23gb|AC004518.1|AC004518 Homo sapiens chromosome 14, BAC CITB-135H... 42 1.8
24emb|AL589168.3|CNS07EG1 Human chromosome 14 DNA sequence BAC R-1... 42 1.8
25gb|AC115818.9| Mus musculus chromosome 1, clone RP23-433A12, com... 40 7.0
26gb|AC107769.7| Mus musculus chromosome 16, clone RP23-130N20, co... 40 7.0
27emb|BX546457.1| Human DNA sequence from clone RP11-29O12 on chro... 40 7.0
28emb|AL359710.15| Human DNA sequence from clone RP11-30L7 on chro... 40 7.0
29emb|AL358237.13| Human DNA sequence from clone RP3-407G6 on chro... 40 7.0
30gb|AC016885.16| Homo sapiens chromosome 8, clone RP11-388K12, co... 40 7.0
31gb|AC157787.6| Mus musculus chromosome 1, clone RP23-158A6, comp... 40 7.0
32gb|AC063948.44| Homo sapiens 12 BAC RP11-321F8 (Roswell Park Can... 40 7.0
33gb|AF503628.1| Homo sapiens prostate apoptosis response protein ... 40 7.0
34gb|AC164663.5| Mus musculus 10 BAC RP23-44F24 (Roswell Park Canc... 40 7.0
35emb|AL929355.1|PFA929355 Plasmodium falciparum strain 3D7, chrom... 40 7.0
36emb|AL161592.2|ATCHRIV88 Arabidopsis thaliana DNA chromosome 4, ... 40 7.0
37emb|AL035709.1|ATT28I19 Arabidopsis thaliana DNA chromosome 4, B... 40 7.0
38emb|CR388046.14| Zebrafish DNA sequence from clone DKEY-50E6 in ... 40 7.0
39gb|AC027449.6| Homo sapiens chromosome 18, clone RP11-535A5, com... 40 7.0
40gb|AC022825.9| Homo sapiens chromosome 8, clone RP11-88J22, comp... 40 7.0
41gb|AC135795.21| Medicago truncatula clone mth2-28g10, complete s... 40 7.0
42gb|AC154607.2| Mus musculus BAC clone RP23-331D17 from chromosom... 40 7.0
43gb|AC093560.2| Homo sapiens chromosome 1 clone RP11-398H19, comp... 40 7.0
44gb|AC023170.10| Homo sapiens chromosome 10 clone RP11-373P23, co... 40 7.0
45gb|AC073569.26| Homo sapiens 12 BAC RP11-530C5 (Roswell Park Can... 40 7.0
46gb|AC093677.4| Homo sapiens BAC clone RP11-629B11 from 4, comple... 40 7.0
47gb|AC022360.23| Homo sapiens 8 BAC RP11-58O3 (Roswell Park Cance... 40 7.0
48gb|AC150889.3| Medicago truncatula chromosome 7 BAC clone mte1-6... 40 7.0
49emb|BX296537.10| Zebrafish DNA sequence from clone CH211-249G3 i... 40 7.0
50tpg|BK000438.1| TPA: TPA_exp: Homo sapiens RING finger protein C... 40 7.0
51gb|AC084277.3| Homo sapiens BAC clone RP11-68O1 from 4, complete... 40 7.0
52gb|AC051630.4|AC051630 Arabidopsis thaliana chromosome 1 BAC F10... 40 7.0
53gb|AC018682.4| Homo sapiens BAC clone RP11-417F21 from 2, comple... 40 7.0
54gb|AC066690.6|AC066690 Arabidopsis thaliana chromosome 1 BAC F3A... 40 7.0
55gb|AC069556.4|AC069556 Genomic Sequence For Arabidopsis thaliana... 40 7.0
56gb|AC020646.2|AC020646 Genomic sequence for Arabidopsis thaliana... 40 7.0
57gb|AC007505.4|AC007505 Arabidopsis thaliana chromosome I BAC F28... 40 7.0
58gb|AC005058.1|AC005058 Homo sapiens BAC clone CTB-54D4 from 7q31... 40 7.0
59emb|BX284684.8| Zebrafish DNA sequence from clone DKEY-14I10 in ... 40 7.0
60emb|AL355101.2|CNS05TCK Human chromosome 14 DNA sequence BAC R-6... 40 7.0
61gb|AC167700.2| Reniera sp. JGI-2005 clone JGIBAYC-5J13, complete... 40 7.0
62emb|AL590723.13| Human DNA sequence from clone RP11-492I21 on ch... 40 7.0
63emb|AL035605.1|ATF19F18 Arabidopsis thaliana DNA chromosome 4, B... 40 7.0
64gb|AC135019.3| Mus musculus BAC clone RP23-186D15 from 10, compl... 40 7.0
65emb|AL672307.9| Mouse DNA sequence from clone RP23-141N2 on chro... 40 7.0
66emb|AL596246.10| Mouse DNA sequence from clone RP23-186E14 on ch... 40 7.0
67gb|AY035396.1| Escherichia coli O91 O-antigen gene cluster, comp... 40 7.0
68dbj|AB030580.1| Homo sapiens DNA, breakpoint of inv(11)(q13,q25)... 40 7.0 
>gb|AY968589.1| Triticum aestivum ice recrystallization inhibition protein 2
            precursor, mRNA, complete cds
          Length = 1596

