Clone Information

BLAST Search Result

Clone Name	rbart54g02
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	emb\|AL157405.10\| Human DNA sequence from clone RP1-19K8 on chrom...	50	0.006
2	emb\|AL844187.13\| Zebrafish DNA sequence from clone DKEY-221D18 i...	48	0.025
3	emb\|BX901948.4\| Zebrafish DNA sequence from clone DKEY-187E3 in ...	48	0.025
4	emb\|BX294164.13\| Zebrafish DNA sequence from clone CH211-266D19 ...	46	0.097
5	emb\|CR848664.5\| Zebrafish DNA sequence from clone CH211-169I9 in...	46	0.097
6	emb\|CR405690.6\| Zebrafish DNA sequence from clone CH211-208M13 i...	46	0.097
7	emb\|CR548631.18\| Zebrafish DNA sequence from clone CH211-117I20 ...	46	0.097
8	gb\|AC115633.4\| Mus musculus BAC clone RP24-361I15 from 16, compl...	46	0.097
9	emb\|AL807375.14\| Mouse DNA sequence from clone RP23-247H23 on ch...	46	0.097
10	gb\|AC166973.5\| Mus musculus chromosome 1, clone RP24-372J6, comp...	44	0.39
11	gb\|AC102355.13\| Mus musculus chromosome 5, clone RP23-120C8, com...	44	0.39
12	gb\|AC110194.11\| Mus musculus chromosome 7, clone RP23-238J3, com...	44	0.39
13	gb\|AC160028.9\| Mus musculus 10 BAC RP24-570M12 (Roswell Park Can...	44	0.39
14	gb\|AF541257.1\| Panopea abrupta microsatellite Pab8 sequence	44	0.39
15	gb\|AY258715.1\| Xiphophorus maculatus microsatellite Msb025 sequence	44	0.39
16	gb\|AC152451.5\| Mus musculus BAC clone RP24-309M5 from chromosome...	44	0.39
17	gb\|AC110177.19\| Mus musculus chromosome 1, clone RP24-245K23, co...	44	0.39
18	gb\|AC122234.4\| Mus musculus BAC clone RP23-138M13 from chromosom...	44	0.39
19	gb\|AC144702.2\| Danio rerio clone CH211-138D14, complete sequence	44	0.39
20	gb\|AC167018.4\| Mus musculus BAC clone RP23-354F11 from chromosom...	44	0.39
21	gb\|AC158549.8\| Mus musculus chromosome 19, clone RP24-216K4, com...	44	0.39
22	gb\|AC153919.8\| Mus musculus 10 BAC RP23-91E23 (Roswell Park Canc...	44	0.39
23	emb\|CR788230.7\| Zebrafish DNA sequence from clone DKEY-57I11 in ...	44	0.39
24	emb\|CR936405.6\| Zebrafish DNA sequence from clone DKEYP-111C12 i...	44	0.39
25	emb\|CR388016.11\| Zebrafish DNA sequence from clone DKEY-106M5 in...	44	0.39
26	emb\|CR769785.19\| Zebrafish DNA sequence from clone DKEY-1N3 in l...	44	0.39
27	emb\|CR405688.8\| Zebrafish DNA sequence from clone DKEY-262F5 in ...	44	0.39
28	emb\|CR339052.6\| Zebrafish DNA sequence from clone CH211-218E6 in...	44	0.39
29	emb\|CR394563.17\| Zebrafish DNA sequence from clone CH211-147P18,...	44	0.39
30	gb\|AC122188.4\| Mus musculus BAC clone RP23-33B7 from chromosome ...	44	0.39
31	emb\|CR536619.20\| Zebrafish DNA sequence from clone CH211-194H19 ...	44	0.39
32	gb\|AC122013.4\| Mus musculus BAC clone RP24-357P7 from chromosome...	44	0.39
33	gb\|AC125174.3\| Mus musculus BAC clone RP24-544G11 from chromosom...	44	0.39
34	emb\|CR854834.11\| Zebrafish DNA sequence from clone DKEYP-92B10 i...	44	0.39
35	gb\|AC138605.1\| Mus musculus BAC clone RP23-392L23 from chromosom...	44	0.39
36	emb\|CR318672.5\| Zebrafish DNA sequence from clone DKEYP-75H12 in...	44	0.39
37	emb\|CR735141.14\| Zebrafish DNA sequence from clone CH211-128E9 i...	44	0.39
38	emb\|CR555294.10\| Zebrafish DNA sequence from clone CH211-169P4 i...	44	0.39
39	gb\|AC073048.7\| Homo sapiens BAC clone RP11-54E21 from 7, complet...	44	0.39
40	gb\|AC159272.2\| Mus musculus BAC clone RP23-423J20 from chromosom...	44	0.39
41	gb\|AC159474.9\| Mus musculus 10 BAC RP23-28P17 (Roswell Park Canc...	44	0.39
42	emb\|CR559944.12\| Zebrafish DNA sequence from clone CH211-10D19 i...	44	0.39
43	emb\|CR339051.6\| Zebrafish DNA sequence from clone DKEY-223N8 in ...	44	0.39
44	emb\|CR382378.12\| Zebrafish DNA sequence from clone DKEYP-40G12 i...	44	0.39
45	emb\|BX537131.17\| Zebrafish DNA sequence from clone CH211-266K2 i...	44	0.39
46	emb\|BX936363.13\| Zebrafish DNA sequence from clone CH211-112P19 ...	44	0.39
47	emb\|BX928753.10\| Zebrafish DNA sequence from clone DKEY-5J3 in l...	44	0.39
48	emb\|CR352342.9\| Zebrafish DNA sequence from clone CH211-134H7 in...	44	0.39
49	emb\|Z97353.3\|HS90L6 Human DNA sequence from clone RP1-90L6 on ch...	44	0.39
50	emb\|Z82248.1\|HSN44A4 Human DNA sequence from clone LL22NC03-44A4...	44	0.39
51	emb\|BX470150.13\| Zebrafish DNA sequence from clone DKEY-164K14 i...	44	0.39
52	emb\|AL683870.15\| Human DNA sequence from clone RP11-261P4 on chr...	44	0.39
53	emb\|AL513284.12\| Human DNA sequence from clone RP11-518D3 on chr...	44	0.39
54	emb\|AL392085.12\| Human DNA sequence from clone RP11-225L6 on chr...	44	0.39
55	emb\|AL445231.8\| Human DNA sequence from clone RP11-27K13 on chro...	44	0.39
56	emb\|AL357934.29\| Human DNA sequence from clone RP11-565P9 on chr...	44	0.39
57	gb\|AC108527.6\| Rattus norvegicus 9 BAC CH230-7F11 (Children's Ho...	44	0.39
58	emb\|AL161657.22\| Human DNA sequence from clone RP11-46O3 on chro...	44	0.39
59	emb\|BX510944.11\| Zebrafish DNA sequence from clone DKEY-286H17 i...	44	0.39
60	emb\|BX927311.7\| Zebrafish DNA sequence from clone CH211-235E15 i...	44	0.39
61	emb\|AL831721.30\| Zebrafish DNA sequence from clone CH211-211O10 ...	44	0.39
62	emb\|BX547932.17\| Zebrafish DNA sequence from clone DKEY-269E10 i...	44	0.39
63	gb\|AC163627.4\| Mus musculus BAC clone RP23-341E13 from chromosom...	44	0.39
64	emb\|BX537273.16\| Zebrafish DNA sequence from clone CH211-151F2 i...	44	0.39
65	emb\|BX927328.10\| Zebrafish DNA sequence from clone CH211-10M4 in...	44	0.39
66	emb\|BX927104.11\| Zebrafish DNA sequence from clone CH211-210P22 ...	44	0.39
67	emb\|BX546489.13\| Zebrafish DNA sequence from clone CH211-258F14 ...	44	0.39
68	emb\|CR407599.9\| Zebrafish DNA sequence from clone CH211-273O22 i...	44	0.39
69	emb\|BX666059.13\| Zebrafish DNA sequence from clone DKEYP-108D9 i...	44	0.39
70	emb\|AL645747.11\| Mouse DNA sequence from clone RP23-436D9 on chr...	44	0.39
71	emb\|CR385021.12\| Zebrafish DNA sequence from clone CH211-200N15 ...	44	0.39
72	emb\|BX324134.11\| Zebrafish DNA sequence from clone DKEY-103K8 in...	44	0.39
73	emb\|BX322231.13\| Zebrafish DNA sequence from clone CH211-145C1 i...	44	0.39
74	emb\|CR361569.11\| Zebrafish DNA sequence from clone CH211-99I20 i...	44	0.39
75	gb\|AC009780.12\| Homo sapiens 12 BAC RP11-1C11 (Roswell Park Canc...	44	0.39
76	gb\|AC007834.40\| Homo sapiens 12 BAC RP11-7G5 (Roswell Park Cance...	44	0.39
77	emb\|AL929460.13\| Zebrafish DNA sequence from clone CH211-148J1 i...	44	0.39
78	gb\|AC156982.8\| Mus musculus chromosome 19, clone RP23-183N3, com...	44	0.39
79	emb\|BX470185.18\| Zebrafish DNA sequence from clone CH211-222D3 i...	44	0.39
80	emb\|CR376769.6\| Zebrafish DNA sequence from clone CH211-120K3 in...	44	0.39
81	emb\|AL929016.5\| Zebrafish DNA sequence from clone DKEY-24J9 in l...	44	0.39
82	emb\|BX276181.15\| Zebrafish DNA sequence from clone CH211-247O20 ...	44	0.39
83	emb\|BX465851.5\| Zebrafish DNA sequence from clone CH211-215H21 i...	44	0.39
84	gb\|AC184103.1\| Mus musculus chromosome UNK clone CH35-73N5, comp...	44	0.39
85	emb\|BX927196.10\| Zebrafish DNA sequence from clone DKEY-121D19 i...	44	0.39
86	emb\|BX957346.14\| Zebrafish DNA sequence from clone CH211-117K16 ...	44	0.39
87	emb\|BX548162.12\| Zebrafish DNA sequence from clone DKEYP-90D11 i...	44	0.39
88	emb\|BX571792.9\| Zebrafish DNA sequence from clone CH211-177D9 in...	44	0.39
89	gb\|AC080003.6\| Homo sapiens BAC clone RP11-344F9 from 4, complet...	44	0.39
90	emb\|BX088705.18\| Zebrafish DNA sequence from clone DKEY-21G19, c...	44	0.39
91	gb\|AC027309.3\| Homo sapiens chromosome 5 clone CTB-79E8, complet...	44	0.39
92	gb\|AY115107.1\| Mus musculus vaccinia related kinase 3 (Vrk3) and...	44	0.39
93	emb\|BX537340.15\| Zebrafish DNA sequence from clone DKEYP-93A2 in...	44	0.39
94	emb\|BX323995.13\| Zebrafish DNA sequence from clone RP71-86K19 in...	44	0.39
95	emb\|BX546482.15\| Zebrafish DNA sequence from clone DKEY-226B20 i...	44	0.39
96	emb\|BX649434.7\| Zebrafish DNA sequence from clone CH211-261N9 in...	44	0.39
97	emb\|BX890614.10\| Zebrafish DNA sequence from clone DKEY-46N5, co...	44	0.39
98	emb\|BX323858.12\| Zebrafish DNA sequence from clone DKEY-102F10 i...	44	0.39
99	emb\|BX571707.13\| Zebrafish DNA sequence from clone DKEY-93K4 in ...	44	0.39
100	emb\|BX530071.7\| Zebrafish DNA sequence from clone CH211-189P14 i...	44	0.39
101	emb\|BX950871.13\| Zebrafish DNA sequence from clone CH211-105C13 ...	44	0.39
102	dbj\|AK123899.1\| Homo sapiens cDNA FLJ41905 fis, clone PEBLM2006113	44	0.39
103	emb\|BX927071.12\| Zebrafish DNA sequence from clone DKEY-286O23 i...	44	0.39
104	gb\|AC026395.11\| Homo sapiens chromosome 10 clone RP11-45D20, com...	44	0.39
105	gb\|AC025947.9\| Homo sapiens chromosome 10 clone RP11-78A18, comp...	44	0.39
106	gb\|AC022068.6\| Homo sapiens chromosome 8, clone RP11-523C15, com...	44	0.39
107	gb\|AC171140.2\| Helobdella robusta clone CH306-1B2, complete sequ...	44	0.39
108	emb\|BX649412.8\| Zebrafish DNA sequence from clone DKEY-116G10 in...	44	0.39
109	emb\|BX323022.11\| Zebrafish DNA sequence from clone DKEYP-77C1 in...	44	0.39
110	gb\|AC158231.2\| Mus musculus BAC clone RP24-510K1 from chromosome...	44	0.39
111	emb\|BX005205.17\| Zebrafish DNA sequence from clone DKEY-210P14 i...	44	0.39
112	emb\|BX663520.9\| Zebrafish DNA sequence from clone DKEY-105H12 in...	44	0.39
113	emb\|BX119916.10\| Zebrafish DNA sequence from clone CH211-202I5 i...	44	0.39
114	emb\|BX572641.10\| Zebrafish DNA sequence from clone CH211-213N22 ...	44	0.39
115	emb\|BX897656.9\| Zebrafish DNA sequence from clone CH211-271K12, ...	44	0.39
116	emb\|BX510306.17\| Zebrafish DNA sequence from clone CH211-195F19 ...	44	0.39
117	emb\|BX649487.7\| Zebrafish DNA sequence from clone DKEY-148C4 in ...	44	0.39
118	emb\|BX664716.19\| Zebrafish DNA sequence from clone DKEY-3D4 in l...	44	0.39
119	emb\|BX248517.10\| Zebrafish DNA sequence from clone DKEY-30O16 in...	44	0.39
120	emb\|AL935185.11\| Zebrafish DNA sequence from clone CH211-250A16 ...	44	0.39
121	emb\|BX649643.10\| Zebrafish DNA sequence from clone CH211-125M10 ...	44	0.39
122	gb\|AC159625.2\| Mus musculus BAC clone RP24-262L7 from chromosome...	44	0.39
123	gb\|AC004033.3\| Homo sapiens Chromosome 22q11.2 PAC Clone p_m11 I...	44	0.39
124	emb\|BX324224.11\| Zebrafish DNA sequence from clone CH211-168H21 ...	44	0.39
125	gb\|AC022217.5\|AC022217 Homo sapiens BAC clone RP11-779O18 from 5...	44	0.39
126	gb\|AC153587.2\| Mus musculus 6 BAC RP23-361L1 (Roswell Park Cance...	44	0.39
127	emb\|BX247950.12\| Zebrafish DNA sequence from clone CH211-51G21, ...	44	0.39
128	emb\|AL929493.20\| Zebrafish DNA sequence from clone CH211-157D2, ...	44	0.39
129	dbj\|AP008218.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.39
130	emb\|BX537121.4\| Zebrafish DNA sequence from clone CH211-196P24 i...	44	0.39
131	gb\|AC027688.5\| Homo sapiens chromosome 16 clone RP11-883G14, com...	44	0.39
132	gb\|AC023819.7\| Homo sapiens chromosome 16 clone RP11-1102H15, co...	44	0.39
133	gb\|AC122714.2\| Homo sapiens chromosome 5 clone RP11-451H23, comp...	44	0.39
134	emb\|BX649334.5\| Zebrafish DNA sequence from clone DKEYP-6A3 in l...	44	0.39
135	gb\|AC084030.5\| Homo sapiens BAC clone RP11-205L13 from 2, comple...	44	0.39
136	gb\|AC099489.2\| Homo sapiens chromosome 16 clone CTD-3088G3, comp...	44	0.39
137	gb\|AC167565.1\| Mus musculus BAC clone RP24-84D8 from chromosome ...	44	0.39
138	emb\|AL935272.17\| Zebrafish DNA sequence from clone CH211-266K22,...	44	0.39
139	emb\|BX248498.5\| Zebrafish DNA sequence from clone CH211-241P24, ...	44	0.39
140	emb\|BX276091.6\| Zebrafish DNA sequence from clone CH211-267P9 in...	44	0.39
141	emb\|BX294006.4\| Zebrafish DNA sequence from clone CH211-145M1 in...	44	0.39
142	emb\|BX119987.6\| Zebrafish DNA sequence from clone DKEY-242G16 in...	44	0.39
143	emb\|BX004770.12\| Zebrafish DNA sequence from clone DKEY-14K21 in...	44	0.39
144	emb\|BX004996.8\| Zebrafish DNA sequence from clone CH211-268F23 i...	44	0.39
145	emb\|BX470114.6\| Zebrafish DNA sequence from clone CH211-168G7 in...	44	0.39
146	emb\|BX004992.13\| Zebrafish DNA sequence from clone CH211-120E13 ...	44	0.39
147	emb\|AL953880.11\| Zebrafish DNA sequence from clone CH211-236O11 ...	44	0.39
148	emb\|BX537134.5\| Zebrafish DNA sequence from clone CH211-205J6, c...	44	0.39
149	emb\|AL935306.6\| Zebrafish DNA sequence from clone DKEY-65O9, com...	44	0.39
150	emb\|AL929184.7\| Zebrafish DNA sequence from clone CH211-125N20, ...	44	0.39
151	emb\|AL929217.14\| Zebrafish DNA sequence from clone CH211-148A2, ...	44	0.39
152	emb\|CR762386.16\| Zebrafish DNA sequence from clone CH211-243A15 ...	44	0.39
153	emb\|BX465216.5\| Mouse DNA sequence from clone RP23-282I18 on chr...	44	0.39
154	gb\|AC005879.3\|AC005879 citb_287_c_20, complete sequence	44	0.39
155	emb\|CR854912.18\| Zebrafish DNA sequence from clone DKEY-39O12 in...	44	0.39
156	emb\|CR759865.13\| Zebrafish DNA sequence from clone CH211-118E11 ...	44	0.39
157	emb\|BX855612.9\| Zebrafish DNA sequence from clone CH211-198C22 i...	44	0.39
158	gb\|AC123920.4\| Mus musculus BAC clone RP24-130L14 from 13, compl...	44	0.39
159	gb\|AC154412.3\| Mus musculus BAC clone RP24-225G4 from 14, comple...	44	0.39
160	emb\|CR548627.7\| Zebrafish DNA sequence from clone DKEYP-24A7 in ...	44	0.39
161	emb\|BX927218.17\| Zebrafish DNA sequence from clone DKEY-14O18 in...	44	0.39
162	emb\|BX950189.14\| Zebrafish DNA sequence from clone CH211-155P8 i...	44	0.39
163	emb\|CR381630.12\| Zebrafish DNA sequence from clone CH211-234G24 ...	44	0.39
164	emb\|BX571837.10\| Zebrafish DNA sequence from clone CH211-261O1 i...	44	0.39
165	emb\|CR382286.9\| Zebrafish DNA sequence from clone CH211-12J10 in...	44	0.39
