ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbart55b05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY987028.1| Triticum aestivum dehydration-induced protein mRN... 133 3e-28
2emb|BX571829.7| Zebrafish DNA sequence from clone DKEY-256M7 in ... 44 0.25
3dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 44 0.25
4gb|AF065159.3|AF065159 Bradyrhizobium japonicum putative arylsul... 44 0.25
5gb|AC104613.2| Drosophila melanogaster clone BACR06K07, complete... 42 0.97
6gb|CP000316.1| Polaromonas sp. JS666, complete genome 42 0.97
7emb|AL593857.10| Mouse DNA sequence from clone RP23-439H2 on chr... 42 0.97
8gb|AC008233.3|AC008233 Drosophila melanogaster, chromosome 2L, r... 42 0.97
9gb|AE003608.5| Drosophila melanogaster chromosome 2L, section 17... 42 0.97
10gb|AC005750.1|AC005750 Drosophila melanogaster DNA sequence (P1s... 42 0.97
11gb|AC167143.2| Mus musculus BAC clone RP23-38J9 from chromosome ... 40 3.8
12gb|DP000017.1| Sus scrofa target 1 genomic scaffold 40 3.8
13gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence 40 3.8
14gb|AC103580.4| Trypanosoma brucei chromosome 4 clone RPCI93-5E12... 40 3.8
15gb|AC113988.8| Mus musculus chromosome 3, clone RP24-129H9, comp... 40 3.8
16ref|XM_613039.2| PREDICTED: Bos taurus complement receptor type ... 40 3.8
17gb|AC087160.2| Sus scrofa clone RP44-418J7, complete sequence 40 3.8
18gb|AE017244.1| Mycoplasma hyopneumoniae 7448, complete genome 40 3.8
19gb|AE017243.1| Mycoplasma hyopneumoniae J, complete genome 40 3.8
20gb|AC115298.6| Mus musculus BAC clone RP23-224G24 from X, comple... 40 3.8
21gb|AC124605.4| Mus musculus BAC clone RP23-82A23 from 3, complet... 40 3.8
22gb|AC122857.2| Mus musculus BAC clone RP23-125A8 from 2, complet... 40 3.8
23gb|AC113276.9| Mus musculus chromosome 5, clone RP23-383E21, com... 40 3.8
24gb|AY333070.1| Drosophila virilis antennapedia (Antp), CG10013 (... 40 3.8
25emb|BX942828.16| Zebrafish DNA sequence from clone CH211-237F16 ... 40 3.8
26emb|AL354821.21| Human DNA sequence from clone RP11-538N17 on ch... 40 3.8
27emb|AL133229.40| Human DNA sequence from clone RP5-1167E19 on ch... 40 3.8
28emb|BX571662.1| Wolinella succinogenes, complete genome; segment... 40 3.8
29emb|AL596207.10| Mouse DNA sequence from clone RP23-336J1 on chr... 40 3.8
30emb|CR391994.10| Zebrafish DNA sequence from clone DKEY-239B22, ... 40 3.8
31emb|AL663042.5| Mouse DNA sequence from clone RP23-400P12 on chr... 40 3.8
32gb|AF086643.2| Mycoplasma hyopneumoniae outer membrane protein g... 40 3.8
33gb|AC079845.31| Mus musculus clone rp23-461a12, complete sequence 40 3.8
34gb|AC021231.8| Homo sapiens chromosome , clone RP11-323I15, comp... 40 3.8
35dbj|AK165034.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 40 3.8
36gb|AC157894.3| Medicago truncatula chromosome 7 BAC clone mth2-8... 40 3.8
37gb|AC102947.13| Homo sapiens chromosome 17, clone CTD-2179N1, co... 40 3.8
38gb|AC109327.10| Homo sapiens chromosome 17, clone RP11-93C20, co... 40 3.8
39gb|AC120024.22| Homo sapiens chromosome 17, clone CTD-2526A2, co... 40 3.8
40emb|BX004813.5| Zebrafish DNA sequence from clone CH211-55K22 in... 40 3.8
41gb|AC154173.3| Mus musculus BAC clone RP23-3C4 from 3, complete ... 40 3.8
42gb|AC156558.1| Mus musculus BAC clone RP24-531M24 from 12, compl... 40 3.8
43emb|BX005306.20| Zebrafish DNA sequence from clone DKEY-78C7 in ... 40 3.8
44emb|BX510336.6| Zebrafish DNA sequence from clone CH211-198D13 i... 40 3.8
45emb|AL929117.7| Mouse DNA sequence from clone RP23-442K5 on chro... 40 3.8
46gb|AC079832.18| Mus musculus strain C57BL/6J chromosome 3 clone ... 40 3.8
47gb|AC073946.23| Mus musculus strain C57BL/6J chromosome 8 clone ... 40 3.8
48gb|AE017332.1| Mycoplasma hyopneumoniae 232, complete genome 40 3.8
49emb|AL928914.15| Mouse DNA sequence from clone RP23-399J8 on chr... 40 3.8
50gb|AC003101.1|AC003101 Homo sapiens chromosome 17, clone HRPC41C... 40 3.8
51gb|AC124593.4| Mus musculus BAC clone RP23-10D15 from 3, complet... 40 3.8
52emb|AL662931.10| Mouse DNA sequence from clone RP23-24M17 on chr... 40 3.8
53emb|AL807773.7| Mouse DNA sequence from clone RP23-228L24 on chr... 40 3.8
54gb|AC160130.2| Mus musculus BAC clone RP23-254K13 from chromosom... 40 3.8
55emb|AL929244.8| Mouse DNA sequence from clone RP23-456L5 on chro... 40 3.8
56emb|AL606917.12| Mouse DNA sequence from clone RP23-25K8 on chro... 40 3.8 
>gb|AY987028.1| Triticum aestivum dehydration-induced protein mRNA, complete cds
          Length = 1075