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 74/88 (84%)
 Strand = Plus / Minus

                                                                        
Query: 238  actttgttgtccccagacacaatatggttcatcccagatacaacattgttgtttccggat 297
            |||||||| | |||||| || | ||||||  |||||||||||||||| ||| | || | |
Sbjct: 1235 actttgttattcccagatacgacatggtttctcccagatacaacattattgctcccagtt 1176

                                        
Query: 298  acgacattgttactccccgatacgacat 325
            ||||||||||| ||||| ||||||||||
Sbjct: 1175 acgacattgttcctcccggatacgacat 1148



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 297  tacgacattgttactccccgatacgacatggtt 329
            |||||| |||||| |||| ||||||||||||||
Sbjct: 1239 tacgactttgttattcccagatacgacatggtt 1207



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                        
Query: 269  tcccagatacaacattgttgtttccggatacgacattgttactccccgatacgacatggt 328
            |||||| ||| ||||||||  | ||||||||||||||||  ||||| || || |||||||
Sbjct: 1183 tcccagttacgacattgttcctcccggatacgacattgtcgctcccagaaacaacatggt 1124

             
Query: 329  t 329
            |
Sbjct: 1123 t 1123



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 295  gatacgacattgttactccc 314
            ||||||||||||||||||||
Sbjct: 1094 gatacgacattgttactccc 1075
to top
>gb|AY968588.1| Triticum aestivum ice recrystallization inhibition protein 1
           precursor, mRNA, complete cds
          Length = 1079

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 412 ttgctcccatatacgacatggttgttcccggataccgtgtt 452
           ||||||||| |||||||||||||| |||| ||||| |||||
Sbjct: 920 ttgctcccagatacgacatggttgctcccagatacagtgtt 880



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 297 tacgacattgttactccccgatacgacatggtt 329
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 930 tacgaccttgttgctcccagatacgacatggtt 898



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 394 ctcccggatacgacatgcttgctcccatatac 425
           ||||| ||||||||||| ||||||||| ||||
Sbjct: 917 ctcccagatacgacatggttgctcccagatac 886
to top
>gb|AC121079.20| Mus musculus chromosome 3, clone RP24-178P12, complete sequence
          Length = 177802

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 195   cttatagttgtacataaaataaa 217
             |||||||||||||||||||||||
Sbjct: 58002 cttatagttgtacataaaataaa 58024
to top
>gb|AC104329.22| Mus musculus strain C57BL/6J clone rp23-418c12 map 3, complete sequence
          Length = 197096