166	emb\|BX890602.8\| Zebrafish DNA sequence from clone DKEYP-109H9 in...	44	0.39
167	emb\|BX936391.7\| Zebrafish DNA sequence from clone CH211-114A22 i...	44	0.39
168	emb\|BX957262.7\| Zebrafish DNA sequence from clone CH211-270K23 i...	44	0.39
169	emb\|BX293565.25\| Zebrafish DNA sequence from clone DKEY-268M13 i...	44	0.39
170	emb\|AL606705.23\| Zebrafish DNA sequence from clone BUSM1-175P5 i...	44	0.39
171	emb\|AL645755.20\| Zebrafish DNA sequence from clone RP71-1N18 in ...	44	0.39
172	emb\|BX255963.11\| Zebrafish DNA sequence from clone CH211-195D17 ...	44	0.39
173	emb\|BX469895.7\| Zebrafish DNA sequence from clone DKEY-152C18 in...	44	0.39
174	emb\|BX294095.13\| Zebrafish DNA sequence from clone CH211-248L17 ...	44	0.39
175	emb\|BX284620.5\| Zebrafish DNA sequence from clone CH211-218E20 i...	44	0.39
176	emb\|BX901971.15\| Zebrafish DNA sequence from clone DKEY-256M21 i...	44	0.39
177	emb\|CR388051.22\| Zebrafish DNA sequence from clone CH211-239B6 i...	44	0.39
178	emb\|CR769769.7\| Zebrafish DNA sequence from clone CH211-190H11 i...	44	0.39
179	emb\|BX950865.11\| Zebrafish DNA sequence from clone DKEYP-100E12 ...	44	0.39
180	emb\|CR354403.16\| Zebrafish DNA sequence from clone CH211-196E8 i...	44	0.39
181	emb\|CR450781.12\| Zebrafish DNA sequence from clone DKEY-20O6 in ...	44	0.39
182	emb\|CR847940.9\| Zebrafish DNA sequence from clone CH211-250O24 i...	44	0.39
183	emb\|CR854915.21\| Zebrafish DNA sequence from clone DKEY-4G13 in ...	44	0.39
184	emb\|BX088726.13\| Zebrafish DNA sequence from clone DKEY-149G13 i...	44	0.39
185	emb\|CR788257.9\| Zebrafish DNA sequence from clone DKEY-244H24 in...	44	0.39
186	emb\|AL935203.12\| Zebrafish DNA sequence from clone CH211-256A21 ...	44	0.39
187	emb\|BX294166.5\| Zebrafish DNA sequence from clone CH211-244D20 i...	44	0.39
188	emb\|CR556713.11\| Zebrafish DNA sequence from clone DKEY-28O14 in...	44	0.39
189	emb\|CR848750.27\| Zebrafish DNA sequence from clone RP71-4B23 in ...	44	0.39
190	emb\|AL806525.23\| Mouse DNA sequence from clone RP23-254N4 on chr...	44	0.39
191	gb\|DP000011.1\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.39
192	emb\|AL928780.5\|CNS08CCA Oryza sativa chromosome 12, . BAC OSJNBa...	44	0.39
193	emb\|AL845460.9\| Mouse DNA sequence from clone RP23-453H2 on chro...	44	0.39
194	emb\|BX005384.2\| Zebrafish DNA sequence from clone DKEY-114E11, c...	44	0.39
195	gb\|AC133083.3\| Mus musculus BAC clone RP24-342G5 from 12, comple...	44	0.39
196	gb\|AC140224.4\| Mus musculus BAC clone RP24-483E8 from 1, complet...	44	0.39
197	gb\|AC134604.5\| Mus musculus BAC clone RP23-296I5 from 12, comple...	44	0.39
198	emb\|AL929150.12\| Zebrafish DNA sequence from clone CH211-196H16 ...	44	0.39
199	emb\|AL929276.7\| Zebrafish DNA sequence from clone CH211-59H6, co...	44	0.39
200	emb\|BX897750.11\| Zebrafish DNA sequence from clone DKEY-278N18, ...	44	0.39
201	emb\|CR936437.14\| Zebrafish DNA sequence from clone CH211-197I23 ...	44	0.39
202	dbj\|AP003071.3\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	44	0.39
203	emb\|AL772396.7\| Zebrafish DNA sequence from clone CH211-253F14, ...	44	0.39
204	emb\|AL844150.6\| Zebrafish DNA sequence from clone DKEY-246K2, co...	44	0.39
205	emb\|AL935136.4\| Zebrafish DNA sequence from clone CH211-180B2, c...	44	0.39
206	emb\|AL935045.6\| Zebrafish DNA sequence from clone CH211-183M1, c...	44	0.39
207	gb\|AC160762.4\| Mus musculus BAC clone RP24-330E8 from chromosome...	44	0.39
208	emb\|AL773564.8\| Zebrafish DNA sequence from clone CH211-204C7, c...	44	0.39
209	emb\|AL611934.18\| Mouse DNA sequence from clone RP23-472A8 on chr...	44	0.39
210	emb\|AL627099.13\| Mouse DNA sequence from clone RP23-306F22 on ch...	44	0.39
211	gb\|AC165291.2\| Mus musculus BAC clone RP23-330N2 from chromosome...	44	0.39
212	emb\|AL645535.16\| Mouse DNA sequence from clone RP23-145G23 on ch...	44	0.39
213	gb\|AY502051.1\| Thaleichthys pacificus microsatellite Tpa129 sequ...	42	1.5
214	gb\|AC164649.4\| Mus musculus BAC clone RP23-437D10 from chromosom...	42	1.5
215	gb\|AC146088.2\| Pan troglodytes BAC clone RP43-46I21 from 7, comp...	42	1.5
216	gb\|AC135962.4\| Mus musculus BAC clone RP23-342H15 from chromosom...	42	1.5
217	gb\|DQ481669.1\| Takifugu rubripes HoxDb gene cluster, complete se...	42	1.5
218	gb\|AC140042.19\| Mus musculus chromosome 5, clone RP23-437D10, co...	42	1.5
219	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	42	1.5
220	gb\|AC147771.1\| Homo sapiens chromosome 16 clone PCR-16A03, compl...	42	1.5
221	gb\|AC137520.4\| Homo sapiens chromosome 16 clone WF-1411G11, comp...	42	1.5
222	emb\|AJ937894.1\| Agrilus viridis mitochondrial ND1 gene (partial)...	42	1.5
223	emb\|AJ937893.1\| Agrilus viridis mitochondrial ND1 gene (partial)...	42	1.5
224	emb\|BX936312.12\| Zebrafish DNA sequence from clone DKEY-204O5 in...	42	1.5
225	gb\|AC124777.4\| Mus musculus BAC clone RP23-90I17 from chromosome...	42	1.5
226	gb\|AC124681.3\| Mus musculus BAC clone RP24-261H7 from chromosome...	42	1.5
227	gb\|AC009600.20\| Homo sapiens 2 BAC RP11-436K12 (Roswell Park Can...	42	1.5
228	emb\|CR678388.17\| Zebrafish DNA sequence from clone CH211-125I3 i...	42	1.5
229	emb\|CR352209.10\| Zebrafish DNA sequence from clone DKEY-150O13 i...	42	1.5
230	emb\|CR762396.8\| Zebrafish DNA sequence from clone DKEY-262O12 in...	42	1.5
231	emb\|BX897686.8\| Zebrafish DNA sequence from clone DKEY-145M5 in ...	42	1.5
232	emb\|CR381612.5\| Zebrafish DNA sequence from clone DKEY-274K7, co...	42	1.5
233	emb\|AL160410.24\| Human DNA sequence from clone RP11-136B8 on chr...	42	1.5
234	emb\|AL139823.11\| Human DNA sequence from clone RP4-703E10 on chr...	42	1.5
235	emb\|AL596086.9\| Mouse DNA sequence from clone RP23-168C20 on chr...	42	1.5
236	emb\|AL606690.3\|OSJN00080 Oryza sativa genomic DNA, chromosome 4,...	42	1.5
237	emb\|CR381633.6\| Zebrafish DNA sequence from clone CH211-230M9 in...	42	1.5
238	emb\|CR457458.4\| Zebrafish DNA sequence from clone BUSM1-85A12 in...	42	1.5
239	emb\|BX546485.12\| Zebrafish DNA sequence from clone RP71-39A17 in...	42	1.5
240	emb\|BX649426.8\| Zebrafish DNA sequence from clone DKEYP-82D11, c...	42	1.5
241	emb\|CR354560.9\| Zebrafish DNA sequence from clone DKEY-109I12 in...	42	1.5
242	emb\|BX544890.7\| Zebrafish DNA sequence from clone DKEY-240I4 in ...	42	1.5
243	gb\|AC020912.6\| Homo sapiens chromosome 19 clone CTD-2583G20, com...	42	1.5
244	emb\|BX511308.11\| Zebrafish DNA sequence from clone DKEYP-118E10 ...	42	1.5
245	gb\|AC104509.6\| Drosophila melanogaster X BAC RP98-20K1 (Roswell ...	42	1.5
246	emb\|BX470133.27\| Zebrafish DNA sequence from clone DKEY-169N7 in...	42	1.5
247	gb\|AC018398.10\| Homo sapiens chromosome 8, clone RP11-16G12, com...	42	1.5
248	gb\|AC116426.1\| Genomic sequence for Oryza sativa, Nipponbare str...	42	1.5
249	gb\|AC115687.1\| Genomic sequence for Oryza sativa, Nipponbare str...	42	1.5
250	gb\|AC016065.14\| Homo sapiens chromosome 8, clone RP11-115C21, co...	42	1.5
251	emb\|BX005216.10\| Zebrafish DNA sequence from clone CH211-286O21,...	42	1.5
252	gb\|AC153905.5\| Mus musculus 6 BAC RP23-215A7 (Roswell Park Cance...	42	1.5
253	gb\|AC009220.10\|AC009220 Homo sapiens chromosome 7 clone RP11-365...	42	1.5
254	dbj\|AP008210.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
255	dbj\|AP008212.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
256	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
257	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
258	gb\|AC016993.4\|AC016993 Homo sapiens clone RP11-18J9, complete se...	42	1.5
259	gb\|AC148299.3\| Pan troglodytes BAC clone CH251-484A18 from chrom...	42	1.5
260	gb\|AC093164.6\| Homo sapiens BAC clone RP11-807A19 from 2, comple...	42	1.5
261	gb\|AC113303.16\| Mus musculus chromosome 5, clone RP23-431E5, com...	42	1.5
262	gb\|AC016909.9\| Homo sapiens BAC clone RP11-458A7 from 2, complet...	42	1.5
263	gb\|AC018645.4\|AC018645 Homo sapiens chromosome 7 clone RP11-225B...	42	1.5
264	gb\|AC009783.9\|AC009783 Homo sapiens chromosome 7 clone RP11-14M1...	42	1.5
265	dbj\|AP006167.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
266	dbj\|AP004672.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
267	gb\|AC138356.3\| Homo sapiens chromosome 8, clone RP11-863K10, com...	42	1.5
268	gb\|AC137579.3\| Homo sapiens chromosome 8, clone RP11-346L1, comp...	42	1.5
269	gb\|AC138655.1\| Homo sapiens BAC clone RP11-436K12 from 2, comple...	42	1.5
270	emb\|AL935276.16\| Zebrafish DNA sequence from clone CH211-273J2, ...	42	1.5
271	gb\|AC104521.3\| Homo sapiens chromosome 19 clone CTB-157M14, comp...	42	1.5
272	dbj\|AP003766.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
273	emb\|BX072573.5\| Zebrafish DNA sequence from clone DKEY-16I6, com...	42	1.5
274	dbj\|AB111427.1\| Potamotrygon motoro G6PD mRNA for glucose-6-phos...	42	1.5
275	emb\|BX005015.5\| Zebrafish DNA sequence from clone CH211-66I11 in...	42	1.5
276	emb\|BX284684.8\| Zebrafish DNA sequence from clone DKEY-14I10 in ...	42	1.5
277	emb\|BX294114.8\| Zebrafish DNA sequence from clone DKEY-152J12 in...	42	1.5
278	emb\|CR394541.16\| Zebrafish DNA sequence from clone DKEY-51M5 in ...	42	1.5
279	emb\|BX664613.17\| Zebrafish DNA sequence from clone DKEY-5P5 in l...	42	1.5
280	emb\|BX927293.15\| Zebrafish DNA sequence from clone DKEY-95H12 in...	42	1.5
281	emb\|BX649455.14\| Zebrafish DNA sequence from clone CH211-151J12 ...	42	1.5
282	emb\|AL592289.22\| Zebrafish DNA sequence from clone XX-1CSE, comp...	42	1.5
283	emb\|BX005358.16\| Zebrafish DNA sequence from clone DKEY-161F12 i...	42	1.5
284	emb\|AL772198.14\| Zebrafish DNA sequence from clone CH211-194D6 i...	42	1.5
285	emb\|BX294662.13\| Zebrafish DNA sequence from clone DKEYP-117E6 i...	42	1.5
286	emb\|BX119988.9\| Zebrafish DNA sequence from clone CH211-184L6 in...	42	1.5
287	emb\|BX321877.7\| Zebrafish DNA sequence from clone DKEYP-27B10 in...	42	1.5
288	emb\|BX005479.5\| Zebrafish DNA sequence from clone DKEY-209E8 in ...	42	1.5
289	emb\|BX572080.18\| Zebrafish DNA sequence from clone DKEY-22N17 in...	42	1.5
290	emb\|CR391947.13\| Zebrafish DNA sequence from clone DKEYP-88A4 in...	42	1.5
291	emb\|CR388417.12\| Zebrafish DNA sequence from clone DKEY-211M6 in...	42	1.5
292	emb\|AL845282.12\| Zebrafish DNA sequence from clone DKEY-28P18 in...	42	1.5
293	emb\|BX005232.7\| Zebrafish DNA sequence from clone CH211-172G24, ...	42	1.5
294	gb\|AE003440.3\| Drosophila melanogaster chromosome X, section 24 ...	42	1.5
295	emb\|BX004784.9\| Zebrafish DNA sequence from clone DKEY-82I7 in l...	42	1.5
296	emb\|AL954136.13\| Zebrafish DNA sequence from clone CH211-220E11,...	42	1.5
297	dbj\|AP006291.2\| Homo sapiens genomic DNA, chromosome 8 clone:RP1...	42	1.5
298	dbj\|AP005401.3\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	42	1.5
299	dbj\|AP003967.3\| Homo sapiens genomic DNA, chromosome 11 clone:RP...	42	1.5
300	emb\|BX005218.6\| Zebrafish DNA sequence from clone CH211-127L12 i...	42	1.5
301	emb\|CR536605.14\| Zebrafish DNA sequence from clone DKEY-96K16 in...	42	1.5
302	emb\|AL929172.6\| Zebrafish DNA sequence from clone DKEYP-46C10 in...	42	1.5
303	gb\|AC005619.1\|AC005619 Homo sapiens chromosome 19, cosmid R34241...	42	1.5
304	emb\|AL928952.15\| Zebrafish DNA sequence from clone CH211-225G23,...	42	1.5
305	emb\|AL954372.6\| Zebrafish DNA sequence from clone CH211-259G3, c...	42	1.5
306	emb\|AL606692.3\|OSJN00105 Oryza sativa genomic DNA, chromosome 4,...	42	1.5
307	emb\|AL929114.8\| Zebrafish DNA sequence from clone CH211-133L11 i...	42	1.5
308	emb\|CR352262.23\| Zebrafish DNA sequence from clone DKEY-39F23 in...	42	1.5
309	gb\|AC004788.1\|AC004788 Homo sapiens chromosome 7 clone UWGC:g156...	42	1.5
310	gb\|AC135635.5\| Mus musculus BAC clone RP23-245M20 from 3, comple...	42	1.5
311	emb\|AL935197.7\| Zebrafish DNA sequence from clone CH211-255P10 i...	42	1.5
312	emb\|BX927093.8\| Zebrafish DNA sequence from clone DKEY-53P2 in l...	42	1.5
313	dbj\|AP000066.1\| Homo sapiens genomic DNA, chromosome 8p11.2, sen...	42	1.5
314	gb\|AC138358.12\| Mus musculus chromosome 1, clone RP24-147G10, co...	40	6.0
315	gb\|AC111115.13\| Mus musculus chromosome 5, clone RP23-213H20, co...	40	6.0
316	gb\|AC150415.3\| Branchiostoma floridae clone CH302-62D14, complet...	40	6.0
317	gb\|AC151846.3\| Mus musculus BAC clone RP23-13B8 from chromosome ...	40	6.0
318	gb\|AC166836.3\| Mus musculus BAC clone RP23-17O23 from chromosome...	40	6.0
319	gb\|AC132396.6\| Mus musculus BAC clone RP23-394F17 from chromosom...	40	6.0
320	gb\|AY771996.1\| Homo sapiens interleukin 12 receptor, beta 1 (IL1...	40	6.0
321	gb\|AC161534.5\| Mus musculus chromosome 1, clone RP24-127D13, com...	40	6.0
322	gb\|AF169659.3\|HSTHRG06 Homo sapiens thyroglobulin gene, exons 30...	40	6.0
323	gb\|AF393664.1\| Siphateles bicolor obesa isolate G19 microsatelli...	40	6.0
324	gb\|AY024098.1\| Oryza sativa microsatellite MRG6423 containing (G...	40	6.0
325	gb\|AY024013.1\| Oryza sativa microsatellite MRG6338 containing (C...	40	6.0
326	gb\|AY023918.1\| Oryza sativa microsatellite MRG6243 containing (A...	40	6.0
327	gb\|AC098833.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
328	gb\|DQ198488.1\| Elephas maximus clone LaT26 microsatellite sequence	40	6.0
329	gb\|AC118285.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
330	gb\|AC101852.7\| Mus musculus chromosome 1, clone RP23-279P3, comp...	40	6.0
331	gb\|AC131129.4\| Rattus norvegicus 17 BAC CH230-15O20 (Children's ...	40	6.0
332	gb\|AC113548.22\| Mus musculus chromosome 9, clone RP23-268F15, co...	40	6.0
333	gb\|AF241735.2\| Homo sapiens chromosome X clone CTD-2324A24 map p...	40	6.0