 Score =  133 bits (67), Expect = 3e-28
 Identities = 115/129 (89%), Gaps = 4/129 (3%)
 Strand = Plus / Minus

                                                                        
Query: 32   tttttccagttagtcaatcttggtagtagtacatagtagcaatctctgttcgtacaagct 91
            |||||||||| ||||||||||   |||| ||||||||| ||||||||| |||||||||||
Sbjct: 1043 tttttccagtaagtcaatctt---agtactacatagtaacaatctctggtcgtacaagct 987

                                                                        
Query: 92   aaataaaacctatgctctgttcgacgtatttttctggtttttcatttcgacccgaactac 151
            ||| | |||||||| |||| ||||||||||||| ||| ||| ||||||||||||||||||
Sbjct: 986  aaaaagaacctatgatctgctcgacgtatttttttgg-tttccatttcgacccgaactac 928

                     
Query: 152  aaagaatta 160
            |||||||||
Sbjct: 927  aaagaatta 919



 Score = 46.1 bits (23), Expect = 0.062
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 188 cactgcttactacacacacaaacacac 214
           |||||||||||||||||||| ||||||
Sbjct: 874 cactgcttactacacacacacacacac 848
to top
>emb|BX571829.7| Zebrafish DNA sequence from clone DKEY-256M7 in linkage group 12,
             complete sequence
          Length = 196942

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 195   tactacacacacaaacacacgc 216
             ||||||||||||||||||||||
Sbjct: 48084 tactacacacacaaacacacgc 48063
to top
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 234     cacgatcatcaccatcacggcc 255
               ||||||||||||||||||||||
Sbjct: 5601158 cacgatcatcaccatcacggcc 5601137
to top
>gb|AF065159.3|AF065159 Bradyrhizobium japonicum putative arylsulfatase (arsA), putative
             soluble lytic transglycosylase precursor (sltA),
             dihydrodipicolinate synthase (dapA), MscL (mscL), SmpB
             (smpB), BcpB (bcpB), RnpO (rnpO), RelA/SpoT homolog
             (relA), PdxJ (pdxJ), and acyl carrier protein synthase
             AcpS (acpS) genes, complete cds; prokaryotic type I signal
             peptidase SipF (sipF) gene, sipF-sipS allele, complete
             cds; RNase III (rnc), GTP-binding protein Era (era),
             hypothetical protein, recO-like protein, topoisomerase II
             (gyrA), putative ABC transporter, putative
             GMC-oxidoreductase, hypothetical protein, putative
             cytochrome C binding protein (cyc4), putative polytopic
             integral membrane protein, superoxide dismutase SodM-like
             protein, putative inner membrane protein, AttM-like
             protein (attM), adenylate cyclases-like protein, and
             putative inner membrane protein (spcT) genes, complete
             cds; and unknown genes
          Length = 35209