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 195    cttatagttgtacataaaataaa 217
              |||||||||||||||||||||||
Sbjct: 167796 cttatagttgtacataaaataaa 167774
to top
>emb|AL731546.4| Human DNA sequence from clone RP11-293L1 on chromosome 10, complete
             sequence
          Length = 92998

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 197   tatagttgtacataaaataaaat 219
             |||||||||||||||||||||||
Sbjct: 38404 tatagttgtacataaaataaaat 38382
to top
>gb|AC104632.10| Mus musculus strain C57BL/6J clone rp23-368d24 map 3, complete
            sequence
          Length = 210499

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 195  cttatagttgtacataaaataaa 217
            |||||||||||||||||||||||
Sbjct: 4862 cttatagttgtacataaaataaa 4840
to top
>gb|AC171273.1| Mus musculus BAC clone RP23-137J12 from chromosome 3, complete sequence
          Length = 234363

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 195    cttatagttgtacataaaataaa 217
              |||||||||||||||||||||||
Sbjct: 138254 cttatagttgtacataaaataaa 138232
to top
>emb|AL672194.1| Mouse DNA sequence from clone RP23-73P3 on chromosome 13, complete
             sequence
          Length = 173598

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 38    ttcttttgaaatgtacagtacat 60
             |||||||||||||||||||||||
Sbjct: 58722 ttcttttgaaatgtacagtacat 58744
to top
>gb|DQ366715.1| Uncultured Prochlorococcus marinus clone ASNC2259 genomic sequence
          Length = 35161

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 27    cacatatacttttcttttgaaa 48
             ||||||||||||||||||||||
Sbjct: 11331 cacatatacttttcttttgaaa 11352
to top
>emb|BX248318.9| Zebrafish DNA sequence from clone CH211-220M17 in linkage group 11,
             complete sequence
          Length = 194209

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 36    ttttcttttgaaatgtacagta 57
             ||||||||||||||||||||||
Sbjct: 77201 ttttcttttgaaatgtacagta 77222
to top
>gb|AC158767.3| Mus musculus chromosome 1, clone RP24-128E5, complete sequence
          Length = 188758

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 205    tacataaaataaaatcattaa 225
              |||||||||||||||||||||
Sbjct: 152141 tacataaaataaaatcattaa 152121
to top
>emb|Z36237.1|CEC48D5 Caenorhabditis elegans Cosmid C48D5, complete sequence
          Length = 38370

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 446   ccgtgttcccattcccatata 466
             |||||||||||||||||||||
Sbjct: 26354 ccgtgttcccattcccatata 26374
to top
>gb|AC124765.2| Mus musculus BAC clone RP23-197D9 from 2, complete sequence
          Length = 191781

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 203    tgtacataaaataaaatcatt 223
              |||||||||||||||||||||
Sbjct: 129791 tgtacataaaataaaatcatt 129771
to top
>emb|AL357037.13| Human DNA sequence from clone RP11-383B24 on chromosome 10 Contains the
              3' end of a 44kDA polymerase (RNA) III (DNA directed)
              polypeptide D (POLR3D) pseudogene, the 3' end of the ADK
              gene for adenosine kinase and a novel pseudogene, complete
              sequence
          Length = 165773

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1      acaacccaaaccataatatat 21
              |||||||||||||||||||||
Sbjct: 144816 acaacccaaaccataatatat 144836
to top
>emb|CR933813.6| Zebrafish DNA sequence from clone CH73-227I15 in linkage group 3,
             complete sequence
          Length = 97268

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 206   acataaaataaaatcattaac 226
             |||||||||||||||||||||
Sbjct: 51554 acataaaataaaatcattaac 51534
to top
>gb|AC011493.5| Homo sapiens chromosome 19 clone CTB-28I9, complete sequence
          Length = 117549

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 451   ttcccattcccatatacggca 471
             |||||||||||||||||||||
Sbjct: 83293 ttcccattcccatatacggca 83313
to top
>emb|BX942820.7| Zebrafish DNA sequence from clone CH211-222L23 in linkage group 18,
             complete sequence
          Length = 114084