334	gb\|AF241734.2\| Homo sapiens chromosome X clone RP1-34M10 map p11...	40	6.0
335	gb\|AC091810.4\| Homo sapiens chromosome X clone CTD-2324A24 map p...	40	6.0
336	gb\|AC124143.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
337	gb\|AC137616.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.0
338	gb\|AC131725.2\| Mus musculus BAC clone RP23-129H16 from chromosom...	40	6.0
339	gb\|AC132355.4\| Mus musculus BAC clone RP24-114M18 from chromosom...	40	6.0
340	gb\|AC124998.10\| Mus musculus chromosome 10, clone RP24-350B12, c...	40	6.0
341	gb\|AC127546.4\| Mus musculus BAC clone RP24-485N8 from chromosome...	40	6.0
342	gb\|AC129205.3\| Mus musculus BAC clone RP24-235I5 from chromosome...	40	6.0
343	gb\|AC146082.3\| Pan troglodytes BAC clone RP43-55G24 from 7, comp...	40	6.0
344	gb\|AC126453.5\| Mus musculus BAC clone RP23-244A6 from chromosome...	40	6.0
345	gb\|AC129289.4\| Mus musculus BAC clone RP24-482E11 from chromosom...	40	6.0
346	gb\|AC149031.1\| Rhinolophus ferrumequinum clone VMRC7-44G7, compl...	40	6.0
347	gb\|AC090437.62\| Mus musculus strain C57BL/6J clone rp23-11f20 ma...	40	6.0
348	gb\|AC152166.4\| Mus musculus BAC clone RP23-425A3 from chromosome...	40	6.0
349	gb\|AC105958.11\| Mus musculus chromosome 9, clone RP24-325P4, com...	40	6.0
350	gb\|AC164589.6\| Mus musculus chromosome 8, clone RP24-363C11, com...	40	6.0
351	gb\|AC164306.3\| Mus musculus BAC clone RP23-190A21 from chromosom...	40	6.0
352	gb\|AC159708.13\| Mus musculus 10 BAC RP23-110M21 (Roswell Park Ca...	40	6.0
353	gb\|AC162527.5\| Mus musculus BAC clone RP23-30M17 from chromosome...	40	6.0
354	gb\|AC157650.2\| Mus musculus BAC clone RP24-573N21 from chromosom...	40	6.0
355	gb\|AC183388.3\| Pan troglodytes BAC clone CH251-53D20 from chromo...	40	6.0
356	gb\|AC124374.5\| Mus musculus BAC clone RP24-567K8 from chromosome...	40	6.0
357	gb\|AC145299.3\| Mus musculus BAC clone RP24-129J23 from chromosom...	40	6.0
358	gb\|AC024730.7\| Homo sapiens BAC clone RP11-422E4 from 7, complet...	40	6.0
359	gb\|AC131039.7\| Mus musculus chromosome 1, clone RP23-274I23, com...	40	6.0
360	gb\|AC105470.17\| Rattus norvegicus 10 BAC CH230-192N7 (Children's...	40	6.0
361	emb\|CR759874.20\| Zebrafish DNA sequence from clone CH211-214H24 ...	40	6.0
362	emb\|AL844597.12\| Zebrafish DNA sequence from clone DKEY-9M10 in ...	40	6.0
363	emb\|CR376775.7\| Zebrafish DNA sequence from clone CH211-197C5 in...	40	6.0
364	emb\|CT010576.9\| Mouse DNA sequence from clone RP23-193B21 on chr...	40	6.0
365	emb\|CR956431.10\| Pig DNA sequence from clone PigE-60M9 on chromo...	40	6.0
366	emb\|CR396586.7\| Zebrafish DNA sequence from clone DKEY-184A18 in...	40	6.0
367	emb\|CR932998.12\| Zebrafish DNA sequence from clone DKEY-111I23 i...	40	6.0
368	emb\|CR376860.38\| Zebrafish DNA sequence from clone DKEY-111H22 i...	40	6.0
369	emb\|CR627491.15\| Zebrafish DNA sequence from clone DKEY-163B6 in...	40	6.0
370	emb\|BX927362.10\| Zebrafish DNA sequence from clone CH211-170N20 ...	40	6.0
371	emb\|CR956369.6\| Pig DNA sequence from clone PigI-416G4 on chromo...	40	6.0
372	emb\|BX957328.6\| Zebrafish DNA sequence from clone CH211-187F22, ...	40	6.0
373	emb\|CT009767.6\| Mouse DNA sequence from clone RP23-24A13 on chro...	40	6.0
374	emb\|CR847534.13\| Zebrafish DNA sequence from clone DKEY-27E20 in...	40	6.0
375	emb\|CR790381.6\| Zebrafish DNA sequence from clone DKEY-202K24 in...	40	6.0
376	emb\|CR855305.12\| Zebrafish DNA sequence from clone DKEY-98F17 in...	40	6.0
377	gb\|AC137511.3\| Mus musculus BAC clone RP24-313I8 from chromosome...	40	6.0
378	gb\|AC002288.1\|HUAC002288 Homo sapiens Chromosome 16 BAC clone CI...	40	6.0
379	gb\|AC073600.3\| Genomic sequence for Mus musculus, clone RP23-119...	40	6.0
380	gb\|AC130451.2\| Homo sapiens chromosome 16 clone CTA-249B10, comp...	40	6.0
381	gb\|AC127250.3\| Mus musculus BAC clone RP24-482H23 from chromosom...	40	6.0
382	gb\|AC124407.4\| Mus musculus BAC clone RP24-389C22 from chromosom...	40	6.0
383	gb\|AC116597.3\| Mus musculus BAC clone RP24-409C23 from chromosom...	40	6.0
384	gb\|AC117259.3\| Mus musculus BAC clone RP24-492O19 from chromosom...	40	6.0
385	gb\|AC122388.5\| Mus musculus BAC clone RP24-80J12 from chromosome...	40	6.0
386	gb\|AC124534.4\| Mus musculus BAC clone RP23-316G7 from chromosome...	40	6.0
387	emb\|BX664703.21\| Zebrafish DNA sequence from clone DKEYP-74A8 in...	40	6.0
388	gb\|AC023480.7\| Homo sapiens chromosome 3 clone RP11-399K19 map 3...	40	6.0
389	emb\|CR545462.25\| Zebrafish DNA sequence from clone DKEYP-88F5 in...	40	6.0
390	gb\|AC122436.4\| Mus musculus BAC clone RP24-204P6 from chromosome...	40	6.0
391	gb\|AC126280.4\| Mus musculus BAC clone RP23-10P23 from 16, comple...	40	6.0
392	gb\|AC125329.4\| Mus musculus BAC clone RP23-198F7 from 10, comple...	40	6.0
393	gb\|AC123074.2\| Mus musculus BAC clone RP23-168H19 from 10, compl...	40	6.0
394	ref\|NG_000839.1\| Homo sapiens cystatin locus (CST@) on chromosom...	40	6.0
395	gb\|AC115119.5\| Mus musculus BAC clone RP23-87M19 from 18, comple...	40	6.0
396	gb\|AC098883.3\| Mus musculus BAC clone RP23-122F3 from 16, comple...	40	6.0
397	gb\|AC004963.2\| Homo sapiens PAC clone RP5-1102A12 from 7, comple...	40	6.0
398	gb\|AC006022.1\| Homo sapiens PAC clone RP5-1131G17 from 7, comple...	40	6.0
399	gb\|AC115751.6\| Mus musculus chromosome 1, clone RP23-16I21, comp...	40	6.0
400	gb\|AC154722.2\| Mus musculus BAC clone RP24-371J2 from chromosome...	40	6.0
401	gb\|AC161825.13\| Mus musculus 10 BAC RP23-35O24 (Roswell Park Can...	40	6.0
402	gb\|AC158622.4\| Mus musculus 10 BAC RP23-292G1 (Roswell Park Canc...	40	6.0
403	gb\|AC153656.4\| Mus musculus BAC clone RP23-428O19 from chromosom...	40	6.0
404	emb\|BX928756.13\| Zebrafish DNA sequence from clone CH211-113K9 i...	40	6.0
405	gb\|AC156496.10\| Mus musculus chromosome 7, clone RP24-246N21, co...	40	6.0
406	gb\|AC159466.3\| Mus musculus 10 BAC RP23-388A21 (Roswell Park Can...	40	6.0
407	gb\|AC148217.15\| Medicago truncatula clone mth2-20c19, complete s...	40	6.0
408	emb\|CR931814.13\| Zebrafish DNA sequence from clone DKEY-236E8 in...	40	6.0
409	emb\|CR752649.9\| Zebrafish DNA sequence from clone DKEY-238J13, c...	40	6.0
410	emb\|BX927158.14\| Zebrafish DNA sequence from clone DKEY-106K1 in...	40	6.0
411	emb\|CR391930.9\| Zebrafish DNA sequence from clone CH211-154B16 i...	40	6.0
412	emb\|Z98743.1\|HS181C9 Human DNA sequence from clone RP1-181C9 on ...	40	6.0
413	emb\|AL589949.15\| Human DNA sequence from clone RP11-169F1 on chr...	40	6.0
414	emb\|AL513190.13\| Human DNA sequence from clone RP11-12J10 on chr...	40	6.0
415	emb\|AL451042.10\| Human DNA sequence from clone RP11-276H7 on chr...	40	6.0
416	emb\|AL445933.32\| Human DNA sequence from clone RP11-486B10 on ch...	40	6.0
417	emb\|AL445263.6\| Human DNA sequence from clone RP11-227B14 on chr...	40	6.0
418	emb\|AL359815.26\| Human DNA sequence from clone RP11-63N8 on chro...	40	6.0
419	emb\|AL162231.20\| Human DNA sequence from clone RP11-195F19 on ch...	40	6.0
420	emb\|AL139254.23\| Human DNA sequence from clone RP4-749H3 on chro...	40	6.0
421	emb\|AL137856.24\| Human DNA sequence from clone RP5-1073O3 on chr...	40	6.0
422	gb\|AC130456.2\| Homo sapiens chromosome 16 clone CTA-363E6, compl...	40	6.0
423	emb\|AL133331.27\| Human DNA sequence from clone RP11-157E14 on ch...	40	6.0
424	emb\|AL121880.21\|HSJ1174H9 Human DNA sequence from clone RP5-1174...	40	6.0
425	emb\|AL109809.18\|HSJ673D20 Human DNA sequence from clone RP4-673D...	40	6.0
426	emb\|AL109954.15\|HSJ333B15 Human DNA sequence from clone RP3-333B...	40	6.0
427	emb\|AL079295.1\|HS106I20 Human DNA sequence from clone RP1-106I20...	40	6.0
428	emb\|AL023801.1\|HS786D3 Human DNA sequence from clone RP4-786D3 o...	40	6.0
429	gb\|AC163009.2\| Mus musculus chromosome 1, clone RP23-268A12, com...	40	6.0
430	gb\|AC114461.6\| Rattus norvegicus 1 BAC CH230-14J24 (Children's H...	40	6.0
431	emb\|AL008583.1\|HS327J16 Human DNA sequence from clone RP3-327J16...	40	6.0
432	emb\|BX470172.19\| Zebrafish DNA sequence from clone DKEY-3H3 in l...	40	6.0
433	emb\|BX548051.11\| Zebrafish DNA sequence from clone CH211-203M19 ...	40	6.0
434	emb\|CR936218.6\| Human DNA sequence from clone RP11-669E14, compl...	40	6.0
435	emb\|CR352216.10\| Zebrafish DNA sequence from clone DKEYP-92C6 in...	40	6.0
436	emb\|CR354401.17\| Zebrafish DNA sequence from clone CH211-101C7 i...	40	6.0
437	emb\|BX897743.8\| Zebrafish DNA sequence from clone CH211-164N21 i...	40	6.0
438	gb\|AC175363.2\| Pan troglodytes chromosome X clone CH251-7A1 map ...	40	6.0
439	emb\|CR388171.5\| Zebrafish DNA sequence from clone CH211-261O7, c...	40	6.0
440	emb\|BX324198.20\| Zebrafish DNA sequence from clone CH211-108M2 i...	40	6.0
441	emb\|X15596.1\|ZMGPC1 Maize Gpc1 gene for glyceraldehyde-3-phospha...	40	6.0
442	gb\|AC107933.6\| Homo sapiens chromosome 8, clone RP11-959C6, comp...	40	6.0
443	emb\|BX908789.1\| Neurospora crassa DNA linkage group VII BAC clon...	40	6.0
444	gb\|AC158962.4\| Mus musculus chromosome 1, clone RP23-443N21, com...	40	6.0
445	emb\|CR352297.14\| Zebrafish DNA sequence from clone CH211-165L15 ...	40	6.0
446	emb\|AL808108.3\| Zebrafish DNA sequence from clone CH211-240L14 i...	40	6.0
447	emb\|AL669990.1\|NCB8J24 Neurospora crassa DNA linkage group II BA...	40	6.0
448	emb\|AL596382.12\| Mouse DNA sequence from clone RP23-337J7 on chr...	40	6.0
449	emb\|AL662843.11\| Mouse DNA sequence from clone RP23-411E22 on ch...	40	6.0
450	emb\|AL645804.8\| Zebrafish DNA sequence from clone BUSM1-25N23 Co...	40	6.0
451	emb\|AL591430.8\| Mouse DNA sequence from clone RP23-41B20 on chro...	40	6.0
452	emb\|AJ006345.1\|HSA6345 Homo sapiens KVLQT1 gene	40	6.0
453	gb\|AY988132.1\| Felis catus clone FCA731 microsatellite sequence	40	6.0
454	emb\|CR932417.12\| Human DNA sequence from clone XX-D_24I13, compl...	40	6.0
455	emb\|CR628365.6\| Zebrafish DNA sequence from clone CH211-137O16 i...	40	6.0
456	emb\|BX323075.13\| Zebrafish DNA sequence from clone CH211-230C4 i...	40	6.0
457	emb\|CR384105.16\| Zebrafish DNA sequence from clone CH211-186K13 ...	40	6.0
458	emb\|CR759780.11\| Zebrafish DNA sequence from clone DKEY-269P14 i...	40	6.0
459	emb\|CR381576.10\| Zebrafish DNA sequence from clone DKEY-245F17 i...	40	6.0
460	emb\|CR387989.9\| Zebrafish DNA sequence from clone DKEY-101P2 in ...	40	6.0
461	emb\|BX088597.18\| Zebrafish DNA sequence from clone DKEY-171P23 i...	40	6.0
462	emb\|CR391967.7\| Zebrafish DNA sequence from clone CH211-107E6 in...	40	6.0
463	emb\|AL646093.9\| Mouse DNA sequence from clone RP23-55I2 on chrom...	40	6.0
464	emb\|AL645938.9\| Mouse DNA sequence from clone RP23-15E24 on chro...	40	6.0
465	emb\|CR847548.8\| Zebrafish DNA sequence from clone DKEY-185L9 in ...	40	6.0
466	emb\|CR293521.11\| Zebrafish DNA sequence from clone CH211-152F22 ...	40	6.0
467	emb\|BX294129.10\| Zebrafish DNA sequence from clone DKEYP-34H12 i...	40	6.0
468	emb\|CR293518.13\| Zebrafish DNA sequence from clone CH211-129L10 ...	40	6.0
469	gb\|AC151908.8\| Mus musculus BAC clone RP23-109A22 from chromosom...	40	6.0
470	emb\|BX511086.5\| Zebrafish DNA sequence from clone DKEY-38P8 in l...	40	6.0
471	emb\|BX927096.16\| Zebrafish DNA sequence from clone CH211-262J3 i...	40	6.0
472	emb\|BX510656.7\| Zebrafish DNA sequence from clone CH211-132N7 in...	40	6.0
473	emb\|AL645986.6\| Mouse DNA sequence from clone DN-353G8 on chromo...	40	6.0
474	emb\|CR749769.6\| Zebrafish DNA sequence from clone DKEY-215J3 in ...	40	6.0
475	emb\|AL845544.11\| Zebrafish DNA sequence from clone BUSM1-133F4 i...	40	6.0
476	emb\|AL929329.2\| Zebrafish DNA sequence from clone BUSM1-44F21 in...	40	6.0
477	emb\|BX510349.5\| Zebrafish DNA sequence from clone CH211-69E13 in...	40	6.0
478	emb\|BX571949.19\| Zebrafish DNA sequence from clone DKEY-25F1 in ...	40	6.0
479	emb\|BX470184.9\| Zebrafish DNA sequence from clone CH211-214H13 i...	40	6.0
480	emb\|AL929566.30\| Zebrafish DNA sequence from clone CH211-159C13 ...	40	6.0
481	emb\|BX120006.15\| Zebrafish DNA sequence from clone DKEYP-21H4 in...	40	6.0
482	gb\|AC020913.9\| Homo sapiens chromosome 19 clone CTD-3032J10, com...	40	6.0
483	gb\|AC008735.9\| Homo sapiens chromosome 19 clone CTD-2537I9, comp...	40	6.0
484	gb\|AF305872.2\| Homo sapiens chromosome 8 clone CTD-2182N23 map 8...	40	6.0
485	gb\|AC010299.8\| Homo sapiens chromosome 5 clone CTB-174J2, comple...	40	6.0
486	gb\|AC112175.2\| Homo sapiens chromosome 5 clone CTD-2568P10, comp...	40	6.0
487	emb\|BX571718.9\| Zebrafish DNA sequence from clone DKEYP-111A10 i...	40	6.0
488	gb\|AF069698.1\| Egernia stokesii clone EST3 microsatellite	40	6.0
489	emb\|BX004828.21\| Zebrafish DNA sequence from clone DKEY-185M8, c...	40	6.0
490	emb\|BX927397.10\| Zebrafish DNA sequence from clone DKEY-87H7 in ...	40	6.0
491	emb\|BX510315.6\| Zebrafish DNA sequence from clone CH211-59I18 in...	40	6.0
492	emb\|BX664752.20\| Zebrafish DNA sequence from clone DKEYP-111E5 i...	40	6.0
493	emb\|BX323992.9\| Zebrafish DNA sequence from clone DKEY-185B14 in...	40	6.0
494	dbj\|AK128451.1\| Homo sapiens cDNA FLJ46594 fis, clone THYMU3045692	40	6.0
495	gb\|AC146695.39\| Pan troglodytes clone rp43-48d2, complete sequence	40	6.0
496	dbj\|AK092665.1\| Homo sapiens cDNA FLJ35346 fis, clone PROST2016684	40	6.0
497	gb\|AC025264.16\| Homo sapiens 12 BAC RP11-704P17 (Roswell Park Ca...	40	6.0
498	gb\|AC121233.16\| Medicago truncatula clone mth2-14g13, complete s...	40	6.0
499	gb\|AC149077.19\| Danio rerio clone ch211-270c14, complete sequence	40	6.0
500	gb\|AC109580.14\| Danio rerio strain AB clone busm1-183j13, comple...	40	6.0