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 234   cacgatcatcaccatcacggcc 255
             ||||||||||||||||||||||
Sbjct: 29236 cacgatcatcaccatcacggcc 29257
to top
>gb|AC104613.2| Drosophila melanogaster clone BACR06K07, complete sequence
          Length = 152934

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 119    atttttctggtttttcatttcgacc 143
              ||||||||||||| |||||||||||
Sbjct: 127991 atttttctggtttctcatttcgacc 127967
to top
>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 233    acacgatcatcaccatcacgg 253
              |||||||||||||||||||||
Sbjct: 509476 acacgatcatcaccatcacgg 509496
to top
>emb|AL593857.10| Mouse DNA sequence from clone RP23-439H2 on chromosome 2, complete
             sequence
          Length = 206452

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 194   ttactacacacacaaacacac 214
             |||||||||||||||||||||
Sbjct: 18672 ttactacacacacaaacacac 18652
to top
>gb|AC008233.3|AC008233 Drosophila melanogaster, chromosome 2L, region 25C-25C, BAC clone
              BACR13M11, complete sequence
          Length = 162387

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 119    atttttctggtttttcatttcgacc 143
              ||||||||||||| |||||||||||
Sbjct: 161035 atttttctggtttctcatttcgacc 161059
to top
>gb|AE003608.5| Drosophila melanogaster chromosome 2L, section 17 of 83 of the complete
              sequence
          Length = 174887

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 119    atttttctggtttttcatttcgacc 143
              ||||||||||||| |||||||||||
Sbjct: 163308 atttttctggtttctcatttcgacc 163332
to top
>gb|AC005750.1|AC005750 Drosophila melanogaster DNA sequence (P1s DS03979 (D283) and DS01272
             (D284)), complete sequence
          Length = 102516

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 119   atttttctggtttttcatttcgacc 143
             ||||||||||||| |||||||||||
Sbjct: 75792 atttttctggtttctcatttcgacc 75768
to top
>gb|AC167143.2| Mus musculus BAC clone RP23-38J9 from chromosome 3, complete sequence
          Length = 187770

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   tactacacacacaaacacac 214
             ||||||||||||||||||||
Sbjct: 69422 tactacacacacaaacacac 69403
to top
>gb|DP000017.1| Sus scrofa target 1 genomic scaffold
          Length = 1471440

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 85     acaagctaaataaaacctat 104
              ||||||||||||||||||||
Sbjct: 765032 acaagctaaataaaacctat 765013
to top
>gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence
          Length = 1590432

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 196    actacacacacaaacacacg 215
              ||||||||||||||||||||
Sbjct: 286034 actacacacacaaacacacg 286053
to top
>gb|AC103580.4| Trypanosoma brucei chromosome 4 clone RPCI93-5E12, complete sequence
          Length = 174832

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 196   actacacacacaaacacacg 215
             ||||||||||||||||||||
Sbjct: 45861 actacacacacaaacacacg 45842
to top
>gb|AC113988.8| Mus musculus chromosome 3, clone RP24-129H9, complete sequence
          Length = 181881

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 193   cttactacacacacaaacac 212
             ||||||||||||||||||||
Sbjct: 33301 cttactacacacacaaacac 33320
to top
>ref|XM_613039.2| PREDICTED: Bos taurus complement receptor type 2 (cd21), mRNA
          Length = 4038

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 85   acaagctaaataaaacctat 104
            ||||||||||||||||||||
Sbjct: 3323 acaagctaaataaaacctat 3342
to top
>gb|AC087160.2| Sus scrofa clone RP44-418J7, complete sequence
          Length = 166651

