>emb|X56803.1|TAMRNAU T.aestivum L. mRNA for ubiquitin
          Length = 436

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 163 ttgtgagcccagagacataagcagctccatggcca 197
           |||||| |||||||||| |||||||||||||||||
Sbjct: 276 ttgtgaacccagagacagaagcagctccatggcca 242

>emb|X56601.1|TAUBIQU Wheat mRNA for ubiquitin
          Length = 436

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 163 ttgtgagcccagagacataagcagctccatggcca 197
           |||||| |||||||||| |||||||||||||||||
Sbjct: 276 ttgtgaacccagagacagaagcagctccatggcca 242

>gb|DQ086482.1| Triticum aestivum ubiquitin (Ubiq) mRNA, partial cds
          Length = 400

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 163 ttgtgagcccagagacataagcagctccatggcca 197
           |||||| |||||||||| |||||||||||||||||
Sbjct: 257 ttgtgaacccagagacagaagcagctccatggcca 223

>emb|CT030652.14| Mouse DNA sequence from clone RP23-48G20 on chromosome 17, complete
              sequence
          Length = 221351

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 38     atctgctgcaccacagaaattc 59
              ||||||||||||||||||||||
Sbjct: 119298 atctgctgcaccacagaaattc 119277

>emb|AL138721.16| Human DNA sequence from clone RP11-174N3 on chromosome 6 Contains the 3'
              end of gene KIAA0229 for a novel Ank, SAM (Sterile alpha
              motif) and Phosphotyrosine interaction (PTB/PID) domain
              containing protein, the TCP11 gene for t-complex 11 (mouse)
              and two CpG islands, complete sequence
          Length = 155539

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      cttattcattcattccacag 28
              ||||||||||||||||||||
Sbjct: 151535 cttattcattcattccacag 151554

>gb|AC026366.20| Homo sapiens 12 BAC RP11-139O18 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 164429

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    tattcattcattccacagtt 30
             ||||||||||||||||||||
Sbjct: 96285 tattcattcattccacagtt 96304

>gb|AC073596.40| Homo sapiens 12 BAC RP11-385C6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 203395

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     tattcattcattccacagtt 30
              ||||||||||||||||||||
Sbjct: 114407 tattcattcattccacagtt 114388

>emb|AL772198.14| Zebrafish DNA sequence from clone CH211-194D6 in linkage group 9,
             complete sequence
          Length = 211682

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     gcccacttattcattcattc 23
             ||||||||||||||||||||
Sbjct: 41374 gcccacttattcattcattc 41355

>emb|AL133467.4|CNS01DV7 Human chromosome 14 DNA sequence BAC R-1070N10 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 210791

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 8      acttattcattcattccaca 27
              ||||||||||||||||||||
Sbjct: 143332 acttattcattcattccaca 143313


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,988,472
Number of Sequences: 3902068
Number of extensions: 1988472
Number of successful extensions: 173563
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 173535
Number of HSP's gapped (non-prelim): 28
length of query: 201
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 179
effective length of database: 17,147,199,772
effective search space: 3069348759188
effective search space used: 3069348759188
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)