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 208   ataaaataaaatcattaacct 228
             |||||||||||||||||||||
Sbjct: 81203 ataaaataaaatcattaacct 81183
to top
>gb|AC158674.10| Mus musculus 6 BAC RP23-54E12 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 211124

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 206    acataaaataaaatcattaac 226
              |||||||||||||||||||||
Sbjct: 126131 acataaaataaaatcattaac 126111
to top
>gb|AC069462.3| Homo sapiens chromosome 3 clone RP11-271E2 map 3p, complete sequence
          Length = 161577

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1     acaacccaaaccataatatat 21
             |||||||||||||||||||||
Sbjct: 85044 acaacccaaaccataatatat 85064
to top
>gb|AC117771.17| Mus musculus chromosome 1, clone RP24-512A5, complete sequence
          Length = 161292

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 205   tacataaaataaaatcattaa 225
             |||||||||||||||||||||
Sbjct: 45706 tacataaaataaaatcattaa 45726
to top
>emb|AL133453.3|CNS01DV4 Human chromosome 14 DNA sequence BAC R-841O20 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 212103

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 218   atcattaacctcctgatataa 238
             |||||||||||||||||||||
Sbjct: 51639 atcattaacctcctgatataa 51659
to top
>emb|AL844840.8| Mouse DNA sequence from clone RP23-337P9 on chromosome 2, complete
              sequence
          Length = 219568

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 203    tgtacataaaataaaatcatt 223
              |||||||||||||||||||||
Sbjct: 173220 tgtacataaaataaaatcatt 173240
to top
>gb|AC004518.1|AC004518 Homo sapiens chromosome 14, BAC CITB-135H17  containing the RAD51L1
             gene, complete sequence
          Length = 123661

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 121   ccttatgtaccttatttatccaaca 145
             ||||||||||||||||||| |||||
Sbjct: 59880 ccttatgtaccttatttattcaaca 59856
to top
>emb|AL589168.3|CNS07EG1 Human chromosome 14 DNA sequence BAC R-108B17 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 149805

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 121   ccttatgtaccttatttatccaaca 145
             ||||||||||||||||||| |||||
Sbjct: 75644 ccttatgtaccttatttattcaaca 75668
to top
>gb|AC115818.9| Mus musculus chromosome 1, clone RP23-433A12, complete sequence
          Length = 186895

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 206    acataaaataaaatcattaa 225
              ||||||||||||||||||||
Sbjct: 122947 acataaaataaaatcattaa 122928
to top
>gb|AC107769.7| Mus musculus chromosome 16, clone RP23-130N20, complete sequence
          Length = 192682

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 206    acataaaataaaatcattaa 225
              ||||||||||||||||||||
Sbjct: 190569 acataaaataaaatcattaa 190588
to top
>emb|BX546457.1| Human DNA sequence from clone RP11-29O12 on chromosome 1 Contains part
             of a novel gene (FLJ31487), complete sequence
          Length = 69971

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     ccaaaccataatatattaca 25
             ||||||||||||||||||||
Sbjct: 10254 ccaaaccataatatattaca 10273
to top
>emb|AL359710.15| Human DNA sequence from clone RP11-30L7 on chromosome 9 Contains part
             of a novel gene, the 5' end of the NR4A3 gene for nuclear
             receptor subfamily 4 group A, member 3 and two CpG
             islands, complete sequence
          Length = 174140

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 16    atatattacaacacatatactttt 39
             ||||||||||||||||||| ||||
Sbjct: 29943 atatattacaacacatatattttt 29966
to top
>emb|AL358237.13| Human DNA sequence from clone RP3-407G6 on chromosome 20 Contains part
             of a novel gene (LOC284757), complete sequence
          Length = 47850