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    acaagctaaataaaacctat 104
             ||||||||||||||||||||
Sbjct: 87272 acaagctaaataaaacctat 87253
to top
>gb|AE017244.1| Mycoplasma hyopneumoniae 7448, complete genome
          Length = 920079

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    atttttctggtttttcattt 138
              ||||||||||||||||||||
Sbjct: 130278 atttttctggtttttcattt 130259
to top
>gb|AE017243.1| Mycoplasma hyopneumoniae J, complete genome
          Length = 897405

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    atttttctggtttttcattt 138
              ||||||||||||||||||||
Sbjct: 124996 atttttctggtttttcattt 124977
to top
>gb|AC115298.6| Mus musculus BAC clone RP23-224G24 from X, complete sequence
          Length = 184032

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 194    ttactacacacacaaacaca 213
              ||||||||||||||||||||
Sbjct: 119497 ttactacacacacaaacaca 119516
to top
>gb|AC124605.4| Mus musculus BAC clone RP23-82A23 from 3, complete sequence
          Length = 204785

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 193   cttactacacacacaaacacacgc 216
             ||||||||||||||| ||||||||
Sbjct: 24495 cttactacacacacacacacacgc 24472
to top
>gb|AC122857.2| Mus musculus BAC clone RP23-125A8 from 2, complete sequence
          Length = 221951

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 199    acacacacaaacacacgctgggat 222
              ||||||||| ||||||||||||||
Sbjct: 114124 acacacacacacacacgctgggat 114101
to top
>gb|AC113276.9| Mus musculus chromosome 5, clone RP23-383E21, complete sequence
          Length = 245002

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 195    tactacacacacaaacacac 214
              ||||||||||||||||||||
Sbjct: 124122 tactacacacacaaacacac 124103
to top
>gb|AY333070.1| Drosophila virilis antennapedia (Antp), CG10013 (CG10013), CG31217
              (CG31217), and ultrabithorax (Ubx) genes, complete cds
          Length = 308092

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 195    tactacacacacaaacacac 214
              ||||||||||||||||||||
Sbjct: 145043 tactacacacacaaacacac 145062
to top
>emb|BX942828.16| Zebrafish DNA sequence from clone CH211-237F16 in linkage group 17,
             complete sequence
          Length = 125793

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   ctacacacacaaacacacgc 216
             ||||||||||||||||||||
Sbjct: 89116 ctacacacacaaacacacgc 89097
to top
>emb|AL354821.21| Human DNA sequence from clone RP11-538N17 on chromosome 13, complete
             sequence
          Length = 200087

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   tactacacacacaaacacac 214
             ||||||||||||||||||||
Sbjct: 22673 tactacacacacaaacacac 22654
to top
>emb|AL133229.40| Human DNA sequence from clone RP5-1167E19 on chromosome 20 Contains STSs,
              GSSs and a CpG island, complete sequence
          Length = 161776

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 196    actacacacacaaacacacg 215
              ||||||||||||||||||||
Sbjct: 160119 actacacacacaaacacacg 160138
to top
>emb|BX571662.1| Wolinella succinogenes, complete genome; segment 6/7
          Length = 349859

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 235   acgatcatcaccatcacggc 254
             ||||||||||||||||||||
Sbjct: 61591 acgatcatcaccatcacggc 61572
to top
>emb|AL596207.10| Mouse DNA sequence from clone RP23-336J1 on chromosome 11 Contains the 5'
              end of the Sparc gene for secreted acidic cysteine rich
              glycoprotein, the Atox1 gene for ATX1 (antioxidant protein
              1) homolog 1 (yeast), an upregulated during skeletal muscle
              growth 5 (Usmg5) pseudogene, the gene for
              Ras-GTPase-activating protein SH3-domain binding protein
              (G3bp-pending) (C87777), a novel gene, the Glra1 gene for
              glycine receptor, alpha 1 subunit, a novel gene, a
              ubiquitously expressed transcript (Uxt) pseudogene and one
              CpG island, complete sequence
          Length = 204037