>emb|AL157405.10| Human DNA sequence from clone RP1-19K8 on chromosome 1q21.1-21.3
             Contains the SPRRC small proline-rich protein 2 pseudogene
             and the SPRR2G gene for small proline-rich protein 2G,
             complete sequence
          Length = 52109

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 398   agcaaacatggatggatgtatggatggat 426
             |||||||||||||||||| ||||||||||
Sbjct: 46612 agcaaacatggatggatggatggatggat 46640

to top

>emb|AL844187.13| Zebrafish DNA sequence from clone DKEY-221D18 in linkage group 16,
             complete sequence
          Length = 168637

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 405   atggatggatgtatggatggatcg 428
             ||||||||||||||||||||||||
Sbjct: 72430 atggatggatgtatggatggatcg 72453



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 405   atggatggatgtatggatggatcg 428
             ||||||||||| ||||||||||||
Sbjct: 72644 atggatggatggatggatggatcg 72667



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 405   atggatggatgtatggatggatcg 428
             ||||||||||| ||||||||||||
Sbjct: 72501 atggatggatggatggatggatcg 72524

to top

>emb|BX901948.4| Zebrafish DNA sequence from clone DKEY-187E3 in linkage group 9,
            complete sequence
          Length = 65953

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 403  acatggatggatgtatggatggat 426
            ||||||||||||||||||||||||
Sbjct: 7568 acatggatggatgtatggatggat 7545

to top

>emb|BX294164.13| Zebrafish DNA sequence from clone CH211-266D19 in linkage group 24,
             complete sequence
          Length = 177516

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 400   caaacatggatggatgtatggatggat 426
             |||||||||||||||| ||||||||||
Sbjct: 99699 caaacatggatggatggatggatggat 99673

to top

>emb|CR848664.5| Zebrafish DNA sequence from clone CH211-169I9 in linkage group 15,
             complete sequence
          Length = 139504

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 404   catggatggatgtatggatggat 426
             |||||||||||||||||||||||
Sbjct: 12497 catggatggatgtatggatggat 12475

to top

>emb|CR405690.6| Zebrafish DNA sequence from clone CH211-208M13 in linkage group 22,
              complete sequence
          Length = 195552

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 400    caaacatggatggatgtatggatggat 426
              |||||||||||||||| ||||||||||
Sbjct: 166305 caaacatggatggatggatggatggat 166331



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 166322 atggatggatgtatggatggat 166343



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 102208 atggatggatgtatggatggat 102229



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 102196 atggatggatgtatggatggat 102217



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 101832 atggatggatgtatggatggat 101853

to top

>emb|CR548631.18| Zebrafish DNA sequence from clone CH211-117I20 in linkage group 6,
              complete sequence
          Length = 169904

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                             
Query: 401    aaacatggatggatgtatggatggatcgccg 431
              ||||||||||||||| |||||||||| ||||
Sbjct: 128825 aaacatggatggatggatggatggatggccg 128795



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 401    aaacatggatggatgtatggatggat 426
              ||||||||||||||| ||||||||||
Sbjct: 128601 aaacatggatggatggatggatggat 128576

to top

>gb|AC115633.4| Mus musculus BAC clone RP24-361I15 from 16, complete sequence
          Length = 135437

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 400   caaacatggatggatgtatggatggat 426
             |||||||||||||||| ||||||||||
Sbjct: 56796 caaacatggatggatggatggatggat 56822

to top

>emb|AL807375.14| Mouse DNA sequence from clone RP23-247H23 on chromosome X, complete
             sequence
          Length = 143779

 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 400   caaacatggatggatgtatggatggat 426
             |||||||||||||||| ||||||||||
Sbjct: 69627 caaacatggatggatggatggatggat 69653

to top

>gb|AC166973.5| Mus musculus chromosome 1, clone RP24-372J6, complete sequence
          Length = 146400

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 401    aaacatggatggatgtatggatggat 426
              ||||||||||||||| ||||||||||
Sbjct: 138195 aaacatggatggatggatggatggat 138220

to top

>gb|AC102355.13| Mus musculus chromosome 5, clone RP23-120C8, complete sequence
          Length = 194854

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 12992 aaacatggatggatggatggatggat 12967

to top

>gb|AC110194.11| Mus musculus chromosome 7, clone RP23-238J3, complete sequence
          Length = 223663

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 147181 atggatggatgtatggatggat 147202

to top

>gb|AC160028.9| Mus musculus 10 BAC RP24-570M12 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 223055