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 210   aaaataaaatcattaacctcctga 233
             |||| |||||||||||||||||||
Sbjct: 47599 aaaaaaaaatcattaacctcctga 47622
to top
>gb|AC016885.16| Homo sapiens chromosome 8, clone RP11-388K12, complete sequence
          Length = 210008

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 47   aatgtacagtacatatactt 66
            ||||||||||||||||||||
Sbjct: 6507 aatgtacagtacatatactt 6488
to top
>gb|AC157787.6| Mus musculus chromosome 1, clone RP23-158A6, complete sequence
          Length = 199981

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   acataaaataaaatcattaa 225
             ||||||||||||||||||||
Sbjct: 35128 acataaaataaaatcattaa 35147
to top
>gb|AC063948.44| Homo sapiens 12 BAC RP11-321F8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 146502

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    ttttgaaatgtacagtacat 60
             ||||||||||||||||||||
Sbjct: 58192 ttttgaaatgtacagtacat 58173
to top
>gb|AF503628.1| Homo sapiens prostate apoptosis response protein PAR-4 gene, promoter
            region, 5'UTR and partial cds
          Length = 5935

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 25   aacacatatacttttctttt 44
            ||||||||||||||||||||
Sbjct: 1867 aacacatatacttttctttt 1848
to top
>gb|AC164663.5| Mus musculus 10 BAC RP23-44F24 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 192449

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    aacacatatacttttctttt 44
             ||||||||||||||||||||
Sbjct: 95945 aacacatatacttttctttt 95964
to top
>emb|AL929355.1|PFA929355 Plasmodium falciparum strain 3D7, chromosome 9; segment 1/5
          Length = 330050

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 204    gtacataaaataaaatcatt 223
              ||||||||||||||||||||
Sbjct: 308186 gtacataaaataaaatcatt 308205
to top
>emb|AL161592.2|ATCHRIV88 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 88
          Length = 198493

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   cttatttatccaacatcatc 150
             ||||||||||||||||||||
Sbjct: 14098 cttatttatccaacatcatc 14117
to top
>emb|AL035709.1|ATT28I19 Arabidopsis thaliana DNA chromosome 4, BAC clone T28I19 (ESSA project)
          Length = 110766

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   cttatttatccaacatcatc 150
             ||||||||||||||||||||
Sbjct: 10396 cttatttatccaacatcatc 10415
to top
>emb|CR388046.14| Zebrafish DNA sequence from clone DKEY-50E6 in linkage group 7, complete
              sequence
          Length = 211210

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 42     tttgaaatgtacagtacata 61
              ||||||||||||||||||||
Sbjct: 176953 tttgaaatgtacagtacata 176972
to top
>gb|AC027449.6| Homo sapiens chromosome 18, clone RP11-535A5, complete sequence
          Length = 149660

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    ttttgaaatgtacagtacat 60
             ||||||||||||||||||||
Sbjct: 36206 ttttgaaatgtacagtacat 36187
to top
>gb|AC022825.9| Homo sapiens chromosome 8, clone RP11-88J22, complete sequence
          Length = 191772

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     aatgtacagtacatatactt 66
              ||||||||||||||||||||
Sbjct: 171027 aatgtacagtacatatactt 171008
to top
>gb|AC135795.21| Medicago truncatula clone mth2-28g10, complete sequence
          Length = 110937

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 47    aatgtacagtacatatacttatta 70
             ||||||||||||||||| ||||||
Sbjct: 22690 aatgtacagtacatatagttatta 22713
to top
>gb|AC154607.2| Mus musculus BAC clone RP23-331D17 from chromosome 16, complete sequence
          Length = 202496

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 206    acataaaataaaatcattaa 225
              ||||||||||||||||||||
Sbjct: 186066 acataaaataaaatcattaa 186047
to top
>gb|AC093560.2| Homo sapiens chromosome 1 clone RP11-398H19, complete sequence
          Length = 199594