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 197    ctacacacacaaacacacgc 216
              ||||||||||||||||||||
Sbjct: 117245 ctacacacacaaacacacgc 117226
to top
>emb|CR391994.10| Zebrafish DNA sequence from clone DKEY-239B22, complete sequence
          Length = 157765

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 195 tactacacacacaaacacac 214
           ||||||||||||||||||||
Sbjct: 325 tactacacacacaaacacac 344
to top
>emb|AL663042.5| Mouse DNA sequence from clone RP23-400P12 on chromosome 11 Contains two
             NACHT, leucine rich repeat and PYD containing 1 (NALP1)
             pseudogenes, complete sequence
          Length = 153021

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 199   acacacacaaacacacgctg 218
             ||||||||||||||||||||
Sbjct: 65696 acacacacaaacacacgctg 65677
to top
>gb|AF086643.2| Mycoplasma hyopneumoniae outer membrane protein gene, complete cds;
            and unknown gene
          Length = 4302

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 119  atttttctggtttttcattt 138
            ||||||||||||||||||||
Sbjct: 1930 atttttctggtttttcattt 1911
to top
>gb|AC079845.31| Mus musculus clone rp23-461a12, complete sequence
          Length = 206117

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 193    cttactacacacacaaacac 212
              ||||||||||||||||||||
Sbjct: 192964 cttactacacacacaaacac 192983
to top
>gb|AC021231.8| Homo sapiens chromosome , clone RP11-323I15, complete sequence
          Length = 185062

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 119    atttttctggtttttcattt 138
              ||||||||||||||||||||
Sbjct: 101852 atttttctggtttttcattt 101871
to top
>dbj|AK165034.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
            library, clone:E130310D01 product:methionyl
            aminopeptidase 1, full insert sequence
          Length = 3709

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 193  cttactacacacacaaacac 212
            ||||||||||||||||||||
Sbjct: 2311 cttactacacacacaaacac 2292
to top
>gb|AC157894.3| Medicago truncatula chromosome 7 BAC clone mth2-85d15, complete
             sequence
          Length = 127331

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    tagtacatagtagcaatctc 77
             ||||||||||||||||||||
Sbjct: 12691 tagtacatagtagcaatctc 12672
to top
>gb|AC102947.13| Homo sapiens chromosome 17, clone CTD-2179N1, complete sequence
          Length = 52688

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   ctacacacacaaacacacgc 216
             ||||||||||||||||||||
Sbjct: 39327 ctacacacacaaacacacgc 39308
to top
>gb|AC109327.10| Homo sapiens chromosome 17, clone RP11-93C20, complete sequence
          Length = 113000

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   tactacacacacaaacacac 214
             ||||||||||||||||||||
Sbjct: 99909 tactacacacacaaacacac 99890
to top
>gb|AC120024.22| Homo sapiens chromosome 17, clone CTD-2526A2, complete sequence
          Length = 136002

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   tactacacacacaaacacac 214
             ||||||||||||||||||||
Sbjct: 30322 tactacacacacaaacacac 30303
to top
>emb|BX004813.5| Zebrafish DNA sequence from clone CH211-55K22 in linkage group 8,
             complete sequence
          Length = 148955

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   cacacacaaacacacgctgg 219
             ||||||||||||||||||||
Sbjct: 27887 cacacacaaacacacgctgg 27906
to top
>gb|AC154173.3| Mus musculus BAC clone RP23-3C4 from 3, complete sequence
          Length = 214016

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 191    tgcttactacacacacaaacacac 214
              ||||||||||||||||| ||||||
Sbjct: 125030 tgcttactacacacacacacacac 125053
to top
>gb|AC156558.1| Mus musculus BAC clone RP24-531M24 from 12, complete sequence
          Length = 161831

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 198   tacacacacaaacacacgct 217
             ||||||||||||||||||||
Sbjct: 54480 tacacacacaaacacacgct 54499
to top
>emb|BX005306.20| Zebrafish DNA sequence from clone DKEY-78C7 in linkage group 20, complete
              sequence
          Length = 135228

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 200    cacacacaaacacacgctgg 219
              ||||||||||||||||||||
Sbjct: 116894 cacacacaaacacacgctgg 116913
to top
>emb|BX510336.6| Zebrafish DNA sequence from clone CH211-198D13 in linkage group 20,
              complete sequence
          Length = 187683