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 120840 atggatggatgtatggatggat 120861

to top

>gb|AF541257.1| Panopea abrupta microsatellite Pab8 sequence
          Length = 447

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 405 atggatggatgtatggatggat 426
           ||||||||||||||||||||||
Sbjct: 142 atggatggatgtatggatggat 163



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 405 atggatggatgtatggatggat 426
           ||||||||||||||||||||||
Sbjct: 130 atggatggatgtatggatggat 151

to top

>gb|AY258715.1| Xiphophorus maculatus microsatellite Msb025 sequence
          Length = 625

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 401 aaacatggatggatgtatggatggat 426
           ||||||||||||||| ||||||||||
Sbjct: 120 aaacatggatggatggatggatggat 145

to top

>gb|AC152451.5| Mus musculus BAC clone RP24-309M5 from chromosome 12, complete sequence
          Length = 145113

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 35066 atggatggatgtatggatggat 35045

to top

>gb|AC110177.19| Mus musculus chromosome 1, clone RP24-245K23, complete sequence
          Length = 165052

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 80567 atggatggatgtatggatggat 80588

to top

>gb|AC122234.4| Mus musculus BAC clone RP23-138M13 from chromosome 1, complete sequence
          Length = 175090

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 25118 atggatggatgtatggatggat 25097

to top

>gb|AC144702.2| Danio rerio clone CH211-138D14, complete sequence
          Length = 192101

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 183446 atggatggatgtatggatggat 183425



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 183434 atggatggatgtatggatggat 183413

to top

>gb|AC167018.4| Mus musculus BAC clone RP23-354F11 from chromosome 16, complete
             sequence
          Length = 199488

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 20516 atggatggatgtatggatggat 20495



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 403   acatggatggatgtatggatggat 426
             ||||||||||||| ||||||||||
Sbjct: 20486 acatggatggatgcatggatggat 20463

to top

>gb|AC158549.8| Mus musculus chromosome 19, clone RP24-216K4, complete sequence
          Length = 195500

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 85926 atggatggatgtatggatggat 85905



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 403   acatggatggatgtatggatggat 426
             |||||||||||||||| |||||||
Sbjct: 86008 acatggatggatgtatagatggat 85985

to top

>gb|AC153919.8| Mus musculus 10 BAC RP23-91E23 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 264561

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 204705 atggatggatgtatggatggat 204726

to top

>emb|CR788230.7| Zebrafish DNA sequence from clone DKEY-57I11 in linkage group 2,
             complete sequence
          Length = 223248

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 12666 atggatggatgtatggatggat 12645

to top

>emb|CR936405.6| Zebrafish DNA sequence from clone DKEYP-111C12 in linkage group 2,
            complete sequence
          Length = 36213

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 3246 atggatggatgtatggatggat 3225

to top

>emb|CR388016.11| Zebrafish DNA sequence from clone DKEY-106M5 in linkage group 16,
              complete sequence
          Length = 164212

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 150186 atggatggatgtatggatggat 150207

to top

>emb|CR769785.19| Zebrafish DNA sequence from clone DKEY-1N3 in linkage group 13,
             complete sequence
          Length = 232168

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 11319 atggatggatgtatggatggat 11298

to top

>emb|CR405688.8| Zebrafish DNA sequence from clone DKEY-262F5 in linkage group 13,
             complete sequence
          Length = 48740

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 31789 atggatggatgtatggatggat 31810

to top

>emb|CR339052.6| Zebrafish DNA sequence from clone CH211-218E6 in linkage group 10,
             complete sequence
          Length = 127879

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 57246 atggatggatgtatggatggat 57267

to top

>emb|CR394563.17| Zebrafish DNA sequence from clone CH211-147P18, complete sequence
          Length = 165013

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 81224 atggatggatgtatggatggat 81203

to top

>gb|AC122188.4| Mus musculus BAC clone RP23-33B7 from chromosome 10, complete sequence
          Length = 217173

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 67293 atggatggatgtatggatggat 67314

to top

>emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 in linkage group 16,
              complete sequence
          Length = 179375

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 175663 atggatggatgtatggatggat 175684

to top

>gb|AC122013.4| Mus musculus BAC clone RP24-357P7 from chromosome 12, complete sequence
          Length = 175788

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 52348 atggatggatgtatggatggat 52369



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 402    aacatggatggatgtatggatggat 426
              |||||||||||||| ||||||||||
Sbjct: 132714 aacatggatggatggatggatggat 132738

to top

>gb|AC125174.3| Mus musculus BAC clone RP24-544G11 from chromosome 16, complete
             sequence
          Length = 196646

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 20635 atggatggatgtatggatggat 20614



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 20623 atggatggatgtatggatggat 20602

to top

>emb|CR854834.11| Zebrafish DNA sequence from clone DKEYP-92B10 in linkage group 11,
              complete sequence
          Length = 140484

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 108576 atggatggatgtatggatggat 108597

to top

>gb|AC138605.1| Mus musculus BAC clone RP23-392L23 from chromosome 16, complete sequence
          Length = 172684

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 149784 atggatggatgtatggatggat 149763



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 149772 atggatggatgtatggatggat 149751

to top

>emb|CR318672.5| Zebrafish DNA sequence from clone DKEYP-75H12 in linkage group 7,
            complete sequence
          Length = 126789

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 7537 atggatggatgtatggatggat 7558



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 6533 atggatggatgtatggatggat 6554

to top

>emb|CR735141.14| Zebrafish DNA sequence from clone CH211-128E9 in linkage group 15,
             complete sequence
          Length = 108767

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 82359 atggatggatgtatggatggat 82338



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 82343 atggatggatgtatggatggat 82322



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 82327 atggatggatgtatggatggat 82306



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 406   tggatggatgtatggatggat 426
             |||||||||||||||||||||
Sbjct: 78737 tggatggatgtatggatggat 78717

to top

>emb|CR555294.10| Zebrafish DNA sequence from clone CH211-169P4 in linkage group 19,
             complete sequence
          Length = 142042

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 25634 atggatggatgtatggatggat 25613

to top

>gb|AC073048.7| Homo sapiens BAC clone RP11-54E21 from 7, complete sequence
          Length = 166183

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 116891 atggatggatgtatggatggat 116912

to top

>gb|AC159272.2| Mus musculus BAC clone RP23-423J20 from chromosome 13, complete sequence
          Length = 186588

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 132925 atggatggatgtatggatggat 132904

to top

>gb|AC159474.9| Mus musculus 10 BAC RP23-28P17 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 230201

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 123853 atggatggatgtatggatggat 123874

to top

>emb|CR559944.12| Zebrafish DNA sequence from clone CH211-10D19 in linkage group 13,
              complete sequence
          Length = 180933

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 177110 atggatggatgtatggatggat 177089



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 177098 atggatggatgtatggatggat 177077

to top

>emb|CR339051.6| Zebrafish DNA sequence from clone DKEY-223N8 in linkage group 7,
             complete sequence
          Length = 176851

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 23274 atggatggatgtatggatggat 23295

to top

>emb|CR382378.12| Zebrafish DNA sequence from clone DKEYP-40G12 in linkage group 7,
              complete sequence
          Length = 198471

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 115512 atggatggatgtatggatggat 115491



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 115500 atggatggatgtatggatggat 115479

to top

>emb|BX537131.17| Zebrafish DNA sequence from clone CH211-266K2 in linkage group 14,
             complete sequence
          Length = 140171

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 20688 atggatggatgtatggatggat 20667

to top

>emb|BX936363.13| Zebrafish DNA sequence from clone CH211-112P19 in linkage group 11,
              complete sequence
          Length = 184849

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 136711 atggatggatgtatggatggat 136732

to top

>emb|BX928753.10| Zebrafish DNA sequence from clone DKEY-5J3 in linkage group 17, complete
              sequence
          Length = 159225

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 155386 atggatggatgtatggatggat 155365



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 407    ggatggatgtatggatggat 426
              ||||||||||||||||||||
Sbjct: 155396 ggatggatgtatggatggat 155377

to top

>emb|CR352342.9| Zebrafish DNA sequence from clone CH211-134H7 in linkage group 12,
             complete sequence
          Length = 186937

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 45471 atggatggatgtatggatggat 45492

to top

>emb|Z97353.3|HS90L6 Human DNA sequence from clone RP1-90L6 on chromosome 22q11.21-11.23,
             complete sequence
          Length = 190837

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 31800 atggatggatgtatggatggat 31779

to top

>emb|Z82248.1|HSN44A4 Human DNA sequence from clone LL22NC03-44A4 on chromosome 22 Contains
            the YWHAH gene for tyrosine 3-monooxygenase/tryptophan
            5-monooxygenase activation protein eta polypeptide, the
            C22orf24 gene for chromosome 22 open reading frame 24 and
            a CpG island, complete sequence
          Length = 40662

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 401  aaacatggatggatgtatggatggat 426
            ||||||||||||||| ||||||||||
Sbjct: 5156 aaacatggatggatggatggatggat 5131

to top

>emb|BX470150.13| Zebrafish DNA sequence from clone DKEY-164K14 in linkage group 23,
             complete sequence
          Length = 209342

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 73113 atggatggatgtatggatggat 73134

to top

>emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chromosome X Contains the 3'
              end of the IL3RA gene for interleukin 3 receptor, alpha
              (low affinity) (IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra,
              MGC34174), the SLC25A6 gene for solute carrier family 25
              (mitochondrial carrier; adenine nucleotide translocator),
              member 6 (ANT3, ANT3Y, MGC17525), the ASMTL gene for
              acetylserotonin O-methyltransferase-like (ASMTLX), a novel
              gene (LOC286530), a novel gene (FLJ13330) and six CpG
              islands, complete sequence
          Length = 162377

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 145594 atggatggatgtatggatggat 145573

to top

>emb|AL513284.12| Human DNA sequence from clone RP11-518D3 on chromosome 1 Contains the 3'
              end of a novel gene (FLJ42034, FLJ38762), the gene for a
              putative NFkB activating protein 373, a C-terminal binding
              protein 2 (CTBP2) pseudogene, a ribosomal protein S7 (RPS7)
              pseudogene and a CpG island, complete sequence
          Length = 169972

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 165899 atggatggatgtatggatggat 165920

to top

>emb|AL392085.12| Human DNA sequence from clone RP11-225L6 on chromosome 9 Contains part of
              the ASTN2 gene for astrotactin2 (KIAA0634), complete
              sequence
          Length = 159836

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 114446 atggatggatgtatggatggat 114425

to top

>emb|AL445231.8| Human DNA sequence from clone RP11-27K13 on chromosome 1 Contains the
             3' end of the PTGFRN gene for prostaglandin F2 receptor
             negative regulator, the IGSF2 gene for immunoglobulin
             superfamily member 2, a novel gene (FLJ42338), the 5' end
             of the TTF2 gene for RNA polymerase II transcription
             termination factor and a CpG island, complete sequence
          Length = 126847

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 62584 atggatggatgtatggatggat 62605

to top

>emb|AL357934.29| Human DNA sequence from clone RP11-565P9 on chromosome 9 Contains part
             of the VAV2 gene for vav 2 oncogene, complete sequence
          Length = 95505

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 58747 atggatggatgtatggatggat 58768

to top

>gb|AC108527.6| Rattus norvegicus 9 BAC CH230-7F11 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 225777

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 171826 atggatggatgtatggatggat 171847

to top

>emb|AL161657.22| Human DNA sequence from clone RP11-46O3 on chromosome 20 Contains ESTs,
             STSs and GSSs, complete sequence
          Length = 92132

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 42882 atggatggatgtatggatggat 42903

to top

>emb|BX510944.11| Zebrafish DNA sequence from clone DKEY-286H17 in linkage group 14,
             complete sequence
          Length = 131659

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 28720 atggatggatgtatggatggat 28741

to top

>emb|BX927311.7| Zebrafish DNA sequence from clone CH211-235E15 in linkage group 24,
              complete sequence
          Length = 162570

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 154054 atggatggatgtatggatggat 154075



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 154034 atggatggatgtatggatggat 154055



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 405   atggatggatgtatggatggatcg 428
             ||||||||||| ||||||||||||
Sbjct: 20456 atggatggatggatggatggatcg 20479

to top

>emb|AL831721.30| Zebrafish DNA sequence from clone CH211-211O10 in linkage group 1,
             complete sequence
          Length = 88708

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 80075 atggatggatgtatggatggat 80096

to top

>emb|BX547932.17| Zebrafish DNA sequence from clone DKEY-269E10 in linkage group 7,
             complete sequence
          Length = 82464

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 66410 atggatggatgtatggatggat 66431

to top

>gb|AC163627.4| Mus musculus BAC clone RP23-341E13 from chromosome 6, complete sequence
          Length = 191467

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 38283 atggatggatgtatggatggat 38262



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 406   tggatggatgtatggatggat 426
             |||||||||||||||||||||
Sbjct: 38386 tggatggatgtatggatggat 38366

to top

>emb|BX537273.16| Zebrafish DNA sequence from clone CH211-151F2 in linkage group 10,
              complete sequence
          Length = 167226

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 152763 atggatggatgtatggatggat 152784

to top

>emb|BX927328.10| Zebrafish DNA sequence from clone CH211-10M4 in linkage group 17,
             complete sequence
          Length = 197949

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 84458 atggatggatgtatggatggat 84437



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 407   ggatggatgtatggatggat 426
             ||||||||||||||||||||
Sbjct: 84468 ggatggatgtatggatggat 84449

to top

>emb|BX927104.11| Zebrafish DNA sequence from clone CH211-210P22 in linkage group 17,
             complete sequence
          Length = 146265

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 44005 atggatggatgtatggatggat 44026

to top

>emb|BX546489.13| Zebrafish DNA sequence from clone CH211-258F14 in linkage group 3,
             complete sequence
          Length = 148304

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 12858 atggatggatgtatggatggat 12837



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 405   atggatggatgtatggatgga 425
             |||||||||||||||||||||
Sbjct: 12846 atggatggatgtatggatgga 12826

to top

>emb|CR407599.9| Zebrafish DNA sequence from clone CH211-273O22 in linkage group 13,
             complete sequence
          Length = 32537

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 18580 atggatggatgtatggatggat 18601

to top

>emb|BX666059.13| Zebrafish DNA sequence from clone DKEYP-108D9 in linkage group 15,
             complete sequence
          Length = 121448

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 33859 atggatggatgtatggatggat 33880

to top

>emb|AL645747.11| Mouse DNA sequence from clone RP23-436D9 on chromosome 11 Contains a
             novel gene and a signal transducing adaptor molecule (SH3
             domain and ITAM motif) 1 (Stam) pseudogene, complete
             sequence
          Length = 172052

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 60223 atggatggatgtatggatggat 60244

to top

>emb|CR385021.12| Zebrafish DNA sequence from clone CH211-200N15 in linkage group 16,
             complete sequence
          Length = 148046

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 88419 atggatggatgtatggatggat 88440

to top

>emb|BX324134.11| Zebrafish DNA sequence from clone DKEY-103K8 in linkage group 6, complete
              sequence
          Length = 219514

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 212428 atggatggatgtatggatggat 212449

to top

>emb|BX322231.13| Zebrafish DNA sequence from clone CH211-145C1 in linkage group 9,
             complete sequence
          Length = 166681