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 40     cttttgaaatgtacagtaca 59
              ||||||||||||||||||||
Sbjct: 183485 cttttgaaatgtacagtaca 183504
to top
>gb|AC023170.10| Homo sapiens chromosome 10 clone RP11-373P23, complete sequence
          Length = 195448

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    ttttgaaatgtacagtacat 60
             ||||||||||||||||||||
Sbjct: 43439 ttttgaaatgtacagtacat 43458
to top
>gb|AC073569.26| Homo sapiens 12 BAC RP11-530C5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 177734

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    aacacatatacttttctttt 44
             ||||||||||||||||||||
Sbjct: 43842 aacacatatacttttctttt 43861
to top
>gb|AC093677.4| Homo sapiens BAC clone RP11-629B11 from 4, complete sequence
          Length = 148179

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   agttgtacataaaataaaat 219
             ||||||||||||||||||||
Sbjct: 72021 agttgtacataaaataaaat 72040
to top
>gb|AC022360.23| Homo sapiens 8 BAC RP11-58O3 (Roswell Park Cancer Institute Human BAC
            Library) complete sequence
          Length = 171991

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 41   ttttgaaatgtacagtacat 60
            ||||||||||||||||||||
Sbjct: 9642 ttttgaaatgtacagtacat 9661
to top
>gb|AC150889.3| Medicago truncatula chromosome 7 BAC clone mte1-61j12, complete
            sequence
          Length = 116517

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 47   aatgtacagtacatatacttatta 70
            ||||||||||||||||| ||||||
Sbjct: 1473 aatgtacagtacatatagttatta 1450
to top
>emb|BX296537.10| Zebrafish DNA sequence from clone CH211-249G3 in linkage group 2,
             complete sequence
          Length = 153636

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 43    ttgaaatgtacagtacatat 62
             ||||||||||||||||||||
Sbjct: 78948 ttgaaatgtacagtacatat 78929
to top
>tpg|BK000438.1| TPA: TPA_exp: Homo sapiens RING finger protein COP1 gene, complete cds
          Length = 421987

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     aatgtacagtacatatactt 66
              ||||||||||||||||||||
Sbjct: 253361 aatgtacagtacatatactt 253342
to top
>gb|AC084277.3| Homo sapiens BAC clone RP11-68O1 from 4, complete sequence
          Length = 150705

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 199    tagttgtacataaaataaaa 218
              ||||||||||||||||||||
Sbjct: 133808 tagttgtacataaaataaaa 133789
to top
>gb|AC051630.4|AC051630 Arabidopsis thaliana chromosome 1 BAC F10C21 genomic sequence, complete
             sequence
          Length = 97242

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 194   tcttatagttgtacataaaa 213
             ||||||||||||||||||||
Sbjct: 71034 tcttatagttgtacataaaa 71015
to top
>gb|AC018682.4| Homo sapiens BAC clone RP11-417F21 from 2, complete sequence
          Length = 181405

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   acataaaataaaatcattaa 225
             ||||||||||||||||||||
Sbjct: 70326 acataaaataaaatcattaa 70345
to top
>gb|AC066690.6|AC066690 Arabidopsis thaliana chromosome 1 BAC F3A14 genomic sequence, complete
             sequence
          Length = 24146

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    aacacatatacttttctttt 44
             ||||||||||||||||||||
Sbjct: 22162 aacacatatacttttctttt 22143
to top
>gb|AC069556.4|AC069556 Genomic Sequence For Arabidopsis thaliana Clone T1G16 From Chromosome
             V, complete sequence
          Length = 93672

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    aacacatatacttttctttt 44
             ||||||||||||||||||||
Sbjct: 29561 aacacatatacttttctttt 29580
to top
>gb|AC020646.2|AC020646 Genomic sequence for Arabidopsis thaliana BAC T32E20 from chromosome
            I, complete sequence
          Length = 103931

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 25   aacacatatacttttctttt 44
            ||||||||||||||||||||
Sbjct: 7746 aacacatatacttttctttt 7727
to top
>gb|AC007505.4|AC007505 Arabidopsis thaliana chromosome I BAC F28L22 genomic sequence, complete
              sequence
          Length = 134499