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 199    acacacacaaacacacgctg 218
              ||||||||||||||||||||
Sbjct: 148348 acacacacaaacacacgctg 148329
to top
>emb|AL929117.7| Mouse DNA sequence from clone RP23-442K5 on chromosome 2, complete
             sequence
          Length = 161940

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   tactacacacacaaacacac 214
             ||||||||||||||||||||
Sbjct: 10478 tactacacacacaaacacac 10459
to top
>gb|AC079832.18| Mus musculus strain C57BL/6J chromosome 3 clone rp23-393j8, complete
              sequence
          Length = 194354

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 193    cttactacacacacaaacac 212
              ||||||||||||||||||||
Sbjct: 192797 cttactacacacacaaacac 192816
to top
>gb|AC073946.23| Mus musculus strain C57BL/6J chromosome 8 clone rp23-218e4, complete
              sequence
          Length = 196558

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 199    acacacacaaacacacgctg 218
              ||||||||||||||||||||
Sbjct: 103785 acacacacaaacacacgctg 103766
to top
>gb|AE017332.1| Mycoplasma hyopneumoniae 232, complete genome
          Length = 892758

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 119    atttttctggtttttcattt 138
              ||||||||||||||||||||
Sbjct: 317068 atttttctggtttttcattt 317087
to top
>emb|AL928914.15| Mouse DNA sequence from clone RP23-399J8 on chromosome 2, complete
              sequence
          Length = 199873

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 199    acacacacaaacacacgctgggat 222
              ||||||||| ||||||||||||||
Sbjct: 155682 acacacacacacacacgctgggat 155659
to top
>gb|AC003101.1|AC003101 Homo sapiens chromosome 17, clone HRPC41C23, complete sequence
          Length = 208396

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 199    acacacacaaacacacgctg 218
              ||||||||||||||||||||
Sbjct: 192777 acacacacaaacacacgctg 192796
to top
>gb|AC124593.4| Mus musculus BAC clone RP23-10D15 from 3, complete sequence
          Length = 187362

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 193    cttactacacacacaaacacacgc 216
              ||||||||||||||| ||||||||
Sbjct: 175354 cttactacacacacacacacacgc 175331
to top
>emb|AL662931.10| Mouse DNA sequence from clone RP23-24M17 on chromosome X, complete
            sequence
          Length = 175639

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 195  tactacacacacaaacacac 214
            ||||||||||||||||||||
Sbjct: 6020 tactacacacacaaacacac 6039
to top
>emb|AL807773.7| Mouse DNA sequence from clone RP23-228L24 on chromosome X, complete
              sequence
          Length = 186645

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 83     gtacaagctaaataaaacct 102
              ||||||||||||||||||||
Sbjct: 169279 gtacaagctaaataaaacct 169298
to top
>gb|AC160130.2| Mus musculus BAC clone RP23-254K13 from chromosome 12, complete sequence
          Length = 177970

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 198    tacacacacaaacacacgct 217
              ||||||||||||||||||||
Sbjct: 168649 tacacacacaaacacacgct 168668
to top
>emb|AL929244.8| Mouse DNA sequence from clone RP23-456L5 on chromosome 2, complete
             sequence
          Length = 86351

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   tactacacacacaaacacac 214
             ||||||||||||||||||||
Sbjct: 80058 tactacacacacaaacacac 80039
to top
>emb|AL606917.12| Mouse DNA sequence from clone RP23-25K8 on chromosome 4, complete
             sequence
          Length = 52163

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 195   tactacacacacaaacacac 214
             ||||||||||||||||||||
Sbjct: 43735 tactacacacacaaacacac 43754


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,063,913
Number of Sequences: 3902068
Number of extensions: 3063913
Number of successful extensions: 180275
Number of sequences better than 10.0: 56
Number of HSP's better than 10.0 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 180006
Number of HSP's gapped (non-prelim): 268
length of query: 293
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 271
effective length of database: 17,147,199,772
effective search space: 4646891138212
effective search space used: 4646891138212
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top