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 15443 atggatggatgtatggatggat 15464

to top

>emb|CR361569.11| Zebrafish DNA sequence from clone CH211-99I20 in linkage group 8,
             complete sequence
          Length = 97203

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 30414 atggatggatgtatggatggat 30435

to top

>gb|AC009780.12| Homo sapiens 12 BAC RP11-1C11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 144454

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 104309 atggatggatgtatggatggat 104330

to top

>gb|AC007834.40| Homo sapiens 12 BAC RP11-7G5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 210578

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 85873 atggatggatgtatggatggat 85852

to top

>emb|AL929460.13| Zebrafish DNA sequence from clone CH211-148J1 in linkage group 9,
              complete sequence
          Length = 161013

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 110295 atggatggatgtatggatggat 110274

to top

>gb|AC156982.8| Mus musculus chromosome 19, clone RP23-183N3, complete sequence
          Length = 216311

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 170654 atggatggatgtatggatggat 170675

to top

>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3,
             complete sequence
          Length = 198900

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 15950 atggatggatgtatggatggat 15929

to top

>emb|CR376769.6| Zebrafish DNA sequence from clone CH211-120K3 in linkage group 24,
             complete sequence
          Length = 56040

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 55825 atggatggatgtatggatggat 55846



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 55470 atggatggatgtatggatggat 55491

to top

>emb|AL929016.5| Zebrafish DNA sequence from clone DKEY-24J9 in linkage group 4 Contains
             the gene for a novel protein (zgc:63880), the 3' end of
             the gene for a novel protein similar to vertebrate KCND2,
             the 5' end of the ing3 gene for inhibitor of growth family
             member 3 and a CpG island, complete sequence
          Length = 200582

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 27522 atggatggatgtatggatggat 27543

to top

>emb|BX276181.15| Zebrafish DNA sequence from clone CH211-247O20 in linkage group 5,
              complete sequence
          Length = 154012

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 401    aaacatggatggatgtatggatggat 426
              ||||||||||||||| ||||||||||
Sbjct: 148121 aaacatggatggatgaatggatggat 148096



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 402    aacatggatggatgtatggatggat 426
              |||||||||||||| ||||||||||
Sbjct: 148286 aacatggatggatggatggatggat 148262



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 402    aacatggatggatgtatggatggat 426
              |||||||||||||| ||||||||||
Sbjct: 148049 aacatggatggatggatggatggat 148025

to top

>emb|BX465851.5| Zebrafish DNA sequence from clone CH211-215H21 in linkage group 6,
             complete sequence
          Length = 145469

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 98603 atggatggatgtatggatggat 98582

to top

>gb|AC184103.1| Mus musculus chromosome UNK clone CH35-73N5, complete sequence
          Length = 179651

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 119606 atggatggatgtatggatggat 119627



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 119594 atggatggatgtatggatggat 119615

to top

>emb|BX927196.10| Zebrafish DNA sequence from clone DKEY-121D19 in linkage group 17,
             complete sequence
          Length = 84911

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 78129 atggatggatgtatggatggat 78108

to top

>emb|BX957346.14| Zebrafish DNA sequence from clone CH211-117K16 in linkage group 25,
             complete sequence
          Length = 149598

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 74622 aaacatggatggatggatggatggat 74647



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 74570 aaacatggatggatggatggatggat 74595



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 74430 aaacatggatggatggatggatggat 74455



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 74396 aaacatggatggatggatggatggat 74421



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 401   aaacatggatggatgtatggatgg 424
             ||||||||||||||| ||||||||
Sbjct: 74464 aaacatggatggatggatggatgg 74487

to top

>emb|BX548162.12| Zebrafish DNA sequence from clone DKEYP-90D11 in linkage group 11,
              complete sequence
          Length = 180422

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 134056 atggatggatgtatggatggat 134035



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 134040 atggatggatgtatggatggat 134019

to top

>emb|BX571792.9| Zebrafish DNA sequence from clone CH211-177D9 in linkage group 12,
             complete sequence
          Length = 141671

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 21397 atggatggatgtatggatggat 21376



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 21370 atggatggatgtatggatggat 21349

to top

>gb|AC080003.6| Homo sapiens BAC clone RP11-344F9 from 4, complete sequence
          Length = 187936

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 131846 atggatggatgtatggatggat 131867

to top

>emb|BX088705.18| Zebrafish DNA sequence from clone DKEY-21G19, complete sequence
          Length = 204103

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 203605 atggatggatgtatggatggat 203626

to top

>gb|AC027309.3| Homo sapiens chromosome 5 clone CTB-79E8, complete sequence
          Length = 189479

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 164368 atggatggatgtatggatggat 164389

to top

>gb|AY115107.1| Mus musculus vaccinia related kinase 3 (Vrk3) and activating
             transcription factor 5 (Atf5) genes, complete cds
          Length = 62297

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 24133 aaacatggatggatggatggatggat 24108

to top

>emb|BX537340.15| Zebrafish DNA sequence from clone DKEYP-93A2 in linkage group 7, complete
              sequence
          Length = 192070

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 165092 atggatggatgtatggatggat 165113

to top

>emb|BX323995.13| Zebrafish DNA sequence from clone RP71-86K19 in linkage group 1,
             complete sequence
          Length = 156662

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 73535 atggatggatgtatggatggat 73556



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 73523 atggatggatgtatggatggat 73544

to top

>emb|BX546482.15| Zebrafish DNA sequence from clone DKEY-226B20 in linkage group 13,
              complete sequence
          Length = 206949

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 401    aaacatggatggatgtatggatggat 426
              ||||||||||||||| ||||||||||
Sbjct: 118525 aaacatggatggatggatggatggat 118500

to top

>emb|BX649434.7| Zebrafish DNA sequence from clone CH211-261N9 in linkage group 3,
              complete sequence
          Length = 147775

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 100575 atggatggatgtatggatggat 100554

to top

>emb|BX890614.10| Zebrafish DNA sequence from clone DKEY-46N5, complete sequence
          Length = 115990

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 43141 aaacatggatggatggatggatggat 43116



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 43037 aaacatggatggatggatggatggat 43012



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 42929 aaacatggatggatggatggatggat 42904



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 42833 aaacatggatggatggatggatggat 42808



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 42721 aaacatggatggatggatggatggat 42696



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 42602 aaacatggatggatggatggatggat 42577



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 401   aaacatggatggatgtatggatgga 425
             ||||||||||||||| |||||||||
Sbjct: 43225 aaacatggatggatggatggatgga 43201

to top

>emb|BX323858.12| Zebrafish DNA sequence from clone DKEY-102F10 in linkage group 14,
             complete sequence
          Length = 184463

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 36455 atggatggatgtatggatggat 36476

to top

>emb|BX571707.13| Zebrafish DNA sequence from clone DKEY-93K4 in linkage group 14,
             complete sequence
          Length = 170416

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 54328 atggatggatgtatggatggat 54349

to top

>emb|BX530071.7| Zebrafish DNA sequence from clone CH211-189P14 in linkage group 10,
             complete sequence
          Length = 148539

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 58436 atggatggatgtatggatggat 58415



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 405   atggatggatgtatggatgga 425
             |||||||||||||||||||||
Sbjct: 58424 atggatggatgtatggatgga 58404

to top

>emb|BX950871.13| Zebrafish DNA sequence from clone CH211-105C13 in linkage group 16,
              complete sequence
          Length = 165048

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 106979 atggatggatgtatggatggat 106958

to top

>dbj|AK123899.1| Homo sapiens cDNA FLJ41905 fis, clone PEBLM2006113
          Length = 2093

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 401 aaacatggatggatgtatggatggat 426
           ||||||||||||||| ||||||||||
Sbjct: 555 aaacatggatggatggatggatggat 530

to top

>emb|BX927071.12| Zebrafish DNA sequence from clone DKEY-286O23 in linkage group 18,
             complete sequence
          Length = 143863

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 52035 atggatggatgtatggatggat 52014



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 403   acatggatggatgtatggatggat 426
             ||||||||||||| ||||||||||
Sbjct: 80863 acatggatggatggatggatggat 80840



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 405   atggatggatgtatggatggatcg 428
             ||||||||||| ||||||||||||
Sbjct: 52219 atggatggatggatggatggatcg 52196



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 407   ggatggatgtatggatggat 426
             ||||||||||||||||||||
Sbjct: 12291 ggatggatgtatggatggat 12310

to top

>gb|AC026395.11| Homo sapiens chromosome 10 clone RP11-45D20, complete sequence
          Length = 172777

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 83379 atggatggatgtatggatggat 83400

to top

>gb|AC025947.9| Homo sapiens chromosome 10 clone RP11-78A18, complete sequence
          Length = 159082

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 8266 atggatggatgtatggatggat 8287

to top

>gb|AC022068.6| Homo sapiens chromosome 8, clone RP11-523C15, complete sequence
          Length = 202043

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 155122 atggatggatgtatggatggat 155101

to top

>gb|AC171140.2| Helobdella robusta clone CH306-1B2, complete sequence
          Length = 105143

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 61704 atggatggatgtatggatggat 61725

to top

>emb|BX649412.8| Zebrafish DNA sequence from clone DKEY-116G10 in linkage group 1,
             complete sequence
          Length = 78932

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 43368 atggatggatgtatggatggat 43347

to top

>emb|BX323022.11| Zebrafish DNA sequence from clone DKEYP-77C1 in linkage group 10,
             complete sequence
          Length = 145324

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 68608 atggatggatgtatggatggat 68587

to top

>gb|AC158231.2| Mus musculus BAC clone RP24-510K1 from chromosome 7, complete sequence
          Length = 207943

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 50651 aaacatggatggatggatggatggat 50626

to top

>emb|BX005205.17| Zebrafish DNA sequence from clone DKEY-210P14 in linkage group 16,
             complete sequence
          Length = 164219

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 81936 atggatggatgtatggatggat 81957

to top

>emb|BX663520.9| Zebrafish DNA sequence from clone DKEY-105H12 in linkage group 15,
             complete sequence
          Length = 248279

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 62933 atggatggatgtatggatggat 62912

to top

>emb|BX119916.10| Zebrafish DNA sequence from clone CH211-202I5 in linkage group 11,
             complete sequence
          Length = 196164

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 96353 atggatggatgtatggatggat 96332

to top

>emb|BX572641.10| Zebrafish DNA sequence from clone CH211-213N22 in linkage group 12,
             complete sequence
          Length = 183309

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 16527 atggatggatgtatggatggat 16506

to top

>emb|BX897656.9| Zebrafish DNA sequence from clone CH211-271K12, complete sequence
          Length = 141840

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 31411 atggatggatgtatggatggat 31390



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 31055 atggatggatgtatggatggat 31034

to top

>emb|BX510306.17| Zebrafish DNA sequence from clone CH211-195F19 in linkage group 13,
              complete sequence
          Length = 194184

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 169489 atggatggatgtatggatggat 169510

to top

>emb|BX649487.7| Zebrafish DNA sequence from clone DKEY-148C4 in linkage group 9, complete
              sequence
          Length = 201933

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 173105 atggatggatgtatggatggat 173126

to top

>emb|BX664716.19| Zebrafish DNA sequence from clone DKEY-3D4 in linkage group 9, complete
              sequence
          Length = 198430

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 113250 atggatggatgtatggatggat 113271

to top

>emb|BX248517.10| Zebrafish DNA sequence from clone DKEY-30O16 in linkage group 16,
             complete sequence
          Length = 201353

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 24021 atggatggatgtatggatggat 24000

to top

>emb|AL935185.11| Zebrafish DNA sequence from clone CH211-250A16 in linkage group 21,
             complete sequence
          Length = 191281

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 72453 atggatggatgtatggatggat 72474

to top

>emb|BX649643.10| Zebrafish DNA sequence from clone CH211-125M10 in linkage group 22,
              complete sequence
          Length = 177325

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 139388 atggatggatgtatggatggat 139367

to top

>gb|AC159625.2| Mus musculus BAC clone RP24-262L7 from chromosome 12, complete sequence
          Length = 189979

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 31046 atggatggatgtatggatggat 31025

to top

>gb|AC004033.3| Homo sapiens Chromosome 22q11.2 PAC Clone p_m11 In BCRL2-GGT Region,
            complete sequence
          Length = 145356

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 9840 atggatggatgtatggatggat 9861

to top

>emb|BX324224.11| Zebrafish DNA sequence from clone CH211-168H21 in linkage group 13,
             complete sequence
          Length = 147168

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 39658 atggatggatgtatggatggat 39637

to top

>gb|AC022217.5|AC022217 Homo sapiens BAC clone RP11-779O18 from 5, complete sequence
          Length = 193960

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 38792 atggatggatgtatggatggat 38813

to top

>gb|AC153587.2| Mus musculus 6 BAC RP23-361L1 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 232002

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 79551 atggatggatgtatggatggat 79530

to top

>emb|BX247950.12| Zebrafish DNA sequence from clone CH211-51G21, complete sequence
          Length = 172752

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 30146 atggatggatgtatggatggat 30167

to top

>emb|AL929493.20| Zebrafish DNA sequence from clone CH211-157D2, complete sequence
          Length = 180578

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 129948 atggatggatgtatggatggat 129969



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 405   atggatggatgtatggatggatcg 428
             ||||||||||| ||||||||||||
Sbjct: 51065 atggatggatgaatggatggatcg 51088

to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 401      aaacatggatggatgtatggatggat 426
                ||||||||||||||| ||||||||||
Sbjct: 25801340 aaacatggatggatggatggatggat 25801365

to top

>emb|BX537121.4| Zebrafish DNA sequence from clone CH211-196P24 in linkage group 3,
              complete sequence
          Length = 184845

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 166727 atggatggatgtatggatggat 166748

to top

>gb|AC027688.5| Homo sapiens chromosome 16 clone RP11-883G14, complete sequence
          Length = 177147

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 116601 atggatggatgtatggatggat 116622

to top

>gb|AC023819.7| Homo sapiens chromosome 16 clone RP11-1102H15, complete sequence
          Length = 136137

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 90649 atggatggatgtatggatggat 90670

to top

>gb|AC122714.2| Homo sapiens chromosome 5 clone RP11-451H23, complete sequence
          Length = 190024

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 125152 atggatggatgtatggatggat 125173

to top

>emb|BX649334.5| Zebrafish DNA sequence from clone DKEYP-6A3 in linkage group 22,
            complete sequence
          Length = 184977

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 1166 atggatggatgtatggatggat 1187

to top

>gb|AC084030.5| Homo sapiens BAC clone RP11-205L13 from 2, complete sequence
          Length = 100731

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 93734 atggatggatgtatggatggat 93755

to top

>gb|AC099489.2| Homo sapiens chromosome 16 clone CTD-3088G3, complete sequence
          Length = 204493

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 78796 atggatggatgtatggatggat 78775



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 78780 atggatggatgtatggatggat 78759

to top

>gb|AC167565.1| Mus musculus BAC clone RP24-84D8 from chromosome 14, complete sequence
          Length = 199101

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 180552 atggatggatgtatggatggat 180531

to top

>emb|AL935272.17| Zebrafish DNA sequence from clone CH211-266K22, complete sequence
          Length = 145553