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     aacacatatacttttctttt 44
              ||||||||||||||||||||
Sbjct: 120128 aacacatatacttttctttt 120109
to top
>gb|AC005058.1|AC005058 Homo sapiens BAC clone CTB-54D4 from 7q31, complete sequence
          Length = 182256

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 502   ccaaatatgacagtgttatc 521
             ||||||||||||||||||||
Sbjct: 49958 ccaaatatgacagtgttatc 49977
to top
>emb|BX284684.8| Zebrafish DNA sequence from clone DKEY-14I10 in linkage group 8,
             complete sequence
          Length = 163766

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 31    tatacttttcttttgaaatg 50
             ||||||||||||||||||||
Sbjct: 75490 tatacttttcttttgaaatg 75509
to top
>emb|AL355101.2|CNS05TCK Human chromosome 14 DNA sequence BAC R-686H21 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 164380

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     acaacccaaaccataatata 20
             ||||||||||||||||||||
Sbjct: 55461 acaacccaaaccataatata 55480
to top
>gb|AC167700.2| Reniera sp. JGI-2005 clone JGIBAYC-5J13, complete sequence
          Length = 39670

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 200   agttgtacataaaataaaatcatt 223
             ||||| ||||||||||||||||||
Sbjct: 35446 agttgaacataaaataaaatcatt 35469
to top
>emb|AL590723.13| Human DNA sequence from clone RP11-492I21 on chromosome 1 Contains part
             of the gene for constitutive photomorphogenic protein
             (COP1) and a novel gene, complete sequence
          Length = 178223

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    aatgtacagtacatatactt 66
             ||||||||||||||||||||
Sbjct: 89209 aatgtacagtacatatactt 89228
to top
>emb|AL035605.1|ATF19F18 Arabidopsis thaliana DNA chromosome 4, BAC clone  F19F18 (ESSA project)
          Length = 91740

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   cttatttatccaacatcatc 150
             ||||||||||||||||||||
Sbjct: 82015 cttatttatccaacatcatc 82034
to top
>gb|AC135019.3| Mus musculus BAC clone RP23-186D15 from 10, complete sequence
          Length = 189457

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   acataaaataaaatcattaa 225
             ||||||||||||||||||||
Sbjct: 69140 acataaaataaaatcattaa 69159
to top
>emb|AL672307.9| Mouse DNA sequence from clone RP23-141N2 on chromosome 2, complete
              sequence
          Length = 206168

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 206    acataaaataaaatcattaa 225
              ||||||||||||||||||||
Sbjct: 103000 acataaaataaaatcattaa 103019
to top
>emb|AL596246.10| Mouse DNA sequence from clone RP23-186E14 on chromosome 11, complete
             sequence
          Length = 144136

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    ttttgaaatgtacagtacat 60
             ||||||||||||||||||||
Sbjct: 36108 ttttgaaatgtacagtacat 36089
to top
>gb|AY035396.1| Escherichia coli O91 O-antigen gene cluster, complete sequence
          Length = 10196

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 59   atatacttattattacaacg 78
            ||||||||||||||||||||
Sbjct: 1272 atatacttattattacaacg 1291
to top
>dbj|AB030580.1| Homo sapiens DNA, breakpoint of inv(11)(q13,q25), cosmid clone CL1005
          Length = 30037

 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 41   ttttgaaatgtacagtacat 60
            ||||||||||||||||||||
Sbjct: 6174 ttttgaaatgtacagtacat 6155


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,467,819
Number of Sequences: 3902068
Number of extensions: 6467819
Number of successful extensions: 121167
Number of sequences better than 10.0: 68
Number of HSP's better than 10.0 without gapping: 68
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 120988
Number of HSP's gapped (non-prelim): 179
length of query: 521
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 498
effective length of database: 17,143,297,704
effective search space: 8537362256592
effective search space used: 8537362256592
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top