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 21150 aaacatggatggatggatggatggat 21125



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 21046 aaacatggatggatggatggatggat 21021



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 20938 aaacatggatggatggatggatggat 20913



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 20842 aaacatggatggatggatggatggat 20817



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 20730 aaacatggatggatggatggatggat 20705



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 20611 aaacatggatggatggatggatggat 20586



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 401   aaacatggatggatgtatggatgga 425
             ||||||||||||||| |||||||||
Sbjct: 21234 aaacatggatggatggatggatgga 21210

to top

>emb|BX248498.5| Zebrafish DNA sequence from clone CH211-241P24, complete sequence
          Length = 171348

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 36307 atggatggatgtatggatggat 36286



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 36059 atggatggatgtatggatggat 36038



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 405   atggatggatgtatggatgga 425
             |||||||||||||||||||||
Sbjct: 36738 atggatggatgtatggatgga 36718



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 406   tggatggatgtatggatggat 426
             |||||||||||||||||||||
Sbjct: 36070 tggatggatgtatggatggat 36050

to top

>emb|BX276091.6| Zebrafish DNA sequence from clone CH211-267P9 in linkage group 5,
              complete sequence
          Length = 134612

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 109163 atggatggatgtatggatggat 109184



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 401    aaacatggatggatgtatggatggat 426
              ||||||||||||||| ||||||||||
Sbjct: 108835 aaacatggatggatggatggatggat 108860

to top

>emb|BX294006.4| Zebrafish DNA sequence from clone CH211-145M1 in linkage group 8,
             complete sequence
          Length = 171051

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 55470 atggatggatgtatggatggat 55491

to top

>emb|BX119987.6| Zebrafish DNA sequence from clone DKEY-242G16 in linkage group 19,
            complete sequence
          Length = 153687

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 5481 atggatggatgtatggatggat 5502

to top

>emb|BX004770.12| Zebrafish DNA sequence from clone DKEY-14K21 in linkage group 10,
              complete sequence
          Length = 231131

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 175570 atggatggatgtatggatggat 175549

to top

>emb|BX004996.8| Zebrafish DNA sequence from clone CH211-268F23 in linkage group 6,
             complete sequence
          Length = 167320

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 69701 atggatggatgtatggatggat 69680

to top

>emb|BX470114.6| Zebrafish DNA sequence from clone CH211-168G7 in linkage group 4,
            complete sequence
          Length = 138545

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 7779 atggatggatgtatggatggat 7758

to top

>emb|BX004992.13| Zebrafish DNA sequence from clone CH211-120E13 in linkage group 16,
             complete sequence
          Length = 195432

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 16875 atggatggatgtatggatggat 16896



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 405   atggatggatgtatggatggatcg 428
             ||||||||||| ||||||||||||
Sbjct: 85172 atggatggatggatggatggatcg 85195



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 403   acatggatggatgtatggatggat 426
             ||||||||||||| ||||||||||
Sbjct: 17637 acatggatggatggatggatggat 17660

to top

>emb|AL953880.11| Zebrafish DNA sequence from clone CH211-236O11 in linkage group 16,
             complete sequence
          Length = 161603

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 10390 atggatggatgtatggatggat 10411



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 8499 atggatggatgtatggatggat 8520



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 407  ggatggatgtatggatggat 426
            ||||||||||||||||||||
Sbjct: 7906 ggatggatgtatggatggat 7925

to top

>emb|BX537134.5| Zebrafish DNA sequence from clone CH211-205J6, complete sequence
          Length = 192029

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 100894 atggatggatgtatggatggat 100873

to top

>emb|AL935306.6| Zebrafish DNA sequence from clone DKEY-65O9, complete sequence
          Length = 207183

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 1458 atggatggatgtatggatggat 1479

to top

>emb|AL929184.7| Zebrafish DNA sequence from clone CH211-125N20, complete sequence
          Length = 168257

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 98972 atggatggatgtatggatggat 98951

to top

>emb|AL929217.14| Zebrafish DNA sequence from clone CH211-148A2, complete sequence
          Length = 130060

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 112531 atggatggatgtatggatggat 112552

to top

>emb|CR762386.16| Zebrafish DNA sequence from clone CH211-243A15 in linkage group 2,
            complete sequence
          Length = 160796

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 6251 atggatggatgtatggatggat 6230



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 406  tggatggatgtatggatggat 426
            |||||||||||||||||||||
Sbjct: 5912 tggatggatgtatggatggat 5892



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 403    acatggatggatgtatggatggat 426
              ||||||||||||| ||||||||||
Sbjct: 156515 acatggatggatggatggatggat 156492



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 407  ggatggatgtatggatggat 426
            ||||||||||||||||||||
Sbjct: 6045 ggatggatgtatggatggat 6026

to top

>emb|BX465216.5| Mouse DNA sequence from clone RP23-282I18 on chromosome 4, complete
             sequence
          Length = 97410

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 60741 atggatggatgtatggatggat 60762

to top

>gb|AC005879.3|AC005879 citb_287_c_20, complete sequence
          Length = 190982

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 143216 atggatggatgtatggatggat 143237

to top

>emb|CR854912.18| Zebrafish DNA sequence from clone DKEY-39O12 in linkage group 6,
            complete sequence
          Length = 170067

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 7944 atggatggatgtatggatggat 7923

to top

>emb|CR759865.13| Zebrafish DNA sequence from clone CH211-118E11 in linkage group 18,
             complete sequence
          Length = 95664

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 48060 atggatggatgtatggatggat 48081

to top

>emb|BX855612.9| Zebrafish DNA sequence from clone CH211-198C22 in linkage group 19,
              complete sequence
          Length = 212866

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 164713 atggatggatgtatggatggat 164734



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 405   atggatggatgtatggatggatcg 428
             ||||||||||| ||||||||||||
Sbjct: 70651 atggatggatgaatggatggatcg 70674

to top

>gb|AC123920.4| Mus musculus BAC clone RP24-130L14 from 13, complete sequence
          Length = 170268

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 32393 atggatggatgtatggatggat 32372

to top

>gb|AC154412.3| Mus musculus BAC clone RP24-225G4 from 14, complete sequence
          Length = 182048

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 34246 atggatggatgtatggatggat 34225

to top

>emb|CR548627.7| Zebrafish DNA sequence from clone DKEYP-24A7 in linkage group 19,
            complete sequence
          Length = 146348

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 7934 atggatggatgtatggatggat 7913



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 7922 atggatggatgtatggatggat 7901

to top

>emb|BX927218.17| Zebrafish DNA sequence from clone DKEY-14O18 in linkage group 19,
              complete sequence
          Length = 208809

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 127914 atggatggatgtatggatggat 127893

to top

>emb|BX950189.14| Zebrafish DNA sequence from clone CH211-155P8 in linkage group 19,
             complete sequence
          Length = 92418

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 87597 atggatggatgtatggatggat 87576

to top

>emb|CR381630.12| Zebrafish DNA sequence from clone CH211-234G24 in linkage group 18,
             complete sequence
          Length = 152854

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 76648 atggatggatgtatggatggat 76627

to top

>emb|BX571837.10| Zebrafish DNA sequence from clone CH211-261O1 in linkage group 19,
              complete sequence
          Length = 190521

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 163898 atggatggatgtatggatggat 163877

to top

>emb|CR382286.9| Zebrafish DNA sequence from clone CH211-12J10 in linkage group 19,
             complete sequence
          Length = 149742

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 32828 atggatggatgtatggatggat 32807

to top

>emb|BX890602.8| Zebrafish DNA sequence from clone DKEYP-109H9 in linkage group 18,
            complete sequence
          Length = 191296

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 3414 atggatggatgtatggatggat 3435

to top

>emb|BX936391.7| Zebrafish DNA sequence from clone CH211-114A22 in linkage group 22,
             complete sequence
          Length = 73203

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 69416 atggatggatgtatggatggat 69437



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 403   acatggatggatgtatggatggat 426
             ||||||||||||| ||||||||||
Sbjct: 70340 acatggatggatggatggatggat 70363

to top

>emb|BX957262.7| Zebrafish DNA sequence from clone CH211-270K23 in linkage group 19,
              complete sequence
          Length = 143812

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 111373 atggatggatgtatggatggat 111394

to top

>emb|BX293565.25| Zebrafish DNA sequence from clone DKEY-268M13 in linkage group 22,
              complete sequence
          Length = 160930

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 113940 atggatggatgtatggatggat 113961

to top

>emb|AL606705.23| Zebrafish DNA sequence from clone BUSM1-175P5 in linkage group 15,
             complete sequence
          Length = 92464

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 41215 atggatggatgtatggatggat 41194

to top

>emb|AL645755.20| Zebrafish DNA sequence from clone RP71-1N18 in linkage group 22,
             complete sequence
          Length = 141779

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 78731 atggatggatgtatggatggat 78752



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 78382 atggatggatgtatggatggat 78403



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 77629 atggatggatgtatggatggat 77650



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 77361 atggatggatgtatggatggat 77382



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 77349 atggatggatgtatggatggat 77370

to top

>emb|BX255963.11| Zebrafish DNA sequence from clone CH211-195D17 in linkage group 20,
             complete sequence
          Length = 103956

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 21842 atggatggatgtatggatggat 21821

to top

>emb|BX469895.7| Zebrafish DNA sequence from clone DKEY-152C18 in linkage group 19,
              complete sequence
          Length = 179493

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 164237 atggatggatgtatggatggat 164216



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 406    tggatggatgtatggatggat 426
              |||||||||||||||||||||
Sbjct: 164248 tggatggatgtatggatggat 164228

to top

>emb|BX294095.13| Zebrafish DNA sequence from clone CH211-248L17 in linkage group 24,
             complete sequence
          Length = 147604

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 49958 atggatggatgtatggatggat 49979

to top

>emb|BX284620.5| Zebrafish DNA sequence from clone CH211-218E20 in linkage group 20,
             complete sequence
          Length = 201942

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 63531 atggatggatgtatggatggat 63510



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 63519 atggatggatgtatggatggat 63498

to top

>emb|BX901971.15| Zebrafish DNA sequence from clone DKEY-256M21 in linkage group 21,
             complete sequence
          Length = 156578

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 66933 atggatggatgtatggatggat 66912

to top

>emb|CR388051.22| Zebrafish DNA sequence from clone CH211-239B6 in linkage group 15,
             complete sequence
          Length = 120027

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 74494 aaacatggatggatggatggatggat 74469

to top

>emb|CR769769.7| Zebrafish DNA sequence from clone CH211-190H11 in linkage group 11,
              complete sequence
          Length = 160246

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 151673 atggatggatgtatggatggat 151694



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 151661 atggatggatgtatggatggat 151682

to top

>emb|BX950865.11| Zebrafish DNA sequence from clone DKEYP-100E12 in linkage group 6,
              complete sequence
          Length = 162517

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 108348 atggatggatgtatggatggat 108369

to top

>emb|CR354403.16| Zebrafish DNA sequence from clone CH211-196E8 in linkage group 9,
              complete sequence
          Length = 167419

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 106812 atggatggatgtatggatggat 106791



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 398    agcaaacatggatggatgtatggatggat 426
              ||||||||||||| |||| ||||||||||
Sbjct: 106570 agcaaacatggatagatggatggatggat 106542



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 402    aacatggatggatgtatggatggat 426
              |||||||||||||| ||||||||||
Sbjct: 105972 aacatggatggatggatggatggat 105948



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 402    aacatggatggatgtatggatggat 426
              |||||||||| ||||||||||||||
Sbjct: 105676 aacatggatgaatgtatggatggat 105652



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 405    atggatggatgtatggatggatcg 428
              ||||||||||| ||||||||||||
Sbjct: 106214 atggatggatggatggatggatcg 106191

to top

>emb|CR450781.12| Zebrafish DNA sequence from clone DKEY-20O6 in linkage group 24, complete
              sequence
          Length = 215010

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 196426 atggatggatgtatggatggat 196447



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 99848 atggatggatgtatggatggat 99869

to top

>emb|CR847940.9| Zebrafish DNA sequence from clone CH211-250O24 in linkage group 11,
             complete sequence
          Length = 102840

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 77394 atggatggatgtatggatggat 77415

to top

>emb|CR854915.21| Zebrafish DNA sequence from clone DKEY-4G13 in linkage group 13, complete
              sequence
          Length = 158798

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 113830 atggatggatgtatggatggat 113851

to top

>emb|BX088726.13| Zebrafish DNA sequence from clone DKEY-149G13 in linkage group 20,
              complete sequence
          Length = 190374

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 137010 atggatggatgtatggatggat 137031

to top

>emb|CR788257.9| Zebrafish DNA sequence from clone DKEY-244H24 in linkage group 1,
              complete sequence
          Length = 198219

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 160004 atggatggatgtatggatggat 160025

to top

>emb|AL935203.12| Zebrafish DNA sequence from clone CH211-256A21 in linkage group 25,
             complete sequence
          Length = 163572

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 62385 atggatggatgtatggatggat 62406



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 406   tggatggatgtatggatggat 426
             |||||||||||||||||||||
Sbjct: 64242 tggatggatgtatggatggat 64262

to top

>emb|BX294166.5| Zebrafish DNA sequence from clone CH211-244D20 in linkage group 22,
              complete sequence
          Length = 175769

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 174630 atggatggatgtatggatggat 174609

to top

>emb|CR556713.11| Zebrafish DNA sequence from clone DKEY-28O14 in linkage group 11,
              complete sequence
          Length = 229692

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 146786 atggatggatgtatggatggat 146807



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 146774 atggatggatgtatggatggat 146795

to top

>emb|CR848750.27| Zebrafish DNA sequence from clone RP71-4B23 in linkage group 15, complete
              sequence
          Length = 148714

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 142356 atggatggatgtatggatggat 142377

to top

>emb|AL806525.23| Mouse DNA sequence from clone RP23-254N4 on chromosome 4, complete
              sequence
          Length = 209356

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 169260 atggatggatgtatggatggat 169281

to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 401      aaacatggatggatgtatggatggat 426
                ||||||||||||||| ||||||||||
Sbjct: 25729516 aaacatggatggatggatggatggat 25729541

to top

>emb|AL928780.5|CNS08CCA Oryza sativa chromosome 12, . BAC OSJNBa0018C20 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 137492

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 22791 aaacatggatggatggatggatggat 22816

to top

>emb|AL845460.9| Mouse DNA sequence from clone RP23-453H2 on chromosome 2, complete
              sequence
          Length = 172295

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 117411 atggatggatgtatggatggat 117432

to top

>emb|BX005384.2| Zebrafish DNA sequence from clone DKEY-114E11, complete sequence
          Length = 152969

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 55659 atggatggatgtatggatggat 55680

to top

>gb|AC133083.3| Mus musculus BAC clone RP24-342G5 from 12, complete sequence
          Length = 191265

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 6271 atggatggatgtatggatggat 6292

to top

>gb|AC140224.4| Mus musculus BAC clone RP24-483E8 from 1, complete sequence
          Length = 175026

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 401   aaacatggatggatgtatggatggat 426
             ||||||||||||||| ||||||||||
Sbjct: 16366 aaacatggatggatggatggatggat 16391

to top

>gb|AC134604.5| Mus musculus BAC clone RP23-296I5 from 12, complete sequence
          Length = 203284

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 55996 atggatggatgtatggatggat 55975

to top

>emb|AL929150.12| Zebrafish DNA sequence from clone CH211-196H16 in linkage group 1,
             complete sequence
          Length = 229480

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 86253 atggatggatgtatggatggat 86274

to top

>emb|AL929276.7| Zebrafish DNA sequence from clone CH211-59H6, complete sequence
          Length = 210630

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 69311 atggatggatgtatggatggat 69290

to top

>emb|BX897750.11| Zebrafish DNA sequence from clone DKEY-278N18, complete sequence
          Length = 182033

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 130225 atggatggatgtatggatggat 130204



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 130213 atggatggatgtatggatggat 130192



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 407    ggatggatgtatggatggat 426
              ||||||||||||||||||||
Sbjct: 130070 ggatggatgtatggatggat 130051

to top

>emb|CR936437.14| Zebrafish DNA sequence from clone CH211-197I23 in linkage group 3,
             complete sequence
          Length = 96056

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 17656 atggatggatgtatggatggat 17635

to top

>dbj|AP003071.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-554A11, complete
              sequence
          Length = 191898

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 125502 atggatggatgtatggatggat 125481

to top

>emb|AL772396.7| Zebrafish DNA sequence from clone CH211-253F14, complete sequence
          Length = 148465

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 45068 atggatggatgtatggatggat 45047

to top

>emb|AL844150.6| Zebrafish DNA sequence from clone DKEY-246K2, complete sequence
          Length = 203058

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 149859 atggatggatgtatggatggat 149838

to top

>emb|AL935136.4| Zebrafish DNA sequence from clone CH211-180B2, complete sequence
          Length = 146712

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 401    aaacatggatggatgtatggatggat 426
              ||||||||||||||| ||||||||||
Sbjct: 130457 aaacatggatggatggatggatggat 130432

to top

>emb|AL935045.6| Zebrafish DNA sequence from clone CH211-183M1, complete sequence
          Length = 149814

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 103786 atggatggatgtatggatggat 103807

to top

>gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome 1, complete sequence
          Length = 149232

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 142539 atggatggatgtatggatggat 142518

to top

>emb|AL773564.8| Zebrafish DNA sequence from clone CH211-204C7, complete sequence
          Length = 159763

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 405  atggatggatgtatggatggat 426
            ||||||||||||||||||||||
Sbjct: 7082 atggatggatgtatggatggat 7103



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 406   tggatggatgtatggatggat 426
             |||||||||||||||||||||
Sbjct: 38955 tggatggatgtatggatggat 38935

to top

>emb|AL611934.18| Mouse DNA sequence from clone RP23-472A8 on chromosome 4, complete
             sequence
          Length = 184866

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 59486 atggatggatgtatggatggat 59507



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 59474 atggatggatgtatggatggat 59495

to top

>emb|AL627099.13| Mouse DNA sequence from clone RP23-306F22 on chromosome 4, complete
             sequence
          Length = 169469

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 12410 atggatggatgtatggatggat 12431



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 12394 atggatggatgtatggatggat 12415

to top

>gb|AC165291.2| Mus musculus BAC clone RP23-330N2 from chromosome 17, complete sequence
          Length = 206353

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 405    atggatggatgtatggatggat 426
              ||||||||||||||||||||||
Sbjct: 163152 atggatggatgtatggatggat 163131

to top

>emb|AL645535.16| Mouse DNA sequence from clone RP23-145G23 on chromosome 11, complete
             sequence
          Length = 161363

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 405   atggatggatgtatggatggat 426
             ||||||||||||||||||||||
Sbjct: 27509 atggatggatgtatggatggat 27488

to top

>gb|AY502051.1| Thaleichthys pacificus microsatellite Tpa129 sequence
          Length = 363

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 405 atggatggatgtatggatgga 425
           |||||||||||||||||||||
Sbjct: 218 atggatggatgtatggatgga 238

to top

>gb|AC164649.4| Mus musculus BAC clone RP23-437D10 from chromosome 5, complete sequence
          Length = 215766

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 406   tggatggatgtatggatggat 426
             |||||||||||||||||||||
Sbjct: 29214 tggatggatgtatggatggat 29194

to top

>gb|AC146088.2| Pan troglodytes BAC clone RP43-46I21 from 7, complete sequence
          Length = 165433

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 402   aacatggatggatgtatggatggat 426
             |||||||||||||| ||||||||||
Sbjct: 97404 aacatggatggatggatggatggat 97428

to top

>gb|AC135962.4| Mus musculus BAC clone RP23-342H15 from chromosome 16, complete
             sequence
          Length = 202525

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 402   aacatggatggatgtatggatggat 426
             |||||||||||||| ||||||||||
Sbjct: 38142 aacatggatggatggatggatggat 38118

to top

>gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete sequence
          Length = 398525

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 402   aacatggatggatgtatggatggat 426
             |||||||||||||| ||||||||||
Sbjct: 45600 aacatggatggatggatggatggat 45624

to top

>gb|AC140042.19| Mus musculus chromosome 5, clone RP23-437D10, complete sequence
          Length = 215786

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 406    tggatggatgtatggatggat 426
              |||||||||||||||||||||
Sbjct: 186573 tggatggatgtatggatggat 186593

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 404     catggatggatgtatggatggatcg 428
               |||||||||||| ||||||||||||
Sbjct: 5147999 catggatggatggatggatggatcg 5147975

to top

>gb|AC147771.1| Homo sapiens chromosome 16 clone PCR-16A03, complete sequence
          Length = 8715

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 398  agcaaacatggatggatgtatggatggat 426
            ||||||||||||||||||  |||||||||
Sbjct: 8305 agcaaacatggatggatgggtggatggat 8277

to top

>gb|AC137520.4| Homo sapiens chromosome 16 clone WF-1411G11, complete sequence
          Length = 37514

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 398   agcaaacatggatggatgtatggatggat 426
             ||||||||||||||||||  |||||||||
Sbjct: 36924 agcaaacatggatggatgggtggatggat 36952

to top

>emb|AJ937894.1| Agrilus viridis mitochondrial ND1 gene (partial), tRNA-Leu gene and
           16S rRNA gene (partial), isolate 2
          Length = 594

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 244 tcaaatatcgtcaaaaatcctactc 268
           ||||||| |||||||||||||||||
Sbjct: 336 tcaaatagcgtcaaaaatcctactc 360

to top

>emb|AJ937893.1| Agrilus viridis mitochondrial ND1 gene (partial), tRNA-Leu gene and
           16S rRNA gene (partial), isolate 1
          Length = 604

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 244 tcaaatatcgtcaaaaatcctactc 268
           ||||||| |||||||||||||||||
Sbjct: 352 tcaaatagcgtcaaaaatcctactc 376

to top

>emb|BX936312.12| Zebrafish DNA sequence from clone DKEY-204O5 in linkage group 7,
             complete sequence
          Length = 158510

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 406   tggatggatgtatggatggat 426
             |||||||||||||||||||||
Sbjct: 89778 tggatggatgtatggatggat 89798

to top

>gb|AC124777.4| Mus musculus BAC clone RP23-90I17 from chromosome 12, complete sequence
          Length = 248983

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 402   aacatggatggatgtatggatggat 426
             |||||||||||||| ||||||||||
Sbjct: 16949 aacatggatggatggatggatggat 16973

to top

>gb|AC124681.3| Mus musculus BAC clone RP24-261H7 from chromosome 16, complete sequence
          Length = 173837

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 402    aacatggatggatgtatggatggat 426
              |||||||||||||| ||||||||||
Sbjct: 165262 aacatggatggatggatggatggat 165238

to top

>gb|AC009600.20| Homo sapiens 2 BAC RP11-436K12 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 217304

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 406    tggatggatgtatggatggat 426
              |||||||||||||||||||||
Sbjct: 105631 tggatggatgtatggatggat 105651

to top

>emb|CR678388.17| Zebrafish DNA sequence from clone CH211-125I3 in linkage group 12,
             complete sequence
          Length = 79224

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 405   atggatggatgtatggatgga 425
             |||||||||||||||||||||
Sbjct: 51626 atggatggatgtatggatgga 51646

to top

>emb|CR352209.10| Zebrafish DNA sequence from clone DKEY-150O13 in linkage group 24,
             complete sequence
          Length = 143425

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 402   aacatggatggatgtatggatggat 426
             |||||||||||||| ||||||||||
Sbjct: 80040 aacatggatggatggatggatggat 80016

to top

>emb|CR762396.8| Zebrafish DNA sequence from clone DKEY-262O12 in linkage group 1,
             complete sequence
          Length = 163635

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 402   aacatggatggatgtatggatggat 426
             |||||||||||||| ||||||||||
Sbjct: 71281 aacatggatggatggatggatggat 71305

to top

>emb|BX897686.8| Zebrafish DNA sequence from clone DKEY-145M5 in linkage group 15,
             complete sequence
          Length = 115533

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 402   aacatggatggatgtatggatggat 426
             |||||||||||||| ||||||||||
Sbjct: 37072 aacatggatggatggatggatggat 37096

to top

>emb|CR381612.5| Zebrafish DNA sequence from clone DKEY-274K7, complete sequence
          Length = 96276

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 402   aacatggatggatgtatggatggat 426
             |||||||||||||| ||||||||||
Sbjct: 33228 aacatggatggatggatggatggat 33252

to top

>emb|AL160410.24| Human DNA sequence from clone RP11-136B8 on chromosome 20 Contains ESs,
             STSs and GSSs, complete sequence
          Length = 63090

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 402   aacatggatggatgtatggatggat 426
             |||||||||||||| ||||||||||
Sbjct: 19646 aacatggatggatggatggatggat 19622

to top

>emb|AL139823.11| Human DNA sequence from clone RP4-703E10 on chromosome 1p36.32-36.33,
             complete sequence
          Length = 118994

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 405   atggatggatgtatggatgga 425
             |||||||||||||||||||||
Sbjct: 57977 atggatggatgtatggatgga 57957

to top

>emb|AL596086.9| Mouse DNA sequence from clone RP23-168C20 on chromosome 11 Contains the
              3' end of the Tex14 gene for testis expressed gene 14,
              complete sequence
          Length = 200501

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 398    agcaaacatggatggatgtatggatggat 426
              |||||| ||||||||||| ||||||||||
Sbjct: 155478 agcaaaaatggatggatggatggatggat 155450

to top

>emb|AL606690.3|OSJN00080 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0060D06,
             complete sequence
          Length = 151506

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 404   catggatggatgtatggatggatcgccgg 432
             |||||||||||| ||||||||||| ||||
Sbjct: 25612 catggatggatggatggatggatcaccgg 25640

to top

>emb|CR381633.6| Zebrafish DNA sequence from clone CH211-230M9 in linkage group 14,
             complete sequence
          Length = 163910

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 406   tggatggatgtatggatggat 426
             |||||||||||||||||||||
Sbjct: 56978 tggatggatgtatggatggat 56998

to top

>emb|CR457458.4| Zebrafish DNA sequence from clone BUSM1-85A12 in linkage group 15,
             complete sequence
          Length = 43537

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 405   atggatggatgtatggatgga 425
             |||||||||||||||||||||
Sbjct: 35923 atggatggatgtatggatgga 35903

to top

>emb|BX546485.12| Zebrafish DNA sequence from clone RP71-39A17 in linkage group 18,
             complete sequence
          Length = 153332

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 406   tggatggatgtatggatggat 426
             |||||||||||||||||||||
Sbjct: 19339 tggatggatgtatggatggat 19319

to top

>emb|BX649426.8| Zebrafish DNA sequence from clone DKEYP-82D11, complete sequence
          Length = 209340

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 405   atggatggatgtatggatgga 425
             |||||||||||||||||||||
Sbjct: 70654 atggatggatgtatggatgga 70634

to top

>emb|CR354560.9| Zebrafish DNA sequence from clone DKEY-109I12 in linkage group 13,
             complete sequence
          Length = 78478

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 405   atggatggatgtatggatgga 425
             |||||||||||||||||||||
Sbjct: 67926 atggatggatgtatggatgga 67946

to top

>emb|BX544890.7| Zebrafish DNA sequence from clone DKEY-240I4 in linkage group 14,
             complete sequence
          Length = 93993

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 406   tggatggatgtatggatggat 426
             |||||||||||||||||||||
Sbjct: 43580 tggatggatgtatggatggat 43600

to top

>gb|AC020912.6| Homo sapiens chromosome 19 clone CTD-2583G20, complete sequence
          Length = 163225

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 402   aacatggatggatgtatggatggat 426
             |||||||||||||| ||||||||||
Sbjct: 68105 aacatggatggatggatggatggat 68129

to top

>emb|BX511308.11| Zebrafish DNA sequence from clone DKEYP-118E10 in linkage group 15,
              complete sequence
          Length = 123109

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 402    aacatggatggatgtatggatggat 426
              |||||||||||||| ||||||||||
Sbjct: 121796 aacatggatggatggatggatggat 121772

to top

>gb|AC104509.6| Drosophila melanogaster X BAC RP98-20K1 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 153604

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 402   aacatggatggatgtatggatggat 426
             |||||||||||||| ||||||||||
Sbjct: 91037 aacatggatggatggatggatggat 91013

to top

>emb|BX470133.27| Zebrafish DNA sequence from clone DKEY-169N7 in linkage group 9, complete
              sequence
          Length = 178929

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 405    atggatggatgtatggatgga 425
              |||||||||||||||||||||
Sbjct: 105510 atggatggatgtatggatgga 105490

to top

>gb|AC018398.10| Homo sapiens chromosome 8, clone RP11-16G12, complete sequence
          Length = 191377

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 404    catggatggatgtatggatggatcg 428
              |||||||||||| ||||||||||||
Sbjct: 138784 catggatggatggatggatggatcg 138808

to top

>gb|AC116426.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0058P18, from chromosome 3, complete sequence
          Length = 155037

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 404   catggatggatgtatggatggatcg 428
             |||||||||||| ||||||||||||
Sbjct: 21706 catggatggatggatggatggatcg 21730

to top

>gb|AC115687.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0091J11, from chromosome 3, complete sequence
          Length = 181163

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 404    catggatggatgtatggatggatcg 428
              |||||||||||| ||||||||||||
Sbjct: 108519 catggatggatggatggatggatcg 108543

to top

>gb|AC016065.14| Homo sapiens chromosome 8, clone RP11-115C21, complete sequence
          Length = 185463

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 404   catggatggatgtatggatggatcg 428
             |||||||||||| ||||||||||||
Sbjct: 28320 catggatggatggatggatggatcg 28344


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,452,453
Number of Sequences: 3902068
Number of extensions: 3452453
Number of successful extensions: 241615
Number of sequences better than 10.0: 772
Number of HSP's better than 10.0 without gapping: 775
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 216040
Number of HSP's gapped (non-prelim): 24277
length of query: 447
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 425
effective length of database: 17,147,199,772
effective search space: 7287559903100
effective search space used: 7287559903100
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result